ID: 1091751096

View in Genome Browser
Species Human (GRCh38)
Location 12:3021666-3021688
Sequence ACTCCTTTTGTTTTACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091751096_1091751102 28 Left 1091751096 12:3021666-3021688 CCAGGATGTAAAACAAAAGGAGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1091751102 12:3021717-3021739 GGGGAAACTATGGCCCAGAAAGG 0: 1
1: 2
2: 49
3: 386
4: 1992
1091751096_1091751098 8 Left 1091751096 12:3021666-3021688 CCAGGATGTAAAACAAAAGGAGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1091751098 12:3021697-3021719 ACCATCTCTATTTTACTCATGGG 0: 1
1: 0
2: 3
3: 36
4: 292
1091751096_1091751100 9 Left 1091751096 12:3021666-3021688 CCAGGATGTAAAACAAAAGGAGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1091751100 12:3021698-3021720 CCATCTCTATTTTACTCATGGGG 0: 1
1: 0
2: 9
3: 69
4: 700
1091751096_1091751097 7 Left 1091751096 12:3021666-3021688 CCAGGATGTAAAACAAAAGGAGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1091751097 12:3021696-3021718 TACCATCTCTATTTTACTCATGG 0: 1
1: 0
2: 3
3: 22
4: 312
1091751096_1091751101 18 Left 1091751096 12:3021666-3021688 CCAGGATGTAAAACAAAAGGAGT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1091751101 12:3021707-3021729 TTTTACTCATGGGGAAACTATGG 0: 1
1: 4
2: 87
3: 944
4: 4710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091751096 Original CRISPR ACTCCTTTTGTTTTACATCC TGG (reversed) Intronic
901147741 1:7078232-7078254 ACTACTTCTGTTTTATATTCAGG + Intronic
903825245 1:26140138-26140160 GCTCCCTGTGTTTCACATCCTGG - Intergenic
905530799 1:38677257-38677279 ACTCCTTTGGTTTTATGTCCTGG - Intergenic
906740682 1:48180830-48180852 AATCCTTTTATTTTAGCTCCAGG + Intergenic
908151630 1:61308623-61308645 AATCATTTAGGTTTACATCCTGG + Intronic
909665892 1:78133021-78133043 GCTACTCTTCTTTTACATCCTGG + Intronic
911831815 1:102559482-102559504 TCTCCTTTTGTTTATCCTCCTGG + Intergenic
913936508 1:125057824-125057846 ACTCCTTTTGTCTAACCTGCTGG + Intergenic
914945900 1:152065930-152065952 ACTCCTTTTTTTTTTTTTCCTGG + Intergenic
916045060 1:160993698-160993720 ATGCCTTCTGTTTTTCATCCCGG + Intergenic
916517162 1:165530105-165530127 ACTCCTTATTGTCTACATCCTGG - Intergenic
919035561 1:192304151-192304173 ACTGCTTTTGTTTTACAATCAGG + Intergenic
919624072 1:199894385-199894407 TCTCCTTTTGGTTTAAATTCTGG + Intergenic
921032438 1:211345369-211345391 CCTCCTTTTTTTTTGCTTCCTGG + Intronic
921548819 1:216507783-216507805 ACACCATTTGTTTTTCATCAGGG - Intronic
924778065 1:247124801-247124823 ATTCCTTTTGTTTTAGAGACAGG + Intronic
1068794492 10:61063747-61063769 ACTCATTTATTTTTACATCTGGG - Intergenic
1069197257 10:65568202-65568224 AATCCTTTGGTTTTACCTTCTGG - Intergenic
1070382900 10:75897585-75897607 AGTCCTTTCATTTTACAGCCAGG + Intronic
1071120120 10:82267135-82267157 ACTCCTTTGGTTTGACAAGCAGG + Intronic
1072769908 10:98129110-98129132 ACTGTTTTTCTTTTGCATCCTGG - Intergenic
1072974503 10:100046061-100046083 ACTTCTTTGATTTTACAGCCTGG - Intronic
1074293928 10:112165154-112165176 TCTCCTTTTATTCTACTTCCTGG - Intronic
1075202446 10:120416269-120416291 ACACATTTTCTTTTACTTCCTGG + Intergenic
1075963841 10:126593181-126593203 ATTCCTTTTGGTATATATCCAGG - Intronic
1080364596 11:31558139-31558161 ACTCTTTTTTTTTTTCTTCCTGG + Intronic
1081408843 11:42731227-42731249 ACTATTTTTGTTTTATAACCTGG - Intergenic
1082593750 11:55048337-55048359 ATTCCTTCTGATTTTCATCCTGG + Intergenic
1085025098 11:73231743-73231765 ATTCCCTTTATTTTAGATCCTGG - Intronic
1085148809 11:74230890-74230912 ACAGTTTTTGTTTAACATCCAGG + Exonic
1087195579 11:95301339-95301361 TCTCCTTTTGTCTTACCTCTTGG - Intergenic
1087348308 11:96999365-96999387 ATTGCTTTTGTTTTACATTTGGG - Intergenic
1087435485 11:98112170-98112192 AATCCTTTGGGTTTACACCCAGG - Intergenic
1087578619 11:100024006-100024028 ACTCCTTTTGTTATATACCAAGG + Intronic
1087746386 11:101952369-101952391 TCTCCTTTTCTTTTCCATTCTGG - Intronic
1089380147 11:118024254-118024276 ACTCTTTTTTTATTACATCAAGG + Intergenic
1091080760 11:132665467-132665489 ACTCCTTTCATTTTCCTTCCCGG - Intronic
1091751096 12:3021666-3021688 ACTCCTTTTGTTTTACATCCTGG - Intronic
1091841141 12:3621693-3621715 GCTCCTTTATTTTTATATCCAGG - Intronic
1092594457 12:9986158-9986180 TCTCTTCTTGTTTTACTTCCAGG - Intronic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1093820592 12:23613268-23613290 TCTGCTTTTGATTTGCATCCAGG - Intronic
1095584104 12:43832049-43832071 ACTCCATTTCTTTTATATGCAGG - Intergenic
1098513548 12:71347196-71347218 ATGCCTTTTATGTTACATCCAGG - Intronic
1100102950 12:91131662-91131684 ATTCCTCTTGTTTAACATTCAGG + Intergenic
1101887951 12:108684913-108684935 AATTGTTTTGTTTTACATCAGGG + Intronic
1105835360 13:24206423-24206445 ATTCCTTTTCCTTTACAACCTGG - Intronic
1105985410 13:25561369-25561391 ATTTTTTTTGTTTTACTTCCTGG + Intronic
1106679651 13:31997066-31997088 CCTTCTTTTTTTTTAAATCCTGG - Intergenic
1108151447 13:47539988-47540010 GCTCTTGGTGTTTTACATCCTGG - Intergenic
1108477711 13:50837334-50837356 ACTACTTATGTTTGACATCTTGG - Intronic
1108821456 13:54355739-54355761 GCTCCTTTTCTTTCACCTCCTGG - Intergenic
1108995206 13:56722839-56722861 ACTCTTGGTGTTTTACATTCTGG - Intergenic
1109976212 13:69835774-69835796 ACACATTTTATTTTATATCCTGG - Intronic
1110724338 13:78802329-78802351 ATTCCTTATGTTTTAAATACAGG + Intergenic
1111469875 13:88666141-88666163 GCTTCTTTTGTTTAACATCATGG + Intergenic
1112000249 13:95203296-95203318 AGTCCATTTGTTTCACAGCCTGG + Intronic
1112816032 13:103274713-103274735 ACTCCAGATGTTTTACATACAGG + Intergenic
1115639449 14:35323407-35323429 ACTCCATTTATTTTACATTCTGG + Intergenic
1117999234 14:61507428-61507450 ATTCCTTTGGTTATAGATCCAGG - Intronic
1118119609 14:62824623-62824645 TCTACTTTTATTTTACATTCAGG + Intronic
1121001461 14:90454542-90454564 TCTCCCATTGGTTTACATCCTGG + Intergenic
1121773513 14:96574188-96574210 AATTCCATTGTTTTACATCCTGG + Intergenic
1122674376 14:103398933-103398955 ACTTCTTTTGTTTTACAGAAGGG + Intronic
1125702247 15:41697375-41697397 GCTCCATTTCTTTTACCTCCTGG + Intronic
1130365320 15:83232824-83232846 GATGCTTTTGGTTTACATCCTGG - Intergenic
1132055018 15:98644700-98644722 TCTCCTTTTGATTTACATTTGGG + Intergenic
1133148544 16:3808745-3808767 ACTTCTTGTGTTTTACAGTCAGG - Intronic
1133401031 16:5487159-5487181 GCTCCTTGTGTTTTTCTTCCTGG + Intergenic
1134419732 16:14074832-14074854 TCTCCATTTGTTTTACATAAAGG - Intronic
1134594866 16:15488156-15488178 ACTGCTTTTGTGTTACAGCAGGG - Intronic
1135729970 16:24886012-24886034 ACTCCTATTTGTTTTCATCCTGG - Intronic
1138889497 16:61125132-61125154 ACTCTTTTTCTTTTTCATACAGG + Intergenic
1140276406 16:73512745-73512767 ACTGCTTTTGCTTTGCATTCAGG + Intergenic
1140691859 16:77492229-77492251 ATTCCTTGTGTTTTCCATTCTGG - Intergenic
1141266088 16:82498542-82498564 ACCCCCTTTGTCTTACATCAGGG - Intergenic
1141853372 16:86663971-86663993 ACTTGTTTTGTTTTGCAACCTGG + Intergenic
1149094797 17:52827752-52827774 TTTCATCTTGTTTTACATCCTGG - Intergenic
1149134892 17:53352734-53352756 ACTTCTTTTCTTTTTAATCCAGG - Intergenic
1149364684 17:55931169-55931191 TCTGCTTTTACTTTACATCCAGG - Intergenic
1153475201 18:5491447-5491469 CCTGCTTTTGTCTTAAATCCAGG + Intronic
1153961533 18:10144141-10144163 TCTCCTTTTATTTTAGATCTAGG + Intergenic
1154418364 18:14199762-14199784 GCTCCTTTTTTTTTAAATCAAGG + Intergenic
1156876197 18:42015522-42015544 ACTTCTTTTGTTTTTGATGCAGG - Exonic
1157299080 18:46466797-46466819 CCTCCTTACGTTTTGCATCCTGG + Intergenic
1158031229 18:52967230-52967252 AGTCCTATTGTTTTACTTCATGG + Intronic
1158199186 18:54921400-54921422 ACTTCTTTTGTTTTCTTTCCAGG - Intronic
1158241500 18:55383758-55383780 ACTCTTTTTCTTTTACCGCCAGG - Intronic
1158855218 18:61537169-61537191 ATTCCTTTTTTTTTCCATACTGG + Intronic
1159508854 18:69369906-69369928 CCTGCTTTTATTTTACATCATGG + Intergenic
1164251821 19:23483730-23483752 CCTCCTTTTGTCATACAACCTGG - Intergenic
1164793180 19:31005133-31005155 ACACATTTTGTTTTGAATCCTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1167653551 19:50748038-50748060 TCTCCTTTTATTTTAGATTCAGG - Intergenic
928337813 2:30413192-30413214 ACTCCCTTAGTTTTTCATCTGGG + Intergenic
930273695 2:49286097-49286119 ACTCCTTTTGCTTTGCATATAGG - Intergenic
931009129 2:57887521-57887543 ACTCTTTTTTATTTAAATCCAGG - Intergenic
932059302 2:68479618-68479640 ACTGCTTTTCTTTTACAACATGG + Intronic
932311573 2:70746647-70746669 ACTCCAATTGTTTTCCCTCCCGG - Intronic
933889007 2:86748223-86748245 ACTCCTTTTGTTATAACTGCAGG - Intronic
934490547 2:94759638-94759660 ACTCCTTCTCATTTTCATCCTGG + Intergenic
938861780 2:135376868-135376890 TCACATTTTGTTTTCCATCCTGG - Intronic
938972726 2:136447055-136447077 ACTCTTTTTTTTTTAAATGCTGG + Intergenic
940397941 2:153213985-153214007 ATTCCTTTTGTCTAACATCGGGG - Intergenic
944274834 2:197824357-197824379 ACTCCTTTTTTTTTTCACCCTGG + Intronic
945810263 2:214541248-214541270 TCTCATTTTGTTTTTCATCTTGG + Intronic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
946822467 2:223644310-223644332 GCTCCCATTGTTTTACATTCAGG - Intergenic
948568373 2:238900837-238900859 CCTCCTCTTGTTTTCCTTCCTGG + Intronic
948934415 2:241153385-241153407 AATCCTTTTGACTTACAACCGGG + Intronic
1169926158 20:10786448-10786470 ACTCTTTTTGTGTAACATCAGGG - Intergenic
1175574657 20:60051984-60052006 TCTGCTTTTGTTTTACTGCCAGG - Intergenic
1177299492 21:19223674-19223696 AATCTTTTTTTTTTAAATCCTGG - Intergenic
1177371307 21:20207277-20207299 ATTCCTTTCGTTTTACATAAAGG - Intergenic
1179087993 21:38237414-38237436 TCTCCTTTTGTTCCATATCCAGG - Intronic
1179917187 21:44485183-44485205 ACCCCTTTTGTTTGTCAGCCAGG + Intergenic
1181689080 22:24548443-24548465 TCTTCATCTGTTTTACATCCTGG - Intronic
1182674096 22:32024033-32024055 ACTCCTCTTTTCTTACTTCCTGG - Intergenic
949389382 3:3542396-3542418 ACTGCATTTGATTTACTTCCAGG + Intergenic
949468761 3:4371580-4371602 ACTCCTTTTGCTCTTCATCTTGG + Intronic
950087957 3:10274128-10274150 ACTCCTGTTGTTTTTCAGCTGGG + Intronic
951941334 3:28082090-28082112 CCTCATTTTGTCTTAAATCCTGG - Intergenic
953001793 3:38940966-38940988 CCTCCTTTTGTTTACCTTCCAGG - Intronic
953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG + Intronic
953762448 3:45700441-45700463 GCTGCTTTACTTTTACATCCAGG - Intronic
954656501 3:52197432-52197454 ACTATTTTTATTTTCCATCCAGG - Intergenic
955437063 3:58912632-58912654 CCTCCTTTTGATTTTCATCTGGG - Intronic
955700057 3:61673217-61673239 ACAATTTTTGTTTTACATGCAGG - Intronic
956208580 3:66779508-66779530 ACTGATTTTGTATTACTTCCAGG + Intergenic
956552007 3:70471659-70471681 ACTCCTCTACTTTCACATCCAGG - Intergenic
958900651 3:99882164-99882186 ACTCTTATTTTTTTACTTCCTGG - Intronic
959726229 3:109544987-109545009 TCTACTTTTATTTTACATACAGG + Intergenic
960333357 3:116389646-116389668 TTTCCTTTTGATTTATATCCAGG - Intronic
962665130 3:137646877-137646899 ACACCTCTTATTTTACATTCTGG + Intergenic
964103111 3:153010197-153010219 ATTCCTTTTTTTTTACATCAAGG - Intergenic
964996290 3:162885917-162885939 TCTCCTTTTGTTGTTCAGCCTGG + Intergenic
965890509 3:173508237-173508259 AATTCTTTTGTTTTACAGCCAGG + Intronic
969148823 4:5150417-5150439 AGTAGTTTTGTCTTACATCCTGG + Intronic
971656760 4:29356960-29356982 ACTCTTTTTGTTTTTCTTCAAGG - Intergenic
971841527 4:31858737-31858759 ACTCCGTGAGTTTTACCTCCAGG + Intergenic
972029558 4:34436447-34436469 AATTCTTTTATTTTACATTCAGG - Intergenic
973278911 4:48339491-48339513 AATCCTTTACTTTTTCATCCTGG + Intergenic
973638311 4:52879876-52879898 TCTCCTTTTCTTTTACATTTGGG + Intronic
975811987 4:78179112-78179134 ATTCCTTTTGTTTCTCATTCTGG + Intronic
975844578 4:78511474-78511496 GCTCCTTATGTTTGACATCCAGG - Intronic
978271627 4:106897252-106897274 ATTCCATTTGTATGACATCCTGG + Intergenic
978313000 4:107406895-107406917 AATCCTTTTATTTTACACACTGG + Intergenic
978620302 4:110630265-110630287 AATCCTTTTGTTTTACAAGCAGG + Intronic
978650496 4:110998166-110998188 CATCCTTTTTTTTTACATCAAGG - Intergenic
981850859 4:149228897-149228919 ATTCATTTTTTTGTACATCCTGG + Intergenic
982009833 4:151096102-151096124 AATCCTCTTGCTTTATATCCTGG + Intergenic
982012699 4:151122203-151122225 ACTCCTTTTGTCTTACAGGCTGG - Exonic
982039620 4:151383529-151383551 AACCCTTTTATTTTAGATCCAGG + Intergenic
983618844 4:169738107-169738129 ACTCTTTTTCTTTTAGAACCAGG - Intronic
984161587 4:176259134-176259156 ACTCCTTTTCTTTTAGTTCTTGG + Intronic
984718365 4:182947278-182947300 ACTCCTTTGGTATTCCATCTTGG + Intergenic
985168398 4:187122531-187122553 ACATATTTTGTTTTACATCCTGG + Intergenic
985218634 4:187679072-187679094 AATCCTTTTGTTTCACAGCTGGG - Intergenic
986213435 5:5695466-5695488 ATCCGTCTTGTTTTACATCCTGG + Intergenic
986588832 5:9347552-9347574 TTTCTTTTTTTTTTACATCCTGG + Intronic
987022741 5:13891435-13891457 TTTCCTTTTGTTTTATTTCCTGG + Intronic
988421775 5:31014220-31014242 ATTTCTTTTGTTTTATACCCTGG - Intergenic
988518703 5:31927199-31927221 TCTACTTTTGTTTTAGATCCAGG - Intronic
990204269 5:53412166-53412188 AATCCTCTTGTTTTACAAGCAGG + Intergenic
990772076 5:59259295-59259317 ACTCATCTTCTTTTACATGCTGG - Intronic
991716591 5:69456600-69456622 ACTCCTTTTATTGTACTTTCTGG - Intergenic
991731003 5:69588201-69588223 ACTCCTTTTATTGTACTTTCTGG - Intronic
991807436 5:70443362-70443384 ACTCCTTTTATTGTACTTTCTGG - Intergenic
991863947 5:71039655-71039677 ACTCCTTTTATTGTACTTTCTGG + Intronic
991918969 5:71634736-71634758 ATTCCCTTTGTTTTACAAACAGG - Intronic
992810490 5:80382907-80382929 ACTCATTTTCTTTTAGATCCTGG + Intergenic
994265859 5:97715462-97715484 ACTTTTTTTGTTTTTCATACTGG + Intergenic
994289675 5:98014038-98014060 AGTCCTTTTGAATTACATGCAGG - Intergenic
994431923 5:99677448-99677470 ACTTCTTTTTTTTTAGATCAAGG + Intergenic
994642581 5:102428503-102428525 ATTACTTTTATTTTACATTCAGG + Intronic
995303736 5:110618105-110618127 ACTGCTTTTGTTTAACAACTTGG + Intronic
995942065 5:117598903-117598925 ACTCCTATTATTTGACATCTTGG - Intergenic
997270317 5:132531178-132531200 ATTCCTTTTACTTTACATCCTGG + Intergenic
998347446 5:141477064-141477086 ACTCCATGAGATTTACATCCAGG + Exonic
998421928 5:141995388-141995410 AATCCTTTTGAAATACATCCAGG + Intronic
998534611 5:142917859-142917881 ACTCTTTTTTTTTTTAATCCAGG + Intronic
1000364401 5:160477666-160477688 CCTACTCTTGTTTTGCATCCTGG - Intergenic
1001094282 5:168764176-168764198 ACTGCTTTTTTTCTACAACCTGG + Intronic
1004967455 6:20870459-20870481 ACTCCTTTTAAGTTACATCTTGG + Intronic
1005533491 6:26732094-26732116 GCTCTTTGTGTTATACATCCTGG - Intergenic
1005535159 6:26747581-26747603 GCTCTTTGTGTTATACATCCTGG + Intergenic
1005537303 6:26769560-26769582 GCTCTTTGTGTTATACATCCTGG + Intergenic
1005611354 6:27528550-27528572 TCTCCTTTGGGTTTATATCCAGG + Intergenic
1006884039 6:37365268-37365290 ATTCCATTTGTATTACATTCTGG + Intronic
1008266265 6:49430755-49430777 ACTTTTTTTATTTTACATTCTGG + Exonic
1009006182 6:57791023-57791045 GCTCTTTGTGTTATACATCCTGG + Intergenic
1009008187 6:57811989-57812011 GCTCTTTGTGTTATACATCCTGG + Intergenic
1009591935 6:65684181-65684203 TCTCCTATTGTTTTCAATCCTGG - Intronic
1009789326 6:68380947-68380969 ATGCCTTTTGTTTGACTTCCAGG + Intergenic
1009908242 6:69894753-69894775 CCTCATCTTGTTTTACATCCTGG - Intronic
1010620388 6:78066448-78066470 ACTCCATTTGTATGACATCTTGG - Intergenic
1016002886 6:139060365-139060387 AGTGCTTTTGTTTTCCATTCAGG + Intergenic
1017741274 6:157408991-157409013 CCTTCTTTTCTTTTCCATCCTGG - Intronic
1020855581 7:13417570-13417592 ACTCCCTTTATTTTGAATCCAGG + Intergenic
1021407874 7:20294813-20294835 ACTACTTTTTTTTAACTTCCAGG + Intergenic
1022382163 7:29870655-29870677 CCTCATTTTGCTTTACCTCCAGG + Intronic
1022589671 7:31649740-31649762 ATCCCCTTTGTTTTGCATCCTGG - Intronic
1023510478 7:40947464-40947486 ACTGCTTTTGTTTTGCATGTGGG + Intergenic
1024218186 7:47265622-47265644 ATTTCTTTTGTTTTATCTCCTGG + Intergenic
1024480695 7:49859051-49859073 ACACATTTTGTTTTACATTGTGG + Intronic
1025121097 7:56304049-56304071 ACTCCTTTAGTTTTAAAACTAGG - Intergenic
1026210169 7:68296999-68297021 ACTTTTTTTTTTTAACATCCTGG + Intergenic
1026518351 7:71092995-71093017 ACTCTTTTTGTTTTAGAGACAGG + Intergenic
1027879340 7:83813654-83813676 AGTCCTTTTGTTTTAATTTCTGG + Intergenic
1028088688 7:86670441-86670463 TCTCATTTTCTTATACATCCAGG + Intronic
1028903125 7:96123326-96123348 ACCGATTTTGTTTTACTTCCTGG + Intronic
1031600653 7:123704007-123704029 AGACCTTATCTTTTACATCCTGG + Intronic
1033985131 7:147215821-147215843 GTTCCTGTTGTTTTGCATCCTGG + Intronic
1034678816 7:152912165-152912187 ACTCCTTTTCTTTAACCTTCAGG + Intergenic
1035539684 8:423305-423327 TCTCCTTTTATTTTAGATACAGG + Intronic
1036074528 8:5480648-5480670 ATTCCTTTTTTTTTACACCGGGG + Intergenic
1036612114 8:10359340-10359362 ACAGCTTTTGTTTTATATACTGG + Intronic
1038608211 8:29032216-29032238 ACTACTTCTGTTTTATATCTGGG - Intronic
1039090364 8:33821735-33821757 ATTCCTTTTGCTCTACATGCAGG - Intergenic
1040059468 8:43092218-43092240 ACCCCTATTGTTATACATTCAGG + Intergenic
1040812355 8:51469118-51469140 TTTCCTTCAGTTTTACATCCAGG - Intronic
1041591405 8:59589233-59589255 ACTGCTTTTATTTTACACCCAGG + Intergenic
1042265508 8:66905007-66905029 TATCCTTTTGGTTTCCATCCTGG - Intronic
1043988942 8:86728853-86728875 ATTCTATTTGTTTTACATTCAGG - Intronic
1046136763 8:110037462-110037484 ACTCTTTTTTTTTTAAATTCAGG - Intergenic
1046140878 8:110089745-110089767 ACTACTTTTATTTTAGATTCAGG + Intergenic
1046792899 8:118340859-118340881 ACTTCAATTGTTTTACATCCTGG - Intronic
1051562193 9:18454325-18454347 TCTCCTTTTTTGTTCCATCCAGG + Intergenic
1051926684 9:22336100-22336122 ACTCCATTTTTTTTAGATACAGG + Intergenic
1052350340 9:27452084-27452106 AATCCTTTTGTTTTCATTCCTGG - Intronic
1052663204 9:31462609-31462631 ATTTCATATGTTTTACATCCAGG + Intergenic
1054989964 9:71313792-71313814 ACTCTTTTTCTTTTTCATCATGG + Intronic
1058326303 9:103702345-103702367 ACTCATTTTGATTTGCATCATGG - Intergenic
1059382777 9:113940820-113940842 ACTCTTTTTGTTTTAGCTCCTGG + Intronic
1061565633 9:131437825-131437847 ACTCCTTTTCTTTCAAATTCTGG - Intronic
1187131851 X:16510857-16510879 ACACCTTTTTTTATACATACAGG + Intergenic
1187790463 X:22944759-22944781 ACTCCCTTTGTTTTACAAGCAGG + Intergenic
1187977885 X:24722082-24722104 ACTCCTTTTTTCACACATCCTGG - Intronic
1188702151 X:33278184-33278206 TCAACTTTTATTTTACATCCAGG + Intronic
1189765171 X:44364400-44364422 ACCCTCTTTGTTTTGCATCCTGG - Intergenic
1191131396 X:57015218-57015240 CCTCATTTTGTTTTAGATACAGG + Intergenic
1192735754 X:73848216-73848238 ATTCCTTTTGTCTTACAGCAGGG - Intergenic
1193088144 X:77465873-77465895 TCACCTTTTATTTTAGATCCTGG + Intergenic
1193413261 X:81190774-81190796 ACTCATTTTTTTTTACATGCAGG + Intronic
1193742995 X:85241416-85241438 TCAACTTTTGTTTTACATTCAGG - Intergenic
1193951260 X:87802250-87802272 ACTCCCTTAGCTTTACATCTAGG + Intergenic
1194062464 X:89221376-89221398 AGTCTTTTTTTTTTTCATCCTGG - Intergenic
1194417873 X:93636027-93636049 ACTCCTTAAGTTTTGCTTCCAGG + Intergenic
1194720329 X:97333466-97333488 ACCCCTTGAGTTTTACAGCCTGG - Intronic
1195097845 X:101523230-101523252 ACTGATTTTATTTTTCATCCTGG - Intronic
1195471862 X:105239439-105239461 ACTCCTTTTAATCTACATCATGG - Intronic
1195887505 X:109655455-109655477 TCTCTTTTTGTTTTATATTCTGG - Intronic
1196689253 X:118541753-118541775 ACTCTTATTATGTTACATCCTGG + Intronic
1200716332 Y:6550342-6550364 AGTCTTTTTTTTTTTCATCCTGG - Intergenic
1201488442 Y:14515095-14515117 ACCCCTTTTGTTTTTCTTTCAGG - Intergenic
1201959286 Y:19660924-19660946 TCTCCTTTTGATTTGGATCCTGG - Intergenic
1202196156 Y:22300040-22300062 ACATCTTTCATTTTACATCCTGG + Intergenic