ID: 1091751852

View in Genome Browser
Species Human (GRCh38)
Location 12:3027260-3027282
Sequence CAAAGAAAGGAGCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 997
Summary {0: 1, 1: 1, 2: 13, 3: 95, 4: 887}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091751852_1091751856 17 Left 1091751852 12:3027260-3027282 CCAGCCTCCTGCTCCTTTCTTTG 0: 1
1: 1
2: 13
3: 95
4: 887
Right 1091751856 12:3027300-3027322 TTCCGTTTTTCTGTTTGTTTTGG 0: 1
1: 2
2: 16
3: 183
4: 1883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091751852 Original CRISPR CAAAGAAAGGAGCAGGAGGC TGG (reversed) Intronic
900616301 1:3567168-3567190 CAAAGATGTGAGCAGGAGCCGGG + Intronic
900662469 1:3791750-3791772 TAAAGAAAGGAGAGAGAGGCCGG - Intronic
901122261 1:6905489-6905511 TAAAGAAAGGAGGAGCAGGCCGG - Intronic
901181510 1:7345045-7345067 AAAAGACTTGAGCAGGAGGCTGG - Intronic
901506318 1:9688044-9688066 GAATGAAAGGACCAGGCGGCCGG - Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
901742423 1:11350948-11350970 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902542935 1:17167170-17167192 CAAAGACAGAAGCAGCAGGCAGG - Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902606308 1:17571234-17571256 GAAAGAAGGGAGCAGCTGGCAGG + Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902830762 1:19010774-19010796 AAAAGAAAGGAGGAGTGGGCAGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903372223 1:22843835-22843857 CAAAGAAGGGAACAAGAGGCTGG - Intronic
903799333 1:25954934-25954956 CAAAGGGAGGAGCTGGGGGCAGG - Intergenic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904170333 1:28587565-28587587 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
904256557 1:29258479-29258501 GAAAGAGAGGAGGAAGAGGCAGG - Intronic
904395693 1:30220020-30220042 CAAATAAAGGAGGAGCAGCCAGG + Intergenic
904985279 1:34542045-34542067 CTAAGACTGGAGTAGGAGGCAGG + Intergenic
905012227 1:34755361-34755383 CAAAGGTAGGAGCAGGGGCCAGG + Intronic
905052324 1:35062270-35062292 GAAAGAAAAGAGGAAGAGGCTGG - Intronic
905059962 1:35131601-35131623 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
905283726 1:36865717-36865739 CAAGGACAGGACCAGGAGTCAGG + Intronic
905639790 1:39581212-39581234 CTAAGAAAGGAGGCGGAGGCCGG + Intergenic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906423020 1:45686738-45686760 CGAAGAAGGGAGCCGGGGGCGGG - Intronic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
907037277 1:51227693-51227715 CAAAGAAAGGTCCAGGCTGCTGG - Intergenic
907198138 1:52703766-52703788 AAAAAAAAGGGCCAGGAGGCCGG + Intergenic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
908339286 1:63159967-63159989 CAAAGAATCGAGCAAGAGCCTGG - Intergenic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910241637 1:85093040-85093062 AAAATAAAGGAGGAGGAGACAGG + Intronic
910317781 1:85906911-85906933 CAAAGAATGGAATTGGAGGCTGG + Intronic
910780127 1:90922762-90922784 CAAAGAAGGGAGCAACAGACTGG - Intronic
910852556 1:91663084-91663106 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
910936641 1:92488350-92488372 CGCAGAAAGGAGCAGGTGGGAGG + Intergenic
910987216 1:93017163-93017185 AAAAGAAATGAGCTGTAGGCTGG + Intergenic
911854897 1:102863999-102864021 CAAATAGAGTAGCTGGAGGCAGG - Intergenic
912201646 1:107464752-107464774 CATAAAAAGGTGCAGGAGGGTGG - Intronic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912968443 1:114257892-114257914 CAGAGAAAGGAACTGGATGCTGG + Intergenic
912972458 1:114296664-114296686 GAAAGAAAAGAGCAGGCGGGAGG + Intergenic
913056560 1:115167123-115167145 CAAAGACAAGAGAAGGAGCCAGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913701380 1:121377514-121377536 CAAAGAAACGAGGCTGAGGCAGG - Intronic
913978871 1:143489521-143489543 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914041936 1:144057975-144057997 CAAAGAAACGAGGCTGAGGCAGG - Intergenic
914073278 1:144315170-144315192 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
914105876 1:144651190-144651212 AAAAAAAAGGAGCAGCAGCCAGG + Intergenic
914136153 1:144902512-144902534 CAAAGAAACGAGGCTGAGGCAGG + Intronic
914310597 1:146462583-146462605 CAAAGAAAGATGCAGAGGGCAGG + Intergenic
914591510 1:149110558-149110580 CAAAGAAAGATGCAGAGGGCAGG - Intergenic
914743145 1:150481819-150481841 TAAAGAAAGGATTATGAGGCCGG - Intergenic
914804585 1:150982978-150983000 CAAGGAAAGGAACAGGTGACTGG + Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915657309 1:157371898-157371920 TAAAGAAAACAGCAGGCGGCTGG - Intergenic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
915901648 1:159850937-159850959 CAAAGAGAGAAGAAAGAGGCTGG + Intronic
915921850 1:159981693-159981715 AAAATATAGCAGCAGGAGGCTGG - Intergenic
916890271 1:169106646-169106668 CCAAGGCAGGAGCAGGAGGAGGG - Exonic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917656284 1:177129413-177129435 CAAGCAAGGAAGCAGGAGGCTGG + Intronic
917770661 1:178274156-178274178 CTAAGAAAGCAGAAGAAGGCAGG - Intronic
918275165 1:182946938-182946960 CAAAGAAAAGCCCAGGTGGCTGG + Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918646756 1:186915010-186915032 CAAACAAGGGAGCAGTAAGCAGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919412632 1:197265287-197265309 GAAAGAAAGAAGCAGGAGAGAGG - Intergenic
919737570 1:200962691-200962713 CCAAGCAGGAAGCAGGAGGCTGG + Intergenic
920090115 1:203446714-203446736 AAAACAATGGAGCAGGAGTCAGG - Intergenic
920169744 1:204064386-204064408 AAAAGAAAGGAGGGGGAGGGAGG - Intergenic
920430929 1:205918472-205918494 GAAAGAGATGAGGAGGAGGCAGG + Intronic
920488804 1:206396228-206396250 CAAAGAAACGAGGCTGAGGCAGG - Intronic
920903499 1:210136288-210136310 GAGAGAGAGAAGCAGGAGGCAGG + Intronic
921075040 1:211693925-211693947 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
921267797 1:213439579-213439601 GAAAGGAAGGGGCAGGAAGCAGG + Intergenic
921377257 1:214487257-214487279 TGAAGGAAGGAGGAGGAGGCAGG + Intronic
921604597 1:217138606-217138628 AAAAGAAAGGAGCGGGAGGAAGG + Intergenic
921681503 1:218038107-218038129 CAAAGAAATCAGCTGGGGGCGGG - Intergenic
921861220 1:220044426-220044448 CAAAAAATGTATCAGGAGGCTGG + Intronic
922608172 1:226904137-226904159 CCAAGGAATGAGCAGGAGGAGGG - Intronic
923231526 1:231990819-231990841 CAAAGTTAGGAGCAGGAGAAGGG - Intronic
923892889 1:238235349-238235371 CAATGATAGAGGCAGGAGGCAGG - Intergenic
924082779 1:240416566-240416588 CAAAGAATGGAAAGGGAGGCTGG - Intronic
924680341 1:246224626-246224648 GAAAGGAAGGAGGAGGAGGAAGG + Intronic
924858650 1:247898955-247898977 CAAACAAAGGAGCAGTAAGTAGG + Intergenic
924955842 1:248925841-248925863 CAAAGGAAAGAGCAGGATCCTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1064142547 10:12802814-12802836 CAAAGAAATGAAGAGCAGGCCGG - Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065172241 10:23043062-23043084 CAAAGCAAGCAGCATGAGCCAGG + Intergenic
1065728497 10:28689745-28689767 TAAAGAAAAAAGCAGGAAGCAGG - Intergenic
1067073028 10:43150796-43150818 CAAAGAAGGGGGAAGGAGTCAGG - Intronic
1067215793 10:44301619-44301641 GAGAGAAAGGAGCAGAAAGCTGG + Intergenic
1067656129 10:48192985-48193007 AAAAGAAAGGAGGAGGAGAGCGG - Intronic
1068491970 10:57735777-57735799 GGAAGAGAGGAGCAGGAGACAGG + Intergenic
1068671384 10:59727096-59727118 CAAACAAGGGAGCAGTAAGCAGG + Intronic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1069381129 10:67843946-67843968 AAAAGAAAGGAGCAACATGCCGG - Intergenic
1069462026 10:68604585-68604607 CAATCAAAGCAGCAGGAGACTGG - Intronic
1069476503 10:68738116-68738138 CTAAGAAAGTATGAGGAGGCTGG + Intronic
1069573473 10:69508145-69508167 GAAATAAAGTAGCAAGAGGCCGG + Intergenic
1069756575 10:70777400-70777422 GGAGGAGAGGAGCAGGAGGCCGG + Intronic
1069950067 10:72012501-72012523 CTAAGACAGGAGCAGAAGACTGG + Exonic
1070717653 10:78734211-78734233 GAAAGAGAAGAGGAGGAGGCAGG + Intergenic
1071027049 10:81127030-81127052 CAAAGCAAGGAGCATTAAGCAGG + Intergenic
1071282643 10:84116533-84116555 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1071288159 10:84167846-84167868 CAGACAAAGGAGCAGTAAGCAGG + Intergenic
1071888304 10:89974567-89974589 CAAAGAAATAATGAGGAGGCTGG + Intergenic
1071952758 10:90723746-90723768 CAAAAAAATGTGCAGGAAGCTGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072335229 10:94391950-94391972 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073599949 10:104836847-104836869 GATAGAAAAGAGCAGGAGGTAGG - Intronic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073834836 10:107429383-107429405 CCAAGTAAGGAGCAGCAGGCAGG - Intergenic
1074374517 10:112928273-112928295 CTGACAAAGGAGCTGGAGGCGGG - Intergenic
1074910962 10:117908393-117908415 CAATGAAAGGAACTGGATGCAGG + Intergenic
1075474622 10:122723537-122723559 CAAAGAAAGCAGAATAAGGCAGG - Intergenic
1075835651 10:125450521-125450543 CTAGGCAAGGTGCAGGAGGCAGG - Intergenic
1075888091 10:125919499-125919521 CAAAAAAAGGAGCAGCAGCCAGG - Intronic
1075957893 10:126539902-126539924 CAAAGAAAGAGGCACGAAGCTGG + Intronic
1076374617 10:129974830-129974852 CAAGGAGAGGAGCAGAAAGCAGG - Intergenic
1076653938 10:132008776-132008798 TAAAGACAGGAACTGGAGGCTGG - Intergenic
1076748998 10:132532348-132532370 CAAGGAAACATGCAGGAGGCTGG + Intergenic
1076930030 10:133525949-133525971 GAAAGAGAGGAGGAGGCGGCAGG + Intronic
1077136674 11:1002993-1003015 AAAAGAGAGGAGAGGGAGGCGGG - Intronic
1077352350 11:2098810-2098832 CAAGGACTGGGGCAGGAGGCAGG + Intergenic
1077652317 11:3984160-3984182 TTAAGAAAGGAGAAAGAGGCTGG - Intronic
1077729815 11:4718412-4718434 CAAACAAAGGAGCAGAAAACAGG - Intronic
1077913175 11:6592063-6592085 CAAATAAAAGAACAGGAGGGGGG + Intronic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078660438 11:13281359-13281381 CTAAGAATGGAGCAGGAGATGGG - Intronic
1079079924 11:17407008-17407030 CAACGACAGGAGCAGGATGCCGG + Exonic
1079285471 11:19126644-19126666 CAAAGAAAGGAACAGCAGGCTGG - Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079759558 11:24311174-24311196 CAAGGGAAGGACCAGGAGGGAGG + Intergenic
1080914829 11:36646324-36646346 CAAGGAAAGCAGCAAGAGACAGG - Intronic
1081432408 11:42990524-42990546 AAAAAAAAGGGGCAGGAGGTGGG + Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081686922 11:45049342-45049364 CACAGACAGGAGGTGGAGGCAGG + Intergenic
1082760366 11:57121499-57121521 CAAGGATAGGAGCAGGGGGTTGG - Intergenic
1083197599 11:61098197-61098219 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1083209259 11:61172643-61172665 CAAAGAAGGGAGCAGAAGAGAGG - Intergenic
1083213602 11:61204594-61204616 CAATGAAAGGAACAGGCAGCAGG + Intronic
1083288946 11:61679563-61679585 CACAGAGAGGAGCAGAAGGCGGG - Intergenic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083616367 11:64028482-64028504 GGAAGGAAGGAGCAGGAGGCAGG + Intronic
1085311012 11:75516622-75516644 TGAAGGAAGGGGCAGGAGGCAGG + Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085952067 11:81344123-81344145 CATATAAAGGACCAGGAGGTGGG - Intergenic
1086370348 11:86150225-86150247 GGAAGAAAGGAGCAAGAGGGAGG + Intergenic
1086973044 11:93104160-93104182 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087236738 11:95727706-95727728 GAAAGCAGGGGGCAGGAGGCAGG + Intergenic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088098887 11:106132187-106132209 CAAAGAATGGAGCAGGCCGCAGG - Intergenic
1088290595 11:108232843-108232865 AAAAGAAATGAACAGTAGGCTGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088763736 11:112956915-112956937 CAAAGAACTGAGCATGAGCCAGG - Intergenic
1089148224 11:116345892-116345914 CAAGAAAAGGGACAGGAGGCAGG - Intergenic
1089456856 11:118630912-118630934 AAAAGAAAGGAACAGGAAGATGG + Intronic
1089536436 11:119163276-119163298 CAACGAATGGAGGAGGAGCCAGG + Intergenic
1089538347 11:119174224-119174246 AAAAGAAAGGAACAGAAGGCTGG - Intronic
1089606804 11:119646035-119646057 CAAGGAAAAGGCCAGGAGGCAGG - Intronic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1091312326 11:134583500-134583522 CAAAGAACGGACCTGGAAGCTGG + Intergenic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091841044 12:3621033-3621055 GGAAGAAAGGAGGAGGAAGCAGG + Intronic
1092178322 12:6426454-6426476 CAAAGTAGGGAGCATCAGGCCGG + Intergenic
1092208573 12:6631812-6631834 AAGAGAAAGGACCAGGGGGCTGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1092481104 12:8859861-8859883 AAAAGAAAGTAGGAAGAGGCTGG - Intronic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093472372 12:19516445-19516467 GAAAGAAGGAAGCAGGATGCAGG - Intronic
1093593684 12:20937672-20937694 CAAACAAGGGAGCAGTAGGCAGG + Intergenic
1093822922 12:23643830-23643852 GAAAGAAAGGAATTGGAGGCAGG + Intronic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1096080335 12:48828460-48828482 CCAAGACTGGAGCAGCAGGCTGG + Exonic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096908744 12:54961318-54961340 TAAGGAAAGGTGCAGGTGGCAGG + Intronic
1097247817 12:57616255-57616277 CAAAGAGAGGAACAGAAGGAGGG - Intronic
1097641962 12:62192395-62192417 GAAAGAAAGGAGCGGGGGGAGGG + Exonic
1097698750 12:62799658-62799680 CAATGAAAATACCAGGAGGCTGG - Intronic
1097713329 12:62938400-62938422 AAAAAAAAGGAACAGGGGGCTGG + Intergenic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1097992029 12:65845901-65845923 CAAAGAAGGGGACAAGAGGCTGG - Intronic
1098248805 12:68547317-68547339 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098639175 12:72818965-72818987 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1098749068 12:74272393-74272415 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1098870554 12:75812705-75812727 GAAAGAAAGTAGCAGGTAGCAGG + Intergenic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1100235960 12:92661130-92661152 AAAAAAAAAGAGCAGGAAGCAGG + Intergenic
1101028101 12:100633677-100633699 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1102524911 12:113505580-113505602 CCAAGAAGGCAGCAGGAGGCAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103367015 12:120390772-120390794 GAAAGGAAGGAGGAGGAGGAAGG + Intergenic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103776266 12:123368620-123368642 AAAAGAAATGAGCACCAGGCCGG + Intergenic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104003980 12:124879406-124879428 CAAAGAAAAGGGGAGAAGGCTGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1105220462 13:18321869-18321891 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic
1105722380 13:23129222-23129244 CAAAGGAAGGAGTAGGAGTAGGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1105902621 13:24769130-24769152 AAAGGAAAGGAGCAGGCAGCTGG + Intronic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1108035046 13:46281889-46281911 GAAAGAAAGGAACAAGAGGAGGG - Intergenic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1109249876 13:60006712-60006734 AAAAGAAAAGAGGAGGAGACTGG + Intronic
1110018029 13:70433558-70433580 GAAGGAAAGGAGGAAGAGGCAGG + Intergenic
1110479995 13:75962762-75962784 CAAAGAAAGGAGGAAGTGTCAGG - Intergenic
1110495512 13:76163239-76163261 GGAAAAAAGGAGCAGGAGGGAGG + Intergenic
1110847131 13:80202749-80202771 CACAGAGAGGATCAGGAAGCTGG - Intergenic
1110952419 13:81513669-81513691 CAAAGAAAGGAGGATGAGAGTGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112235805 13:97635212-97635234 AAAAGACAGGAGCAGGAAGAGGG + Intergenic
1114387098 14:22266869-22266891 CCTAGAAAAGAGCAGGATGCTGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114823771 14:26052867-26052889 GAAAGAAAGGAGGAGGTGCCAGG - Intergenic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1117447211 14:55815736-55815758 CCAAGAAAGGTCCAGGAGGGAGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117881593 14:60318049-60318071 CAAGGTAAGGAGCAGAAGGTGGG - Intergenic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118729234 14:68654972-68654994 GAAAGGAGGGAGTAGGAGGCTGG + Intronic
1118789170 14:69073489-69073511 TAAAGAAAGCAGCAGGGGGCTGG + Intronic
1119184772 14:72632620-72632642 GAAGGAAAGAAGCAGGAGGAAGG + Intronic
1119188743 14:72664086-72664108 CAAGGGAAGGAGCTAGAGGCAGG - Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119524723 14:75313561-75313583 CAAAGAACAGAGTATGAGGCTGG + Intergenic
1119552293 14:75523795-75523817 CTAATAACGGAGCAGCAGGCTGG + Intronic
1119618128 14:76112050-76112072 CCAAGAATGGAGCAGGGGCCAGG - Intergenic
1119674564 14:76544231-76544253 TAAAGATAGGAGCAGGGGTCCGG - Intergenic
1119920241 14:78439958-78439980 AAAAGGAAGGAGCAGGTGCCAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121039220 14:90731245-90731267 TAAAGAGAGTAGCAGCAGGCCGG - Intronic
1121507930 14:94490639-94490661 AAAAGAAATGAGCTGGAAGCTGG - Intronic
1121563939 14:94894685-94894707 AAAAGAAAACAGCAGTAGGCCGG - Intergenic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1121843837 14:97156147-97156169 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122509011 14:102250737-102250759 TAAAGGAAGGAGCACGAGCCTGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122816072 14:104314734-104314756 CACAGAAGAGAGCAGGAGCCAGG - Intergenic
1122835058 14:104426788-104426810 AAAAAAAAGGGCCAGGAGGCAGG + Intergenic
1202870059 14_GL000225v1_random:154507-154529 CAAAAAAAGAAGCAGCAGCCAGG + Intergenic
1123711185 15:22988960-22988982 CAAGGGAAGGAGCAGGATCCGGG - Intronic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1124431001 15:29608503-29608525 TAAAGAAGGCAGGAGGAGGCAGG - Intergenic
1124684043 15:31763583-31763605 CCAAGAAAGGAGTAAGAGTCTGG + Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125256191 15:37766253-37766275 CAAAGAAGGAAACAGGAGGAAGG + Intergenic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125923161 15:43538806-43538828 AAAAGCTGGGAGCAGGAGGCCGG - Intronic
1126060273 15:44774146-44774168 CAAAGAAAAGTCCAGGAGGCTGG - Intergenic
1127095801 15:55511333-55511355 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1127669100 15:61177653-61177675 ACAAGAAAGGAACCGGAGGCCGG + Intronic
1127703563 15:61525576-61525598 GGAAGAATGGAACAGGAGGCTGG - Intergenic
1127968514 15:63941772-63941794 TACAGAAAGGAGCATGAGGGTGG + Intronic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1128260605 15:66230213-66230235 GAAGGAGAGAAGCAGGAGGCAGG - Intronic
1128496477 15:68201245-68201267 CAAAGTCAGGACCAGGTGGCAGG + Intronic
1128557712 15:68642860-68642882 CACAGCAAGGAACAGGAGGTTGG + Intronic
1128874219 15:71188997-71189019 GGAAGAAAGGAGGAAGAGGCAGG - Intronic
1128913859 15:71541920-71541942 ACAAGACAGGAGGAGGAGGCTGG + Intronic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129445844 15:75617302-75617324 TAAAGAGAGGAGAATGAGGCAGG - Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129817094 15:78565040-78565062 GAAAGAAACAAGCTGGAGGCTGG - Intergenic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130297453 15:82657140-82657162 CAAAGAGAGAGGCAGGAAGCAGG - Intergenic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130643725 15:85704546-85704568 CAAAGAAAGAAGTTGAAGGCTGG + Intronic
1131144253 15:90001448-90001470 GAAAGAGAGGAGCCGGAGGGAGG + Exonic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1131852120 15:96554629-96554651 AAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1131871962 15:96772789-96772811 CTCAGAAAGGAGCAGGATGAGGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131972309 15:97904688-97904710 GAAAGAGAGGAGGAGGAGGAGGG + Intergenic
1132094256 15:98970337-98970359 TAAAAAAAGATGCAGGAGGCGGG - Intronic
1132474427 16:126566-126588 CAAAGAAGGGAGCAGGAAGACGG + Intronic
1132778690 16:1611209-1611231 CCAAGAAAGCAGCTGGCGGCCGG + Intronic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1132826875 16:1909544-1909566 CCCAGAAACTAGCAGGAGGCGGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1134279577 16:12805651-12805673 CCAAGAAATGTGAAGGAGGCCGG + Intergenic
1134610262 16:15602604-15602626 AGAAGAAAGGAGGAGGAGGAAGG + Intronic
1134839013 16:17386363-17386385 AAAAGGAAAGAGCTGGAGGCGGG + Intronic
1135352462 16:21740578-21740600 AAAAGCAGAGAGCAGGAGGCAGG - Intronic
1135450950 16:22556700-22556722 AAAAGCAGAGAGCAGGAGGCAGG - Intergenic
1135762952 16:25152197-25152219 CAAAGAGAGGGGCAGCAGTCAGG + Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136036274 16:27542952-27542974 CTAAGACAGGAACAGAAGGCAGG + Intronic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137257705 16:46790366-46790388 CTAAGAAAAGAGCATGAAGCTGG + Intronic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1137581373 16:49635617-49635639 CAAGGAGAGGAGCAGGGAGCAGG + Intronic
1137762582 16:50952568-50952590 CAAGGCCAGGAGCAGGAAGCTGG + Intergenic
1137795429 16:51213661-51213683 AAAAGAGATGAGCAGGAGGCAGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138459938 16:57142190-57142212 CTAGGCCAGGAGCAGGAGGCAGG + Intronic
1138490093 16:57371742-57371764 CAAAGCAGGGAGCGGGAGACCGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138794550 16:59952294-59952316 TAAAGAAAGGAACTGGGGGCTGG + Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1139440193 16:66962915-66962937 CAAAGAAATGGGCAAGTGGCTGG + Intronic
1139489455 16:67278849-67278871 CAAAGTCCGGTGCAGGAGGCTGG - Exonic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1140203746 16:72916176-72916198 AAAAGAAAGGCGGAGGAGGGGGG - Intronic
1140400656 16:74668432-74668454 CAATCAAAGGAGCTGCAGGCCGG + Intergenic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140805779 16:78530728-78530750 CAATGATAGGGACAGGAGGCAGG - Intronic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1140949188 16:79799679-79799701 CAGAGAAAGAACCAAGAGGCTGG - Intergenic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141259418 16:82439160-82439182 GAAAGAAGAGAGAAGGAGGCCGG - Intergenic
1141845219 16:86603888-86603910 GAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1141941187 16:87277214-87277236 AAAAGAAAGGAGCAGAAGGCCGG + Intronic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143231793 17:5362386-5362408 CAAGGAAAGCACCAGGAGTCAGG - Intronic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143963876 17:10742139-10742161 CAAAGAAAGGAGCTGGTTGTGGG - Intergenic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144370409 17:14584816-14584838 GGAAGAAAGGAGTGGGAGGCAGG + Intergenic
1144496252 17:15747478-15747500 TAAAGATAGGTGGAGGAGGCTGG + Intronic
1145066526 17:19765378-19765400 GAAAGAAGGGAGCATGAAGCCGG - Intergenic
1145285543 17:21503588-21503610 TAAAGAGAGAAGGAGGAGGCAGG + Intergenic
1145391984 17:22462149-22462171 TAAAGAGAGAAGGAGGAGGCAGG - Intergenic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146764578 17:35507712-35507734 CAAACAAGGGAGCAGTAAGCAGG - Intronic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1147770599 17:42865563-42865585 CAAATAAAAGAACAAGAGGCAGG + Intergenic
1147887177 17:43691909-43691931 AAATGACAGGAGCAGAAGGCAGG + Intergenic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148386102 17:47236329-47236351 CAAAGAAAGGACCAGGGGACAGG - Intergenic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148573560 17:48690771-48690793 CAAACAAAAGAGCAGGGAGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149444527 17:56703471-56703493 AAATGATAGGAGAAGGAGGCCGG - Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150290571 17:63979206-63979228 CAAAGACAGAGGCAGGACGCAGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151390608 17:73784477-73784499 CAGAGAAAGGAACTGGAGACAGG - Intergenic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1151641761 17:75400466-75400488 AGAAAAAAGGAGCATGAGGCTGG - Intronic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152360140 17:79829136-79829158 GGAAGAGAGGAGCAGGAGGAGGG + Intergenic
1152390638 17:80001850-80001872 TGAGGAAGGGAGCAGGAGGCGGG - Intronic
1152455370 17:80412869-80412891 CAAACAAGGGAGCAGAACGCAGG - Intergenic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1152840773 17:82566719-82566741 AAAAGAAAGCAGCAGGTGGGAGG - Intronic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153474031 18:5477424-5477446 CAAGGGCAGGAGCTGGAGGCAGG + Intronic
1153671806 18:7418985-7419007 TAAAGAAAGCAGTAGGGGGCTGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153830788 18:8920707-8920729 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1155194266 18:23458455-23458477 GAAAGAAAGAACCAGGAGGCTGG + Intronic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1156925679 18:42575088-42575110 CAAGGAAATAAGCAGAAGGCTGG + Intergenic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1157152024 18:45227839-45227861 TAAAGAAAGGAGCAAGAGAATGG - Intronic
1157261542 18:46179566-46179588 AAAAGTAAGGAGCAGGAGCAGGG + Intronic
1157453955 18:47809722-47809744 CAAAGAGAGGGTCAGGGGGCGGG - Exonic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158292515 18:55957323-55957345 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1158329484 18:56345598-56345620 AAAATAAAGGAGCAAGGGGCTGG - Intergenic
1158404790 18:57151522-57151544 CAAAGGAAGGCGCAGGAGAGAGG + Intergenic
1158699873 18:59736097-59736119 GAAATACAGGAGCTGGAGGCAGG - Intergenic
1159900381 18:74039490-74039512 CACAGCCAGGAGCAGGAGGAAGG - Intergenic
1160397535 18:78583395-78583417 CAAGGTCAGGAGCACGAGGCTGG - Intergenic
1160899022 19:1417612-1417634 CCAAGACAGTAGCAAGAGGCGGG - Intronic
1161299876 19:3537510-3537532 CGATGAGAGGTGCAGGAGGCAGG + Intronic
1161563844 19:4988569-4988591 CAAAGAAGGGTTCATGAGGCCGG - Intronic
1161752541 19:6108922-6108944 AAAGGAACGGAGCCGGAGGCTGG + Intronic
1162015647 19:7845208-7845230 CAAATAAGGAGGCAGGAGGCAGG + Intronic
1162788605 19:13051654-13051676 CCAAGAAGGGAGGAGGAGGAGGG - Intronic
1163035763 19:14567943-14567965 GAAAGAAGGAAGCGGGAGGCTGG - Intronic
1163772029 19:19197070-19197092 CAAGGAGAGGAGTAGGAGGGTGG + Intronic
1163849117 19:19653645-19653667 CAAAGGTAGAAGCTGGAGGCGGG + Intronic
1163942793 19:20510505-20510527 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1164216492 19:23155164-23155186 CAAACAAAGGAGCAGTAAGCAGG + Intergenic
1164463534 19:28468635-28468657 CAAAGAAAGAAGCAGGAATGAGG + Intergenic
1164630790 19:29760281-29760303 CAAGGAGGGCAGCAGGAGGCAGG + Intergenic
1165097091 19:33415373-33415395 ACAAGAAAGGAGCGGCAGGCCGG + Intronic
1165694034 19:37886730-37886752 GAAAGGAAGGAGGAGGAGGAAGG - Exonic
1166119031 19:40673880-40673902 GACAGAAAGGGGCAGGAAGCTGG - Intronic
1167036793 19:46999602-46999624 CTCAGACAGGAGCAGGAGGGAGG - Intronic
1167038273 19:47007212-47007234 CAAAGAAGGGAGGAACAGGCCGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167086419 19:47312876-47312898 GAAAGAAAGAAGCACCAGGCTGG - Intronic
1167106868 19:47435523-47435545 AAAAGAAACTAGCAGGAGACGGG - Intronic
1167129374 19:47573967-47573989 CAAAGAAGGGAGGAATAGGCTGG - Intergenic
1167148478 19:47695944-47695966 CAAGGAGAGGAGCAGGTGGGAGG + Intronic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167665969 19:50823012-50823034 CAAGGAAAGGAGCATGTGGTGGG + Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168273893 19:55265735-55265757 GCCAGAAAGGAGCAGGAGTCAGG - Intronic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168365495 19:55783389-55783411 CAAGGAGAGGCACAGGAGGCAGG + Intergenic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
924959103 2:17867-17889 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925341671 2:3142361-3142383 CAAAGAAGGTTGCAGGAAGCTGG + Intergenic
925901705 2:8513743-8513765 GAAAGGAAGGAGCTGGAGGTGGG + Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926246093 2:11123342-11123364 CAAGGAAATGAGCTGGAGTCGGG + Intergenic
926550791 2:14298712-14298734 CCAAACTAGGAGCAGGAGGCAGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
927096232 2:19749630-19749652 TAAAGCAGGAAGCAGGAGGCAGG - Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927445735 2:23159895-23159917 CAAAGAGAGGAACAGTGGGCTGG + Intergenic
927786532 2:25978892-25978914 CAAGGAAAGGATCAGGGGCCTGG - Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928469940 2:31564463-31564485 AAAAGAAAGGAGAAGTAGGGAGG + Intronic
928745594 2:34410790-34410812 AAGAGAGAGGAGCAGGATGCTGG + Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929948586 2:46389098-46389120 GGAAGTGAGGAGCAGGAGGCTGG - Intergenic
930141334 2:47954003-47954025 CTTAGAAGGGAGCAGGAGGAAGG + Intergenic
930262450 2:49163576-49163598 CAAAGGAAGGAACAGTATGCTGG + Intergenic
931246596 2:60497718-60497740 GAAAGAGAAGAGTAGGAGGCTGG - Intronic
932057383 2:68460217-68460239 AAAAGGAAGGAACTGGAGGCAGG + Exonic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933035625 2:77393753-77393775 TAAATAAAGGAGGTGGAGGCAGG + Intronic
933055118 2:77653036-77653058 GTAAGAAAGAAGCAGGAGGTAGG - Intergenic
933795298 2:85914718-85914740 CAACGAAAGGCACTGGAGGCAGG + Intergenic
933894588 2:86799307-86799329 CATAGTAAGGAACAGGAGGGCGG - Intronic
934183596 2:89650602-89650624 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934293879 2:91724774-91724796 AAAAAAAAGGAGCAGCAGCCAGG - Intergenic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935053088 2:99540533-99540555 TAAAGAAAGGAGCAGCAGCCAGG - Intergenic
935060948 2:99607234-99607256 AAAAGAAAAGATCTGGAGGCTGG + Intronic
935558648 2:104538211-104538233 AGAAGAAGGGAGCAGGAAGCCGG + Intergenic
935580289 2:104750454-104750476 GAAGGAAAGGGGCAGGAGGTGGG - Intergenic
935654330 2:105409009-105409031 GCAAGAAAGCAGCAGGAGGTGGG + Intronic
935970984 2:108530806-108530828 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
936547969 2:113409180-113409202 CAATGAAAAGAAGAGGAGGCAGG + Intergenic
937004678 2:118500810-118500832 AATAGGAAGGAGCAGGAGGAGGG + Intergenic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
937227404 2:120377663-120377685 CAAAGAGAGGAGCCAGATGCAGG - Intergenic
937271395 2:120655070-120655092 CTAAGAAGGGACCAGGAGGCAGG + Intergenic
938012582 2:127840600-127840622 CACATAAAGAAGCATGAGGCCGG - Intergenic
938399987 2:130982599-130982621 AGAAGAAAGGAGGAGGAGGAGGG - Intronic
938737345 2:134198393-134198415 CCAAGCAAGGAGCAGGAAGTTGG + Intronic
938763542 2:134445436-134445458 CAAGGGAAGGGGCAGGAGGGAGG + Intronic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939171422 2:138700736-138700758 CCAAGAAACAAGCAGGAGGGAGG - Intronic
940330362 2:152467447-152467469 CGAGGGAAGAAGCAGGAGGCAGG - Intronic
940597514 2:155814670-155814692 CAAAGAAGGAAGCACGAGGCTGG + Intergenic
940957032 2:159739089-159739111 CCAAAATCGGAGCAGGAGGCGGG + Intronic
941357759 2:164514185-164514207 GAAGTAAAGGAACAGGAGGCAGG + Intronic
941775186 2:169385788-169385810 CAAAGAAGGCATCATGAGGCTGG + Intergenic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943746727 2:191469793-191469815 AAAAAAAAGAAGCAGCAGGCCGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944184409 2:196931048-196931070 AAAAGAAAGGAGCATGAGATGGG - Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
944940511 2:204620296-204620318 CCAAGAAAGGTGCATGAGCCGGG - Intronic
946269473 2:218578654-218578676 TAAAAGAAGGAGCGGGAGGCGGG - Intronic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947220718 2:227789479-227789501 GAAAGAGAGGAGGAGGAGGAAGG - Intergenic
948444268 2:238019953-238019975 AAGAGAAGGGAACAGGAGGCTGG - Intronic
948570874 2:238916452-238916474 GAAAGAAAGAAGGAGGAGGAAGG + Intergenic
948570880 2:238916475-238916497 GAAAGAAAGAAGGAGGAGGGAGG + Intergenic
948577838 2:238965623-238965645 CAAAGACAGGAGCAGGGAGGGGG - Intergenic
948631462 2:239305487-239305509 CAAAGAAAGAGGCAGAAGCCAGG - Intronic
948685419 2:239666765-239666787 AGAAGAAAGGAGCAGGTGGGAGG - Intergenic
948744769 2:240080784-240080806 CAAAAAAAATAACAGGAGGCCGG + Intergenic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
949021877 2:241745377-241745399 GCAAGAAAGGAGCCGCAGGCAGG - Intronic
1168829322 20:835923-835945 GAAAGAAAGAAGCAGGTGGGAGG + Intronic
1168862970 20:1059333-1059355 AAAAGAAAGGGGCAGGAATCAGG + Intergenic
1169204951 20:3734167-3734189 CAAAAAAAGGAGCGGGAGTGGGG + Intronic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169477134 20:5941793-5941815 TAAAGAAAGGAGGCTGAGGCTGG - Intronic
1169523726 20:6400734-6400756 GAAAGCAAGGAGCATGAGGCAGG - Intergenic
1170040838 20:12037477-12037499 AAAGGAAAGGTGGAGGAGGCAGG - Intergenic
1170400758 20:15980525-15980547 CAAACAAGGGAGCAGTAAGCAGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171317137 20:24205287-24205309 GAAAGAGAGGAGCAGAGGGCAGG + Intergenic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172138133 20:32701870-32701892 AAAAGAAAGGTGCAGGACGGTGG + Intergenic
1172752577 20:37261190-37261212 TAAAGCAAGGATCAGGAGACAGG + Intronic
1172793895 20:37524123-37524145 CAAAGAAATGAGTAGTGGGCAGG + Intronic
1172981595 20:38946553-38946575 TATATAAAGGAGCAGGAGGAGGG - Intronic
1173565976 20:44039008-44039030 CCAAGAGGGAAGCAGGAGGCTGG + Intronic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1173656056 20:44701043-44701065 CAAAGAAAGGAGTGAGAGGCTGG - Intergenic
1174038027 20:47680102-47680124 CAAAAAAAGAAACAGGAGCCAGG - Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175216268 20:57392965-57392987 CAAAGAAGGGGGCGGGGGGCAGG + Intronic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175871381 20:62211001-62211023 AAAAGAGAGGAGCAGGGGGTGGG - Intergenic
1175975986 20:62710763-62710785 CAAAGCCCCGAGCAGGAGGCTGG + Intronic
1176067401 20:63205403-63205425 CTAGGATGGGAGCAGGAGGCAGG - Intronic
1176365854 21:6032381-6032403 CTAAGTCACGAGCAGGAGGCAGG + Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177310545 21:19386706-19386728 CAAAGAATGGTGCAGGAGTTAGG - Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1178448138 21:32664110-32664132 CAAACAAGGGAGCAGTAAGCAGG - Intronic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178937895 21:36880294-36880316 GAAAGAAGGGAAGAGGAGGCAGG + Intronic
1179070256 21:38064464-38064486 CAAAGCCAGGAGCAGGAGGTGGG - Intronic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1179351130 21:40611945-40611967 CAAAGAGAGGAACATGAGGTGGG + Intronic
1179669479 21:42936317-42936339 CAAATAAGGGAGCAGTAAGCAGG - Intergenic
1179757662 21:43506164-43506186 CTAAGTCACGAGCAGGAGGCAGG - Intergenic
1180096382 21:45557158-45557180 GGAAGAACGGAGCTGGAGGCTGG + Intergenic
1180140324 21:45889559-45889581 AGAAGAAGGGAGGAGGAGGCTGG - Intronic
1180743132 22:18067593-18067615 CAAGGGCAGGAGCAGGAGGTGGG - Intergenic
1180928451 22:19572570-19572592 AAAATAAAACAGCAGGAGGCTGG + Intergenic
1181289993 22:21784363-21784385 GAAAGAAAGGAGGAGAAGGGAGG + Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182010852 22:26999548-26999570 AAAAGGCAGGGGCAGGAGGCAGG - Intergenic
1182018863 22:27064042-27064064 AGAAGAAAGAAGGAGGAGGCTGG + Intergenic
1182661095 22:31925852-31925874 CTAAGCAAGGAGCAGGTGACAGG + Intergenic
1182668136 22:31973700-31973722 CAAAGAAAGGAGCGGGACTGGGG - Intergenic
1182679872 22:32070308-32070330 CAAAGAAAGTAGAAGGAAGAAGG - Intronic
1182960142 22:34464295-34464317 CAAAGAAAGAAGAACAAGGCAGG - Intergenic
1183046148 22:35221851-35221873 TTAAGAATGGTGCAGGAGGCCGG - Intergenic
1183063453 22:35348955-35348977 CAAGGAAAGCAGCTGGGGGCAGG + Intergenic
1183077279 22:35435160-35435182 AAAAGGAATGAGGAGGAGGCTGG + Intergenic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1183691707 22:39393563-39393585 TAAAGAAAAGAAAAGGAGGCTGG - Intergenic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184223078 22:43112905-43112927 CAAAAAAAGGAGCATTAGGCTGG + Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184892997 22:47390796-47390818 GAACGAAAGCAGCGGGAGGCGGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949159403 3:861493-861515 CAAACAAAGGAGCAATAGGAGGG - Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
951884713 3:27513120-27513142 AGAAGGAAGAAGCAGGAGGCAGG + Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953201575 3:40782490-40782512 CAAAGGAAGGAGCAAGAAGTGGG - Intergenic
953284020 3:41588183-41588205 CAATGAAAGGAGCAAAAAGCAGG + Intronic
953398946 3:42595726-42595748 CAAAAAAAGGAGCAGGGACCTGG - Intronic
953852002 3:46471623-46471645 CGGAGAAAGGAGCAGGGAGCGGG + Intronic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954457891 3:50609858-50609880 CAAAGGAAGGAGCTGGGGGAAGG + Intronic
954772091 3:52980864-52980886 AAAAGAAAGGTGAAGGAGTCCGG + Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955644935 3:61126974-61126996 CCAAGAAAAAAGCAGGAGGAAGG + Intronic
955678534 3:61475397-61475419 GAAAGGAAGGAGGAGGAAGCAGG - Intergenic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959133745 3:102391111-102391133 CAAAGAAACTGGCAGGAGGTCGG - Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
960123871 3:113976435-113976457 CAAAGAAATAAGCAACAGGCAGG - Intronic
960598666 3:119432870-119432892 CAAAGACAGGATAAGGAGGAAGG + Intronic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
961158150 3:124698270-124698292 GAAAAACAAGAGCAGGAGGCCGG - Intronic
961266518 3:125647506-125647528 GAAAACAAGGAGCACGAGGCTGG + Intergenic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962277457 3:134026986-134027008 CAAACAAGGGAGCAGTAAGCAGG - Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962402798 3:135075679-135075701 GAAAGAAAGAAGCAGCTGGCAGG + Intronic
962591564 3:136894739-136894761 CACAGAACTGAGCAGGTGGCAGG - Intronic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
964521973 3:157579860-157579882 CAAACAAGGGAGCAGTAAGCAGG + Intronic
964924440 3:161938463-161938485 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965420017 3:168446390-168446412 AAAAGAAAGGAGGAGGAGAGAGG - Intergenic
965850738 3:173019997-173020019 AAAAAAAAGGAACTGGAGGCTGG + Intronic
966226096 3:177599700-177599722 GAAAGAATGGAGCAAGAGGAAGG + Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967787274 3:193511268-193511290 CAAAGAAAGAGGCAGGATGATGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968045305 3:195620638-195620660 CACACAGAGGAGCAGCAGGCAGG + Intergenic
968061160 3:195726981-195727003 CACACAGAGGAGCAGCAGGCAGG + Intronic
968139685 3:196245700-196245722 CAAAGTAAAGAATAGGAGGCCGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968335804 3:197912670-197912692 CTTAGAAAGGAGCAGCAGGTGGG - Exonic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
970236133 4:13960039-13960061 CTAAGCAGGAAGCAGGAGGCAGG + Intergenic
970490167 4:16564048-16564070 AAAAGAAAGGAGAATGAGGGAGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970927544 4:21470342-21470364 GAAAGAGAGAAGCAAGAGGCAGG + Intronic
971143314 4:23948334-23948356 GAAAGGAGGGAGCAGGAGGGAGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971917371 4:32890350-32890372 CATAGACAGGGGCAGGAGGTCGG + Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
974092095 4:57322104-57322126 CCAAGAAAGGAGAAAGAAGCTGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974949484 4:68570729-68570751 CAAACAAGGGAGCAGTAAGCAGG + Intronic
974994031 4:69130636-69130658 TAAAGAAATGAGGACGAGGCAGG - Intronic
975171923 4:71241880-71241902 AGGAGAAAGGAGCAGGAAGCTGG - Intronic
975836648 4:78429358-78429380 CATAGAAATGGGCAGGAGGAAGG - Intronic
976150355 4:82085096-82085118 AAAAGATAAGAGCAGGAGGTGGG + Intergenic
977043142 4:92039070-92039092 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977800504 4:101224548-101224570 GAAAGACAGCAGCAGCAGGCTGG + Intronic
977972805 4:103230809-103230831 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
978481956 4:109202939-109202961 GAAAGAGAGAAGCAGGAGGAAGG + Intronic
978736104 4:112086322-112086344 CAAAGAAAGGAGGCATAGGCTGG + Intergenic
978738318 4:112109394-112109416 CAAAGAAAATAGCAGGAAGATGG - Intergenic
979052835 4:115955851-115955873 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
980073424 4:128267042-128267064 CAAACAAAGGAACAGTAAGCAGG - Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980780569 4:137486389-137486411 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
980894953 4:138853224-138853246 GAAGGAAAGAAGCAGGAGGGAGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981839676 4:149096398-149096420 CAAAGAGAAGAGGAGGAGTCTGG - Intergenic
982662001 4:158218488-158218510 AAAAGAAAATAGCAGGAGGTGGG - Intronic
983094922 4:163550312-163550334 AAAAGAAAAAAGCAGGAGGTAGG + Intronic
983708863 4:170690060-170690082 CAAACAAAGGAGCAATAGGCAGG - Intergenic
984463214 4:180061269-180061291 CAATGAAAGGAGCAAGAGATGGG - Intergenic
984601236 4:181729417-181729439 CAAAGAATGTAGCAGAAGCCCGG + Intergenic
984881381 4:184412707-184412729 CCAAGCAAGGAGCAGAAGGAAGG - Intronic
985100052 4:186449981-186450003 CAAAGCAAGGAGCAGATTGCAGG + Intronic
985371551 4:189290461-189290483 GAAAGAAAGGAGCCCGAAGCTGG + Intergenic
985468496 5:20869-20891 CAAAGGAAAGAGCAGGATCCTGG + Intergenic
985509283 5:303065-303087 GAAAGGAAGGAGCTGGAGGGAGG + Intronic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985738990 5:1603827-1603849 GAAAGGAAGGAGCTGGAGGGAGG - Intergenic
986154002 5:5155726-5155748 GAATGACAGGAACAGGAGGCAGG + Intronic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986476217 5:8136472-8136494 AGAAGGAAGGAGCAGGATGCAGG - Intergenic
986750893 5:10787067-10787089 CAAAGCCAGAAGCAGGAAGCAGG - Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
987747975 5:22001662-22001684 CAAAGAAAGGAACAACAGGCAGG - Intronic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
989095624 5:37778692-37778714 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
991675751 5:69088441-69088463 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
991680348 5:69133720-69133742 AAAAAAAAGAAGCAAGAGGCCGG + Intergenic
991768153 5:70011466-70011488 CAAAGAAAGGAACAACAGACAGG - Intergenic
991847391 5:70886548-70886570 CAAAGAAAGGAACAACAGACAGG - Intergenic
991995944 5:72386806-72386828 CAAAGAGGGAAGCAGCAGGCAGG - Intergenic
992121561 5:73598855-73598877 CAAAGAAAGGAGTCAGTGGCTGG + Intergenic
993036189 5:82760436-82760458 TAATGATAGGAGCAGGAGGCAGG + Intergenic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
995054958 5:107748682-107748704 CAAAGAAACTAGCAGTAGGGAGG - Intergenic
995474249 5:112531995-112532017 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
995712925 5:115052950-115052972 GGAACACAGGAGCAGGAGGCAGG + Intergenic
995784831 5:115816750-115816772 CCAAGAAAGGTGGCGGAGGCGGG + Exonic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
996013760 5:118508313-118508335 CTTAGAAAGGAGCTGGAGGAGGG + Intergenic
996153983 5:120075536-120075558 CACAGAAAGGATCAGTATGCAGG + Intergenic
996434105 5:123415159-123415181 GAATGCAAGGAGCAGGAAGCAGG + Intronic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
997060220 5:130492126-130492148 CAAAGAAAGTAGTATGAGGAGGG + Intergenic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
998852556 5:146364728-146364750 TAAAGAAAGGAGCAAGGAGCCGG - Intergenic
998970724 5:147589148-147589170 TAAAGAATCCAGCAGGAGGCCGG + Exonic
999496375 5:152102890-152102912 AAAAGAAAGAAGGAGGAAGCAGG - Intergenic
999738195 5:154528445-154528467 GAAAGAAAGGAACATGAGGGGGG + Intergenic
1000831740 5:166110537-166110559 CAAAGACATAAGCAGGAGGTAGG + Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1000998079 5:167979167-167979189 TAAAGAAAGGTGCACCAGGCAGG + Intronic
1001092051 5:168748755-168748777 GAAAGAAAGGAGAAAGAGGAAGG - Intronic
1001196762 5:169679965-169679987 CAAAGAAGGTAGGAGGAGGTGGG - Intronic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1001858281 5:175031748-175031770 GAAAGAAAGGAGCTGGGGGAGGG - Intergenic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002366558 5:178717117-178717139 AAAAGAGTGGAGCAGGAGGTGGG + Intronic
1002899534 6:1399407-1399429 GGAAGAAAGGAGGAGGAGGAAGG + Intergenic
1002915771 6:1526535-1526557 CAAGGAAAGGACCATGAGGATGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1004073572 6:12324911-12324933 CTAAGAAGGCAGCAGAAGGCAGG - Intergenic
1004305726 6:14500344-14500366 CAAAGAAAGGGAGAAGAGGCTGG + Intergenic
1004455292 6:15786154-15786176 CTGAGAAAGGAACAGGATGCAGG - Intergenic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1004991122 6:21139802-21139824 TAAAGAAAGGCACAGGAGGCTGG - Intronic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006175391 6:32118294-32118316 AAAATAATGGAGCAGGAGGCCGG + Intronic
1006440442 6:34050465-34050487 GAAAGAGAGGAGGAGGAGCCAGG - Intronic
1006570922 6:35003625-35003647 CAAACAAGGGAGCAGTAAGCAGG - Intronic
1006818029 6:36866807-36866829 CAAAGAAAGTAGAATGAAGCAGG + Intronic
1006883765 6:37362580-37362602 AAAAGAAAAGTGCAGGGGGCAGG - Intronic
1007359253 6:41343283-41343305 TATAGATAGGAGGAGGAGGCAGG - Intronic
1007446102 6:41907356-41907378 GGAAGATGGGAGCAGGAGGCAGG - Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1007741399 6:44012003-44012025 CAAAGAAAGAGGGAGGAGGAAGG - Intergenic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1009965083 6:70569258-70569280 CAAAGAAAGAAAAAAGAGGCCGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010318135 6:74473935-74473957 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1011261264 6:85472162-85472184 CAAGGAAAGGAAGAAGAGGCTGG + Intronic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1013120419 6:107135839-107135861 AAAAGAAAGGGGGAAGAGGCTGG + Intergenic
1013199915 6:107883952-107883974 CAAAGAAAGCAGAAACAGGCGGG + Intronic
1013236102 6:108198898-108198920 CCAAGATAGGAGCAGGCGCCAGG + Intergenic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013558907 6:111284827-111284849 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014014557 6:116515344-116515366 CAAAGAAATAACCAGAAGGCAGG - Intronic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1015172340 6:130267305-130267327 CAAACAAGGGAGCAGTAAGCAGG - Intronic
1015401499 6:132793403-132793425 GAAAGAAAGGAGATAGAGGCAGG - Intronic
1015477514 6:133670355-133670377 ACAAGAAAGGAGGAGGAGGAGGG - Intergenic
1015755351 6:136600488-136600510 TAAAGAAATGAACATGAGGCTGG - Intronic
1016035000 6:139375305-139375327 CAAGGACAGGAGCTGGGGGCGGG + Intergenic
1016239863 6:141917327-141917349 TAAACAAAGCAGCAGGAAGCTGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016940759 6:149481322-149481344 AGAAGAAAGGAACAGGAGACAGG + Intronic
1017180609 6:151548399-151548421 CAGAGAAACGATCATGAGGCTGG + Exonic
1017182120 6:151563863-151563885 AAAAGAAAGCAACAAGAGGCTGG - Intronic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017743588 6:157427528-157427550 CAAATGCAGGACCAGGAGGCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017841417 6:158225742-158225764 CAATGAAAGGATCGGGAGGAAGG + Intergenic
1017993061 6:159506737-159506759 GAAAGCAGGGAGCAAGAGGCAGG - Intergenic
1018041382 6:159926024-159926046 CTAGGAAAGGAGAAGCAGGCTGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019257708 7:62382-62404 CCCAGAAAGGAGCTGGAGGGGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019985466 7:4652260-4652282 GAAAGGAATGAGCAGGAGGGAGG - Intergenic
1020043428 7:5021514-5021536 CAAACAAGGGAGCAGTAAGCAGG + Intronic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1020214857 7:6182344-6182366 TTAAAAAAGAAGCAGGAGGCTGG - Intronic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1021620294 7:22544606-22544628 TAAATGAAGAAGCAGGAGGCAGG - Intronic
1021697163 7:23286454-23286476 GAAAGCAATGAGCAGGAGACGGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021823917 7:24528212-24528234 CAAAGCAAGGACCAGCAGGAGGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024570867 7:50722034-50722056 CAAAGACAGGCTGAGGAGGCTGG + Intronic
1025106841 7:56178045-56178067 CAAAGAGATGAGTCGGAGGCTGG - Intergenic
1025834970 7:65085734-65085756 CCAAGCCAGGAGCAGGAAGCTGG - Intergenic
1025904741 7:65775213-65775235 CCAAGCCAGGAGCAGGAAGCTGG - Intergenic
1026154191 7:67812910-67812932 AGAAGCTAGGAGCAGGAGGCTGG - Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026477914 7:70752636-70752658 CAAAGATAGGCACATGAGGCAGG + Intronic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026702629 7:72660398-72660420 CAAAAAAAGGAGCAGCAGCATGG + Intronic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027171765 7:75877952-75877974 GAAGAAAAGGGGCAGGAGGCTGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027591495 7:80124764-80124786 AAAAGAAAGAAGGAGGAGACTGG + Intergenic
1027916629 7:84332002-84332024 GAAAGAAATGACCAGGAGTCAGG - Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028601003 7:92600395-92600417 CAATCCAAGGAGCAGGAGGGAGG + Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029350380 7:100009257-100009279 AAAAAAAAAGAGCAGGGGGCAGG + Intergenic
1029486547 7:100846223-100846245 CAAACAAAGGAGCAGTAAGCAGG - Intronic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029872226 7:103706969-103706991 TAAACAAATGAGCAGGAGGAGGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031018177 7:116597931-116597953 GAAAGAGAGGAGCAGTGGGCTGG - Intergenic
1031075344 7:117207125-117207147 AAAAGAAACTAGCAGGAGGCAGG - Intronic
1031209698 7:118806464-118806486 AGAAGAAAGGAGCTAGAGGCTGG + Intergenic
1031217796 7:118919895-118919917 CACTGAAAGGAGTAGGAGGTTGG + Intergenic
1031961215 7:127991642-127991664 ACAAGAAAGGAGCAGCAGGGAGG + Intronic
1032131642 7:129233996-129234018 AAAAGAAAGGAGGAGGAAGGGGG - Intronic
1032171208 7:129586082-129586104 CAAACAAGGGAGCACTAGGCAGG - Intergenic
1032301531 7:130691835-130691857 TACAGAGAAGAGCAGGAGGCTGG + Intergenic
1032736903 7:134700961-134700983 GAAAGAAAGGAACATGAGGCCGG - Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032979251 7:137263174-137263196 CAAACAAGGGAGCAGTAAGCAGG + Intronic
1033122342 7:138677198-138677220 TAAGAAAAAGAGCAGGAGGCCGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033332687 7:140429320-140429342 CTAAGAGTGGAGCAGGGGGCTGG - Intergenic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034126654 7:148677620-148677642 TAAAGAAAGGAACCTGAGGCCGG + Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034898041 7:154890166-154890188 CCACCAAAGGAGCAGAAGGCAGG - Intronic
1034989498 7:155539022-155539044 CAAAGAAAGGGGCCCGAAGCTGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035272499 7:157728664-157728686 CAAAGGAAGGAGCCGCAGACAGG - Intronic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036434323 8:8719363-8719385 CTAAGAATAGAGCAGGAGCCAGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037275448 8:17173377-17173399 CAAAGAATTGAGCACAAGGCCGG + Intronic
1037303407 8:17478295-17478317 CAAAGAAAGGAGTAGAAAGAAGG - Intergenic
1037435995 8:18863950-18863972 TAAAGAAAGGTGCAAGAGGTTGG - Intronic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1038090088 8:24242694-24242716 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1038613680 8:29074345-29074367 CAAAGCAGGGAGCAGGATGGTGG + Intronic
1038760743 8:30383132-30383154 GCAAGACAGGAGCAGCAGGCTGG + Intergenic
1039161299 8:34624760-34624782 CAAAAACAGGAGCAAGAGGGTGG + Intergenic
1039583763 8:38688068-38688090 GAAAGAAAGGAGAAGAAGGGAGG + Intergenic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040491891 8:47931302-47931324 CCAACAAGGGAGGAGGAGGCTGG + Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041377730 8:57219814-57219836 CCAAGAAGGTATCAGGAGGCAGG - Intergenic
1041380968 8:57254194-57254216 CCAAGGAAGGAGCTGGAAGCTGG - Intergenic
1041869891 8:62620713-62620735 TAAAGAAAGTTGTAGGAGGCTGG - Intronic
1042491675 8:69406340-69406362 AAAAGAAAGGATCAGAAGTCAGG + Intergenic
1042936047 8:74059403-74059425 CTAAAAAAGAAGCAGGAGGTGGG + Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043169289 8:76944534-76944556 CAAAGAAAGGAGGATGATGTTGG - Intergenic
1043455577 8:80408864-80408886 AAAAGCGAGGAGGAGGAGGCAGG - Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045906591 8:107353434-107353456 CAAAGCAAGTAGCAGGAACCAGG - Intronic
1047187220 8:122644888-122644910 CAATAAAAGGCCCAGGAGGCAGG + Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047484123 8:125313265-125313287 AAAAGAAAGGATGAGAAGGCAGG + Intronic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048392621 8:133982064-133982086 GAAACAAAGGAGCAGAAGGGAGG - Intergenic
1049440835 8:142608867-142608889 CAAGGAAAGAGGCCGGAGGCTGG - Intergenic
1049980838 9:902328-902350 AAAAGAAAGGTGGAGGAGGAGGG - Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051858838 9:21601041-21601063 CAAAGGAAGGACAAGAAGGCTGG + Intergenic
1052508494 9:29384023-29384045 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1052974982 9:34403484-34403506 CAAAGTAAGGGGCAGAAGGCTGG + Intronic
1053076568 9:35139122-35139144 CCAAGATGGGAGCAGGAGCCAGG - Intergenic
1053123069 9:35560545-35560567 AAAAGAAAGGGGCAGGAGGTGGG + Exonic
1053374122 9:37590716-37590738 CAATGAAAAAGGCAGGAGGCAGG + Intronic
1053505077 9:38636270-38636292 ATAAGAAAGGAGCAGGGGCCGGG - Intergenic
1055160042 9:73115320-73115342 CAAAGTAACAAGCAGGAGTCAGG - Intergenic
1055457555 9:76487216-76487238 CAAGGGAAGGAGCAGGAAACAGG - Intronic
1056241894 9:84655905-84655927 CAAAGAAGTGACCAGGAGGATGG - Intergenic
1056596865 9:88014891-88014913 CAAAGAAAGAAGCACTAGCCAGG + Intergenic
1056725378 9:89109735-89109757 TGAAGAAGGGAGCAGGAGCCTGG - Intronic
1057200699 9:93138252-93138274 AACAGGCAGGAGCAGGAGGCTGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058872686 9:109216206-109216228 TTAAGAAAGGAGGTGGAGGCGGG + Intronic
1059058821 9:111014018-111014040 GAATGGAGGGAGCAGGAGGCTGG - Intronic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059766133 9:117385738-117385760 AAAAGAAAGGAGCAAGAGAGAGG + Intronic
1059883877 9:118722760-118722782 CAAAGTAGGGGGTAGGAGGCAGG - Intergenic
1059913730 9:119075764-119075786 AAAAAAAAAGAGCAGGAGGTGGG - Intergenic
1059975501 9:119712544-119712566 GAAAGGAAGGAGCAGAAGGAAGG - Intergenic
1060398895 9:123335914-123335936 CAAAGACATGAGCAAGAAGCCGG - Intergenic
1060414527 9:123421032-123421054 CCCAGACAGAAGCAGGAGGCAGG + Intronic
1060470765 9:123946254-123946276 AAACGAAAAGAGCAGGAGTCGGG + Intergenic
1060477100 9:123994984-123995006 AAAAGAAAGGAGAAAGAGACAGG - Intergenic
1060700429 9:125746395-125746417 AAAAGCATGGAGCAGGAGTCGGG + Intergenic
1060715979 9:125929207-125929229 CACAGAAATGAGCAAGATGCAGG - Intronic
1061118081 9:128627255-128627277 CAAAGATGAGAGGAGGAGGCTGG - Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1062189632 9:135241305-135241327 GAAGGAAAGGACCAGCAGGCTGG + Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1203733091 Un_GL000216v2:108855-108877 CAAAAAAAGCAGCAGCAGCCAGG + Intergenic
1203734396 Un_GL000216v2:122036-122058 CAAAAAAAGCAGCAGCAGCCAGG - Intergenic
1203490327 Un_GL000224v1:98557-98579 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1203502950 Un_KI270741v1:40438-40460 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1185633184 X:1531585-1531607 CACAGACAGAAGCAGGTGGCAGG - Intronic
1185886804 X:3790319-3790341 CAAAGACAGGAGCAGTAGACGGG + Intergenic
1185910388 X:3975532-3975554 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1186326688 X:8485504-8485526 CACAGAACGGAGCAGGAGTGTGG + Intergenic
1186957152 X:14696157-14696179 CCAAGAAAGGAGAAGAAGGGAGG + Intronic
1187025670 X:15433572-15433594 GAAAGAAATGAGGAGGAGGAAGG + Intronic
1187196969 X:17096361-17096383 GAAAGAAAAGAGGAAGAGGCCGG + Intronic
1187522024 X:20022283-20022305 GAAAGCAAGGAGTAAGAGGCAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188305589 X:28557373-28557395 CAAAGAAAGGACCTGGTGGGAGG - Intergenic
1189082241 X:37986811-37986833 CAAACAAGGGAGCAGTAAGCAGG + Intronic
1189322140 X:40093393-40093415 TAAAGAAAGGAAGAGGAGGGAGG + Intronic
1189725623 X:43965640-43965662 AAAAGAAAGGTGCAAGAGGGTGG - Intronic
1190157713 X:48007155-48007177 CAATGAAAGAAGCTGAAGGCTGG + Intronic
1190173485 X:48130040-48130062 CAATGAAAGAAGCTGAAGGCTGG + Intergenic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190499299 X:51059411-51059433 AAAAGAAGGTAGCAAGAGGCTGG + Intergenic
1190581755 X:51897107-51897129 CAAAGAAAAGAGCAAGAGAGGGG - Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190771704 X:53520120-53520142 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1190970259 X:55341731-55341753 AAAAGAAAGCAGCAAGAGCCTGG + Intergenic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1191639622 X:63416038-63416060 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1191854038 X:65608271-65608293 GAAAGGGAGGAGCATGAGGCAGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192533642 X:71910791-71910813 AAAAGAGAGGAGGAGGAGGGGGG + Intergenic
1192536943 X:71936245-71936267 TAGAGATGGGAGCAGGAGGCTGG + Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1193717757 X:84951830-84951852 CAAACAAGGGAGCAGTAAGCAGG - Intergenic
1194793521 X:98181186-98181208 AAAAGAAAGGAGGAGGATGGAGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195721351 X:107872019-107872041 AAATGACAGGGGCAGGAGGCAGG - Intronic
1196422606 X:115538368-115538390 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1196459643 X:115917072-115917094 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197757724 X:130007879-130007901 CCAAGAAAGGAGCAGGAAGTAGG + Intronic
1197875169 X:131095269-131095291 CAAAGAATGGAACAGGAGGCAGG - Intergenic
1198730425 X:139722093-139722115 TAAAGTAATGAGCATGAGGCTGG + Intergenic
1199759196 X:150892308-150892330 AAAAGAACAGAACAGGAGGCCGG + Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200173102 X:154093499-154093521 AAAAGAAAAGAGCCAGAGGCTGG + Intronic
1200393662 X:155969581-155969603 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200943769 Y:8811060-8811082 CAAAGAAGGGAGCAGTAAGCAGG - Intergenic
1201373316 Y:13289056-13289078 CAAACAAGGGAGCAGTAAGCAGG - Intronic
1201556639 Y:15269881-15269903 CAAACAAAGGAGCCGTAAGCAGG - Intergenic
1201680132 Y:16636724-16636746 CAAACAAGGGAGCAGTAAGCAGG + Intergenic
1201909967 Y:19124174-19124196 CAAAGACAGGAGCAGCAGAGGGG - Intergenic
1202459401 Y:25092624-25092646 CACAGAAAGGGCCAGGAGGTTGG + Intergenic
1202626637 Y:56866569-56866591 CAAAAAAAGGAGCAGCAGCCAGG + Intergenic