ID: 1091758380

View in Genome Browser
Species Human (GRCh38)
Location 12:3071247-3071269
Sequence CAAGGTAGGGCCCCTCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091758375_1091758380 9 Left 1091758375 12:3071215-3071237 CCAGGTGGAAAGTTAAACAGACG No data
Right 1091758380 12:3071247-3071269 CAAGGTAGGGCCCCTCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091758380 Original CRISPR CAAGGTAGGGCCCCTCTAAT TGG Intergenic
No off target data available for this crispr