ID: 1091745124

View in Genome Browser
Species Human (GRCh38)
Location 12:2987065-2987087
Sequence CAAGCTGAACACTTGGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091745115_1091745124 16 Left 1091745115 12:2987026-2987048 CCTGAGAGAGAGCCGAGGAGGTG 0: 1
1: 0
2: 1
3: 30
4: 265
Right 1091745124 12:2987065-2987087 CAAGCTGAACACTTGGTTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 255
1091745118_1091745124 4 Left 1091745118 12:2987038-2987060 CCGAGGAGGTGGAACAGGATATG 0: 1
1: 0
2: 2
3: 22
4: 225
Right 1091745124 12:2987065-2987087 CAAGCTGAACACTTGGTTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091745124 Original CRISPR CAAGCTGAACACTTGGTTTT GGG Intronic
901668947 1:10842926-10842948 AAAGCTGAGCACTTGTTTCTGGG + Intergenic
905605856 1:39299052-39299074 CACGCTGAGCACTTGGTCTCTGG + Intronic
905950641 1:41947629-41947651 CAAGCTTAACACTGGGGCTTGGG - Intronic
907505333 1:54914105-54914127 CAAGCTTAACACTGGGGCTTGGG + Intergenic
908092272 1:60698755-60698777 CAAGAGGAAGACTTGGGTTTTGG + Intergenic
908892714 1:68864019-68864041 CAAGCTGAACACTAGTTGCTGGG + Intergenic
910591297 1:88929997-88930019 CAAGCTCAACACTGGGGCTTGGG - Intergenic
910804743 1:91179242-91179264 CAAGCTTAACACTGGGGCTTGGG - Intergenic
910879260 1:91907745-91907767 CATGCTGAAGTCTTTGTTTTTGG - Intergenic
912463671 1:109854527-109854549 CAAGCTTAACACTGGGGCTTGGG + Intergenic
912637193 1:111308105-111308127 CCATCTGAGCACTTGGTTATTGG - Intronic
913019196 1:114769996-114770018 CAAGCAGAGTTCTTGGTTTTAGG + Exonic
913468759 1:119170174-119170196 CAAGCTTAACACTAGGGCTTGGG + Intergenic
915169447 1:153967795-153967817 GAAGCTGAAGACTTAGGTTTCGG - Intronic
916489059 1:165285559-165285581 CAAGGTGAACACATGCTTATGGG + Intronic
917148581 1:171920212-171920234 GCAGCTAAACACTTGGGTTTTGG + Intronic
917961573 1:180149815-180149837 GTAGATGAACACTTGGTCTTTGG - Intergenic
921449640 1:215289983-215290005 GAAGGTGGAAACTTGGTTTTAGG + Intergenic
922685127 1:227632988-227633010 CAAGCTGAACACTAGTTTCTGGG - Intronic
1063307654 10:4920384-4920406 AAAGCTCAACACTTGGTTTTAGG - Intergenic
1064341256 10:14487636-14487658 AAAGATGAATACTTGCTTTTGGG + Intergenic
1065199310 10:23298430-23298452 CAAGCTTAACACTGGGGCTTGGG + Intronic
1068791567 10:61036043-61036065 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1069037934 10:63664826-63664848 CAAGCTGAACACTAGTTGCTAGG - Intergenic
1071027763 10:81136708-81136730 CAAATTCAACACCTGGTTTTGGG + Intergenic
1071721596 10:88152157-88152179 CTTGCTGAACACTTGAGTTTAGG + Intergenic
1072377848 10:94836437-94836459 CAAGCTTAACACTGAGTCTTGGG + Intronic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1076078697 10:127558379-127558401 AAAGCTGCACACTTGGCTTGGGG - Intergenic
1078693920 11:13610262-13610284 CACACAGAACACTTGTTTTTGGG - Intergenic
1079601061 11:22314002-22314024 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1080625035 11:34021345-34021367 GAAGCTGACTCCTTGGTTTTGGG - Intergenic
1081010456 11:37804893-37804915 CCAGCTGTAGACATGGTTTTGGG - Intergenic
1085209813 11:74765840-74765862 TCAGTTGACCACTTGGTTTTGGG - Intronic
1085601514 11:77860162-77860184 CAAGCTTAACACTGGGGCTTGGG + Intronic
1086371057 11:86156335-86156357 CAGGCTGAATGCTAGGTTTTGGG - Intergenic
1086441732 11:86835449-86835471 CAAGCTTAACACTGGGGCTTGGG + Intronic
1086511180 11:87559747-87559769 CAAGCTGAACACTAGTCTCTGGG - Intergenic
1087263928 11:96041124-96041146 CATTCTGAACACATGGATTTTGG + Intronic
1088265331 11:107983006-107983028 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1090750206 11:129739986-129740008 CCAGCTGCACACTTGGATTTTGG - Intergenic
1090756525 11:129796641-129796663 CAAGCCCAGCACTAGGTTTTGGG + Intergenic
1091069355 11:132548687-132548709 CAAGTAGTTCACTTGGTTTTTGG - Intronic
1091745124 12:2987065-2987087 CAAGCTGAACACTTGGTTTTGGG + Intronic
1092469197 12:8763321-8763343 CAAGCTTAACACTGGGGCTTGGG + Intronic
1093207330 12:16266206-16266228 CAAGCTGTACACTTGACTTGTGG + Intronic
1094198224 12:27771324-27771346 GAAGCTGAACACTGGAGTTTAGG + Intergenic
1094806711 12:34101078-34101100 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1095125558 12:38472543-38472565 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1096351821 12:50907104-50907126 CAAGCTTAACACTGGGACTTGGG + Intergenic
1097377003 12:58854178-58854200 CAAGCTTAACACTGGGGCTTAGG + Intergenic
1098901365 12:76115104-76115126 GGAGATGAGCACTTGGTTTTAGG + Intergenic
1098909046 12:76190705-76190727 TATGCTGAACACCTGTTTTTTGG - Intergenic
1100192839 12:92211276-92211298 CAAGCAGATCACTTGGGTTCAGG - Intergenic
1100676919 12:96878382-96878404 CAACCTGCACACTCGGTGTTTGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103803363 12:123553999-123554021 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1104851241 12:131875515-131875537 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1105017581 12:132795262-132795284 CAGGCAGATCACTTGGGTTTAGG + Intronic
1108311032 13:49190957-49190979 CAATCTGATTATTTGGTTTTGGG + Intronic
1108876928 13:55059176-55059198 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1109380869 13:61558131-61558153 CAAGCTGAACACTAGTTGCTGGG - Intergenic
1109680681 13:65748297-65748319 CGAGCTGAACACTAGTTGTTGGG - Intergenic
1111354731 13:87083452-87083474 CCATCTGAACTCATGGTTTTGGG + Intergenic
1113882489 13:113635464-113635486 CAAGTGGAACACTTGGTTTGGGG + Intronic
1114031760 14:18585302-18585324 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1114076532 14:19164331-19164353 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1114085632 14:19235237-19235259 CCAGGTGAACACCAGGTTTTAGG + Intergenic
1114384565 14:22241820-22241842 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1115405582 14:33011842-33011864 CAAGGTGTACTCTTGGTTTGTGG + Intronic
1117017108 14:51529058-51529080 CAAGATGAATAGTTGGTCTTGGG + Intronic
1117672690 14:58124242-58124264 CAAGCTTAACACTGGGGCTTGGG - Intronic
1119403600 14:74381344-74381366 CAAGCTGTATACTTGTGTTTGGG + Intergenic
1119822261 14:77627215-77627237 CAACCTGAACACAAGATTTTCGG - Intergenic
1120107955 14:80517801-80517823 CAAGCTGAACACTAGTTGCTAGG - Intronic
1120172551 14:81260087-81260109 CCAGGTGAAGACTTGGTGTTGGG + Intergenic
1122180042 14:99948224-99948246 CAAGCAGATCACTTGATGTTAGG + Intergenic
1202897843 14_GL000194v1_random:20337-20359 CCAGGTGAACACCAGGTTTTAGG + Intergenic
1124357072 15:29003654-29003676 GAATCTGCACACGTGGTTTTGGG + Intronic
1125471511 15:40008822-40008844 CAAGCAGAACATGTGTTTTTAGG + Intronic
1127074040 15:55309040-55309062 CAAGCTTAACACTGGGGCTTGGG + Intronic
1129726517 15:77904304-77904326 CAAGAGGAACACTTGCTTCTGGG - Intergenic
1131466464 15:92658931-92658953 CAAACTTTACACTTGGTCTTTGG + Intronic
1133500245 16:6359042-6359064 CAAGCTGAGCATTTGTTATTAGG - Intronic
1134443266 16:14311921-14311943 CACGCTGAATACTTGGTGTTAGG + Intergenic
1135480543 16:22817383-22817405 CAAGCTAAACACTTGACTCTAGG - Intronic
1137513379 16:49120779-49120801 CAAGCTCAGCTCTTGGTTTGTGG + Intergenic
1139326988 16:66160338-66160360 CCAGCTGCACACTTGGTGTGTGG - Intergenic
1139772337 16:69288205-69288227 CAAGTTGCACTCTTGATTTTGGG - Intronic
1139933827 16:70552582-70552604 GAAGCTAGATACTTGGTTTTTGG - Intronic
1141100859 16:81196608-81196630 CAAGCTGGACCCTTGGTATCTGG + Intergenic
1142557423 17:789208-789230 CAATTTTAACACTTGGTTTCTGG + Intronic
1142822515 17:2481892-2481914 TAAGCTAAACAATTGATTTTGGG + Intronic
1143119987 17:4600442-4600464 CAAGGTGAACCCGTGGTTTGGGG - Intronic
1144892404 17:18501444-18501466 AAAGCAGGACACTTGGTCTTGGG + Intergenic
1145139810 17:20442844-20442866 AAAGCAGGACACTTGGTCTTGGG - Intergenic
1145302956 17:21653642-21653664 CTAGGTGAACACTAGGTCTTAGG + Intergenic
1145347084 17:22048199-22048221 CTAGGTGAACACTAGGTCTTAGG - Intergenic
1148576406 17:48714442-48714464 CAATCTGACCACTTGCTTGTGGG + Intergenic
1149112908 17:53055395-53055417 CAAGTTGAACATCTGGCTTTAGG - Intergenic
1149273836 17:55013289-55013311 CAAGCTTAACACTGGGACTTGGG + Intronic
1150957905 17:69881969-69881991 CAAGATCCACACTTGGGTTTTGG - Intergenic
1152283523 17:79399161-79399183 CCTGCTGACCCCTTGGTTTTGGG + Intronic
1152546062 17:81000590-81000612 GAAGCTGAAGACCTGGGTTTGGG + Intronic
1153591608 18:6679894-6679916 CAGGCTGATCACTTGATGTTAGG + Intergenic
1156678159 18:39556652-39556674 CAAGCTAAACACTGGTTCTTTGG - Intergenic
1157286748 18:46382156-46382178 GTATCTGAACACTTGGTTGTTGG + Intronic
1158785933 18:60711820-60711842 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1160330053 18:77983114-77983136 CAAGCAGGACAGTTGGTTATGGG + Intergenic
1161128000 19:2570778-2570800 CAAGCTGAACATCTGTTTTTAGG - Intronic
1162119238 19:8452093-8452115 GAAGCTGAGCATTTGGTTTGGGG - Intronic
1162850637 19:13428708-13428730 GTAGCTGAACATTTGGATTTGGG - Intronic
1163923146 19:20312498-20312520 CAAGCAGATCACTTGATTTCAGG - Intergenic
1167087634 19:47321016-47321038 CAAGGTGAACACTTCCTTCTAGG + Exonic
926847844 2:17161570-17161592 AAAACTGAACACTTGGTTTAGGG - Intergenic
928348217 2:30520051-30520073 CGAGCTGAACACTTGTCTCTGGG + Intronic
928677350 2:33662575-33662597 CAAGCTTAACACTGGGGTTTGGG - Intergenic
929170973 2:38933232-38933254 CAAGCTTATCACCTGGTTATTGG + Intronic
930529052 2:52569060-52569082 TAAGATGAACATGTGGTTTTTGG + Intergenic
932280945 2:70491384-70491406 CAAGCTGAAAACTTTGGTTTGGG - Intronic
932917932 2:75877171-75877193 CAAGCTTAACACTGGGGCTTGGG - Intergenic
934036094 2:88089507-88089529 CAAGCTGACCATGTGGCTTTTGG - Intronic
934671886 2:96219361-96219383 CAAGCTTAACACTGGGGCTTGGG + Intergenic
934740320 2:96716467-96716489 TAAGCTGACCATTTGCTTTTGGG + Intronic
935309857 2:101772909-101772931 CATGCTGCTCACTTGCTTTTAGG + Intronic
936463464 2:112727618-112727640 CAGGCTGCACACTTGGCTTTTGG - Intronic
937717491 2:125050270-125050292 CAAGCTGAATTCATGGTTTCTGG + Intergenic
938490224 2:131757258-131757280 CCAGGTGAACACATGGTCTTAGG - Intronic
938491126 2:131761847-131761869 CCAGGTGAACACCAGGTTTTAGG - Intronic
938496438 2:131800490-131800512 CCAGGTGAACACCAGGTTTTAGG + Intronic
940111777 2:150162681-150162703 CATGCTGTACACTTGCATTTTGG + Intergenic
940227455 2:151414639-151414661 CAAGCTGTACACATGGCCTTTGG + Intronic
940255100 2:151719908-151719930 CAAACTGAAGACTTCATTTTAGG + Intronic
942339956 2:174933323-174933345 CAACCTGATCTCTTGATTTTGGG - Intronic
943850363 2:192713201-192713223 CAAGTTGAATACCTTGTTTTAGG - Intergenic
1168741143 20:192580-192602 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1171520478 20:25771334-25771356 CTAGGTGAACACTAGGTCTTAGG + Intronic
1171556441 20:26085159-26085181 CTAGGTGAACACTAGGTCTTAGG - Intergenic
1173088087 20:39943788-39943810 CAAGCTAAACTTTTGGTTTATGG - Intergenic
1174684756 20:52443444-52443466 CAACTTCAACATTTGGTTTTAGG - Intergenic
1174977369 20:55350326-55350348 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1176617527 21:9036326-9036348 CCAGGTGAACACCAGGTTTTAGG + Intergenic
1176707398 21:10126266-10126288 CCAGGTGAACACATGGTCTTAGG - Intergenic
1176708262 21:10130707-10130729 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1177263260 21:18755067-18755089 CAAGCTCAACACTGGGGCTTGGG + Intergenic
1177896515 21:26860163-26860185 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1178130149 21:29563190-29563212 AAAGCTTAAAACATGGTTTTGGG + Intronic
1178225588 21:30714102-30714124 AAAGCTGAACAGTTGGTTTGTGG - Intergenic
1180292341 22:10857956-10857978 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1180455874 22:15512359-15512381 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1180495147 22:15887378-15887400 CCAGGTGAACACCAGGTTTTAGG - Intergenic
951172862 3:19562612-19562634 CAAAATGAAAACTAGGTTTTAGG + Intergenic
951724647 3:25743631-25743653 CAAGCAGAACACTAAGTGTTGGG - Intronic
955327773 3:58022368-58022390 CCAGTGGAACACTTCGTTTTTGG + Intronic
957000024 3:74874710-74874732 CAAGCTTAACACTGGGGCTTGGG + Intergenic
961074482 3:123969160-123969182 CCAGCTGAACCCTGGGGTTTTGG + Exonic
961705763 3:128783845-128783867 CATGCTGAACACTTCTTTTTAGG + Intronic
961828087 3:129608961-129608983 CAAGCTGAGCAGTGGGGTTTAGG + Intergenic
962206966 3:133442753-133442775 CAAGATGATCCCTTGGTTTCCGG + Intronic
962495709 3:135937006-135937028 CAAGCTTAACACTGGGGCTTGGG - Intergenic
963188221 3:142441386-142441408 CAAGCTTAACACTGGGGCTTGGG - Intronic
963891619 3:150641962-150641984 CAAAATGAAAAGTTGGTTTTTGG + Intergenic
964965959 3:162494343-162494365 AAACTTGAACACCTGGTTTTTGG - Intergenic
965054546 3:163696795-163696817 CAAGCTTAACACTGGGGCTTGGG + Intergenic
965504557 3:169498467-169498489 AAAGATGAACAGTAGGTTTTGGG + Intronic
966353766 3:179057941-179057963 CAAGCTTAACACTGGGACTTGGG - Intronic
966465378 3:180225723-180225745 TGAGCTGATCACTTTGTTTTAGG - Intergenic
967623808 3:191663687-191663709 CAAGCTTAACACTGGGGTTTGGG - Intergenic
969338519 4:6526421-6526443 CAAGTTTAACAGTTTGTTTTTGG + Intronic
969852536 4:9971457-9971479 TAAACTTAACACTTGATTTTAGG + Intronic
972328033 4:38036606-38036628 AAAACTGCACACTTGGTTTAGGG - Intronic
972781098 4:42287689-42287711 CAAGCTTAACACTGGGGCTTGGG + Intergenic
973065030 4:45779349-45779371 CAGGCTGCAAAGTTGGTTTTGGG + Intergenic
973818228 4:54638817-54638839 CAATCAGAAGACTTGGTTCTAGG + Intergenic
975313549 4:72928421-72928443 CAAGCTTAACACTGGGGCTTGGG + Intergenic
975645572 4:76542681-76542703 CTAGCTGACACCTTGGTTTTAGG + Intronic
977187294 4:93955633-93955655 GCAGCTGAAAACATGGTTTTTGG - Intergenic
978586540 4:110281080-110281102 CAAGCTTAACACTGGGGCTTGGG + Intergenic
978909821 4:114049922-114049944 CAAGCTTAACACTGGGTCTTGGG - Intergenic
979844109 4:125486555-125486577 CAAGATGAACATTTGGTTCAGGG - Intronic
980347738 4:131644554-131644576 AAAGGTGAAAACTTGGTTTTTGG + Intergenic
980444476 4:132887240-132887262 CAAGCTTAACACTGGGGCTTGGG - Intergenic
980773952 4:137415305-137415327 CACACTGAGTACTTGGTTTTTGG - Intergenic
981210229 4:142094628-142094650 AAAGGTGAGCCCTTGGTTTTTGG - Intronic
981806857 4:148726331-148726353 TAACCTGAACACTTATTTTTGGG + Intergenic
981971424 4:150667008-150667030 CTGGCAGAGCACTTGGTTTTTGG - Intronic
982717430 4:158823782-158823804 CAAGCTGAACAACTGAGTTTTGG + Intronic
984514869 4:180725680-180725702 CAGTCAGAACACTTTGTTTTGGG + Intergenic
984723994 4:183002503-183002525 CAAGCTTAACACTGGGGCTTGGG - Intergenic
985589824 5:758645-758667 CCAGCTGAACCCTTGTTTCTGGG - Intronic
986133467 5:4952248-4952270 CAAGGTAAACACTTTGGTTTAGG + Intergenic
987129643 5:14848691-14848713 CAAGCTGAACACTAGTTGCTGGG + Intronic
991238626 5:64429590-64429612 CAAGATGAAAAGTTGCTTTTTGG + Intergenic
991364377 5:65853195-65853217 CAACTTGAACAATTGTTTTTAGG - Intronic
992160838 5:73999734-73999756 CAATCTGGAAACTTGGTATTTGG + Intergenic
992943301 5:81784502-81784524 AAAGTTGAACAGTTTGTTTTGGG - Intergenic
993697287 5:91076720-91076742 AAAGCTGAACATGTAGTTTTGGG - Intronic
993746199 5:91600203-91600225 CAAGCTGAAACCATGGTTTGGGG + Intergenic
995551547 5:113286675-113286697 CAAACTCAACATATGGTTTTTGG + Intronic
995662099 5:114496305-114496327 GAACCTGAACACTAAGTTTTAGG + Exonic
997640416 5:135445248-135445270 CAAGCAGAACCCTGGGGTTTTGG - Exonic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
999624081 5:153501754-153501776 GAAGCTGATGACTTGGTTTAGGG + Intronic
1000107183 5:158071211-158071233 CAAGCTAAACAATTGGTTCAAGG - Intergenic
1002890966 6:1331466-1331488 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1004115323 6:12761048-12761070 CAAGCAGCAGACTTGGGTTTTGG - Intronic
1004546722 6:16604880-16604902 CCAGCTGACCACCTGGATTTTGG + Intronic
1006099793 6:31679487-31679509 CCAGCAGAGCACTTGGTGTTAGG + Intronic
1008479784 6:51973736-51973758 CAAGTTGAACAATTCATTTTTGG - Intronic
1009545046 6:65010071-65010093 CAAGCTTAACACTGGGGCTTGGG - Intronic
1009567532 6:65329662-65329684 CAAGTTGAATAGTTGGTTTTAGG - Intronic
1009647168 6:66420386-66420408 CAAGATTAACACTTGGCTATAGG + Intergenic
1009700369 6:67169980-67170002 TAAGATGATCATTTGGTTTTTGG - Intergenic
1011143333 6:84184981-84185003 AAATCTGAAGAATTGGTTTTGGG - Intronic
1011189519 6:84715133-84715155 CAAGCTTAACACTGGGGCTTGGG + Intronic
1013022499 6:106233436-106233458 CAAGCTAAACACTGGGGCTTGGG - Intronic
1013543812 6:111136197-111136219 CAAGCTTAACACTGGGGCTTGGG - Intronic
1016033279 6:139359562-139359584 CAATGAGAACACATGGTTTTTGG - Intergenic
1016444454 6:144118207-144118229 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1017906792 6:158761986-158762008 CTAGCTGAGCTCTCGGTTTTGGG + Intronic
1018761305 6:166896376-166896398 CAAGCTGAACACTGGGGCTTGGG - Intronic
1018952177 6:168386404-168386426 CAAGCTGAATTCTTGCTTTCAGG + Intergenic
1019941688 7:4297227-4297249 CATGCTGGACGGTTGGTTTTGGG + Intergenic
1020630867 7:10637808-10637830 CTCCCTGAACACTGGGTTTTTGG - Intergenic
1020960973 7:14800987-14801009 ATAGCTGATCACATGGTTTTAGG - Intronic
1021620106 7:22542817-22542839 CAAGCCCAACACCTGGTTCTCGG + Intronic
1021680210 7:23122392-23122414 CAACTTGATCACTTGTTTTTTGG + Intronic
1023600128 7:41874495-41874517 CAAGCTGACCTTTTGGCTTTAGG - Intergenic
1024339564 7:48243423-48243445 GAAGCTGGACACATGGCTTTTGG - Intronic
1028659756 7:93256017-93256039 AAAGCTGAAAACATGTTTTTTGG - Intronic
1028723074 7:94056295-94056317 CAAGCTGAACACATTGGCTTTGG + Intergenic
1030843239 7:114380969-114380991 CAAGCTTAACACTGGGACTTGGG + Intronic
1031264816 7:119568939-119568961 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1031996119 7:128232355-128232377 CATGCAGAACTTTTGGTTTTTGG - Intergenic
1034796351 7:154017158-154017180 CAAGAGGAACACTTGTGTTTAGG - Intronic
1037672499 8:21027390-21027412 CATGGTGAACACTTGGCTTAGGG + Intergenic
1040527488 8:48237819-48237841 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1041663608 8:60422175-60422197 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1042032431 8:64491032-64491054 CAATCAGAGCACCTGGTTTTAGG + Intergenic
1043490231 8:80741284-80741306 CAAGCTTAACACTGGGGCTTGGG - Intronic
1044801467 8:95961557-95961579 CACACTGAACACTTGGACTTGGG + Intergenic
1047289006 8:123512935-123512957 AAAGCTGGAAACTTGGCTTTTGG - Intronic
1048443626 8:134477723-134477745 CAAGTTGAAATCTTGGATTTGGG - Intergenic
1048631521 8:136247819-136247841 CAAGCTGAACACTAGTTGCTGGG + Intergenic
1049516830 8:143063872-143063894 GAAGCTGAAAAGTTGGTTTGGGG - Intergenic
1050516499 9:6449729-6449751 TATGCTGAACACTTGCTTCTGGG + Intronic
1051245217 9:15103270-15103292 AAAACTGGAGACTTGGTTTTTGG - Intergenic
1053134604 9:35642620-35642642 CAAGCTTAACACTGGGGCTTGGG + Intronic
1053644585 9:40112986-40113008 CCAGGTGAACACATGGTCTTAGG - Intergenic
1053645224 9:40116221-40116243 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1053760491 9:41347307-41347329 CCAGGTGAACACCAGGTTTTAGG + Intergenic
1053761397 9:41351865-41351887 CCAGGTGAACACATGGTCTTAGG + Intergenic
1054325607 9:63710866-63710888 CCAGGTGAACACATGGTCTTAGG - Intergenic
1054326246 9:63714119-63714141 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1054350170 9:64013410-64013432 CCAGGTGAACACATGGTCTTAGG + Intergenic
1054539347 9:66259750-66259772 CCAGGTGAACACCAGGTTTTAGG + Intergenic
1054539991 9:66262983-66263005 CCAGGTGAACACATGGTCTTAGG + Intergenic
1060420108 9:123462389-123462411 CATGCTGCACACCTGGGTTTGGG - Intronic
1060912313 9:127360973-127360995 CTAGAGGAGCACTTGGTTTTGGG - Intronic
1062531613 9:137003667-137003689 CAAGCTGAACTCCTGATTTCAGG + Intergenic
1202792145 9_KI270719v1_random:95146-95168 CCAGGTGAACACATGGTCTTAGG - Intergenic
1202793023 9_KI270719v1_random:99676-99698 CCAGGTGAACACCAGGTTTTAGG - Intergenic
1186545300 X:10442870-10442892 AAACCTGAACCTTTGGTTTTTGG + Intergenic
1189749193 X:44202592-44202614 CAAGCTGGCCACCTGATTTTGGG - Intronic
1191167458 X:57405388-57405410 CAAGCTGAACACTAGTTGCTGGG - Intronic
1193306955 X:79961200-79961222 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1195630932 X:107054449-107054471 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1195989281 X:110666623-110666645 CAAGCACAACACTTGCTTCTGGG - Intergenic
1197954553 X:131931914-131931936 CAAGCTTAACACTGGGGCTTGGG + Intergenic
1198367987 X:135962134-135962156 CAAACTAAACACGTGTTTTTGGG - Exonic
1198765797 X:140078145-140078167 CAAGCTTAACACTGGGGCTTGGG - Intergenic
1199109893 X:143919122-143919144 CAAACTTTACACTTGGATTTTGG - Intergenic
1201905875 Y:19085177-19085199 CAAGCTTAACACTGGGGCTTGGG - Intergenic