ID: 1091755327

View in Genome Browser
Species Human (GRCh38)
Location 12:3047612-3047634
Sequence ATTTTTCCACGGATGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091755327_1091755338 19 Left 1091755327 12:3047612-3047634 CCCCGCTCCATCCGTGGAAAAAT No data
Right 1091755338 12:3047654-3047676 CCCTGGTGCCACAAAGGTTGGGG 0: 30
1: 1025
2: 1597
3: 1328
4: 940
1091755327_1091755332 2 Left 1091755327 12:3047612-3047634 CCCCGCTCCATCCGTGGAAAAAT No data
Right 1091755332 12:3047637-3047659 TCTTAAATGAAACCAGTCCCTGG No data
1091755327_1091755335 17 Left 1091755327 12:3047612-3047634 CCCCGCTCCATCCGTGGAAAAAT No data
Right 1091755335 12:3047652-3047674 GTCCCTGGTGCCACAAAGGTTGG 0: 27
1: 1001
2: 1722
3: 1434
4: 986
1091755327_1091755333 13 Left 1091755327 12:3047612-3047634 CCCCGCTCCATCCGTGGAAAAAT No data
Right 1091755333 12:3047648-3047670 ACCAGTCCCTGGTGCCACAAAGG 0: 15
1: 516
2: 857
3: 1234
4: 1200
1091755327_1091755336 18 Left 1091755327 12:3047612-3047634 CCCCGCTCCATCCGTGGAAAAAT No data
Right 1091755336 12:3047653-3047675 TCCCTGGTGCCACAAAGGTTGGG 0: 27
1: 1033
2: 1643
3: 1391
4: 994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091755327 Original CRISPR ATTTTTCCACGGATGGAGCG GGG (reversed) Intergenic
No off target data available for this crispr