ID: 1091761863

View in Genome Browser
Species Human (GRCh38)
Location 12:3092910-3092932
Sequence CCTCCCTGCCACCACGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091761856_1091761863 22 Left 1091761856 12:3092865-3092887 CCGCAGTCAACTGGCTGAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1091761863 12:3092910-3092932 CCTCCCTGCCACCACGCCCAGGG 0: 1
1: 0
2: 1
3: 46
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091761863 Original CRISPR CCTCCCTGCCACCACGCCCA GGG Intronic
900134470 1:1109360-1109382 CCTCCCTGCCCCCCAGCCCCTGG - Intronic
900317700 1:2067622-2067644 CCCCCGTGCCACCACCCTCATGG - Intronic
900329813 1:2128379-2128401 CCTCACCGCCACCGCACCCAAGG + Intronic
900556875 1:3285046-3285068 CCTCCCTTGCACCCCGTCCAGGG - Intronic
901163094 1:7195410-7195432 CCACTCGGCCACCAAGCCCAGGG - Intronic
901226461 1:7615733-7615755 CCTCCCTGGTACCTCCCCCATGG - Intronic
901360358 1:8693574-8693596 CCTCTCTGCCCCCAAGCCCCTGG - Intronic
901420105 1:9145056-9145078 CCTCCCTCTCACCAAACCCAGGG - Intergenic
901630975 1:10648009-10648031 CCCTCCTGTCACCACGGCCACGG - Exonic
901878266 1:12179414-12179436 GCTGCCTCCCACCACGCCCTAGG + Intronic
902980559 1:20119599-20119621 CCTCCCAGCCCCCACTCTCATGG + Intergenic
903209922 1:21812196-21812218 CCTCCCTGCCTCCTCTCCCCAGG + Intergenic
903332088 1:22601499-22601521 CCCCCCTGCCCCCACACGCATGG - Intronic
903366328 1:22807545-22807567 CCTCCCAGCCTCTACCCCCATGG + Intronic
903907361 1:26696330-26696352 CCCCCCTCCCACCCCGCCCCGGG - Exonic
904024465 1:27493520-27493542 CCCCACTGCCACCACCCCCATGG - Intergenic
904322866 1:29708093-29708115 CCTCCCTGTCTCCATGTCCAGGG + Intergenic
905119725 1:35672451-35672473 CCTCCCTTCCACAAAGTCCAGGG + Intergenic
907455921 1:54575406-54575428 CCTGCCTCCCTCCACCCCCAAGG - Intronic
907905558 1:58781858-58781880 GCTCCCTGGCTCCACGCCAAGGG + Exonic
910426177 1:87121930-87121952 CCTCCCCGCCTCCACCCCCTAGG + Intronic
911179335 1:94847351-94847373 CCTCCCTGCCACCCTCCTCAAGG - Intronic
912717144 1:111990476-111990498 CCTCCCTGCCACCTCTCCGTGGG - Intergenic
913319229 1:117576836-117576858 CCTCCCTACCAGCACTGCCATGG - Intergenic
913324647 1:117616074-117616096 ACTCCCTTCCACCAAGCTCAAGG - Intronic
914426283 1:147580084-147580106 CCTCCCTGCCTCCATGCCATAGG + Intronic
916436719 1:164784373-164784395 TCTCCCTGCCAGCTGGCCCAGGG + Intronic
917278540 1:173356912-173356934 CTGCTCTGCCACCACACCCATGG - Intergenic
917979461 1:180260041-180260063 CCTCACTCCCACCACACCCTTGG - Intronic
918126427 1:181588125-181588147 CCTCTGTGGCACCACTCCCAGGG + Intronic
918463031 1:184795419-184795441 CCTCCCTGTCCCGAGGCCCATGG - Exonic
919479182 1:198065378-198065400 CCTCACTGCCAGCACTGCCAGGG + Intergenic
919983866 1:202659392-202659414 CCTCCCTTCCACCAAGCAGAGGG + Intronic
920176131 1:204103013-204103035 CCTCCCTGCCCCCAGGGCAAGGG - Intronic
921064792 1:211615017-211615039 CTTTCCTGCCATCAAGCCCATGG + Intergenic
922054563 1:222028361-222028383 CCTCCCGGCCACCCCTGCCAAGG - Intergenic
1065079235 10:22111302-22111324 CCCCCCCCCCACCACCCCCAAGG - Intergenic
1067224407 10:44366190-44366212 CCTCCCTGCCACCCAGCACCTGG - Intergenic
1067664669 10:48266803-48266825 CTTCCCTGGCACCACCCCCGTGG - Intronic
1069556113 10:69399602-69399624 CCTCCCTGCCATGAAGCCCAGGG - Intronic
1069957311 10:72060012-72060034 CCTTCCTGCCCCCACTCCCCTGG - Exonic
1069964378 10:72101981-72102003 CCTCCCTCCCTCCACCCTCAAGG - Intronic
1070683009 10:78462249-78462271 TCTCCCTGGCACCAGCCCCAAGG - Intergenic
1070987298 10:80699925-80699947 CCTGCCTGCCAGCAAGCCCAGGG - Intergenic
1072690968 10:97572254-97572276 CCTTCCTGCTACCACGGCCCTGG + Intergenic
1072924021 10:99600344-99600366 CCTACCTCCCACCATACCCAGGG + Intergenic
1073117040 10:101097150-101097172 CTTCCCTGCCACCACCGCCCTGG + Intronic
1073146675 10:101285913-101285935 CCTCCCTCCCCCCAGGCCCCAGG + Intergenic
1073217181 10:101843131-101843153 CCTAGCTGTCACCAAGCCCAGGG + Intronic
1076109251 10:127848675-127848697 CTTCCCTGGCACCACCCTCACGG + Intergenic
1076630617 10:131849850-131849872 CCTGCCTGCCACCCCCACCAGGG - Intergenic
1076691455 10:132225699-132225721 CATCCCTGCCACCACCCACCTGG + Intronic
1076763307 10:132616373-132616395 CATACCTCACACCACGCCCACGG - Intronic
1076979436 11:196829-196851 ACTCCCTGGCACCAAGGCCAGGG + Exonic
1077159933 11:1108050-1108072 CCTCCCTCTCACCCAGCCCAGGG - Intergenic
1077240384 11:1507594-1507616 CCTACCTGCCCCCCAGCCCAGGG - Intergenic
1077370460 11:2179450-2179472 CCTCAATGCCACCTCTCCCAAGG + Intergenic
1078941495 11:16011574-16011596 CCTCACTGCCTCCAGGCTCAGGG + Intronic
1081629843 11:44681638-44681660 CCTCCAGGCCACCCCACCCATGG - Intergenic
1083635266 11:64117464-64117486 CGCCTCTGCCACCACGCCCCAGG + Exonic
1083758874 11:64805197-64805219 CCTCCCTTCCCCCTCGTCCAGGG - Exonic
1083777605 11:64901943-64901965 CATCCCTCCCACCACGCACCGGG + Exonic
1083885627 11:65572288-65572310 CCGCCCCGCCCCCACACCCAAGG - Intronic
1083970465 11:66070902-66070924 CCTCCCCGCCCCAGCGCCCATGG + Intronic
1084194491 11:67516692-67516714 CCTTCCTTCCACCACCCTCACGG - Intergenic
1084399681 11:68936460-68936482 CCACGCTGCCACCAAGCCCCAGG + Exonic
1084478088 11:69400208-69400230 CCCCCCTACCCCCACTCCCAGGG - Intergenic
1084790280 11:71471201-71471223 CCTTCCTGCCACCTCTTCCACGG - Intronic
1085037975 11:73310942-73310964 GCTCCCTGCCACCTCAGCCATGG + Exonic
1085056821 11:73409506-73409528 GGTGCCTGCCACCATGCCCATGG + Exonic
1088659701 11:112033418-112033440 CCTCTCTCCCACCATGACCATGG + Exonic
1089461320 11:118655978-118656000 CCTCCCTTCCCCCAGGCCCAAGG + Intronic
1089527104 11:119104371-119104393 CCTCCCTACCACCACCCTCCTGG + Intronic
1089537290 11:119168730-119168752 CCTCCCTGCCTCCATCCCCGCGG - Intronic
1089540978 11:119188795-119188817 CATAGCTGCCACCAGGCCCAGGG - Exonic
1089543811 11:119206751-119206773 CGTCCCTGCCCCCACGCCCCCGG - Intronic
1090075105 11:123575691-123575713 TCTGCCTGCCACCAGCCCCACGG + Intronic
1090076635 11:123584077-123584099 GCTGCCTGCCACCCCGCCCGCGG + Intronic
1090446249 11:126767212-126767234 CCTACCTGACATCCCGCCCAAGG + Intronic
1090482153 11:127078255-127078277 CCCCCGTGACACCAAGCCCATGG - Intergenic
1090736289 11:129614507-129614529 CCTCCCTGCCAGCACTCCTTTGG - Intergenic
1090936789 11:131350209-131350231 CCTCCCCTCCACCAGGCACATGG + Intergenic
1091649117 12:2296450-2296472 CCAGCCTGTCACCACTCCCAGGG - Intronic
1091761863 12:3092910-3092932 CCTCCCTGCCACCACGCCCAGGG + Intronic
1096650221 12:53058875-53058897 TCTCCCTGGCACCACCCCCCAGG - Intronic
1096840003 12:54374364-54374386 CCACCCTACCACCACACCCAGGG + Intronic
1097035418 12:56120613-56120635 CCTCGCTGCCACCACCTCCAGGG - Exonic
1097294041 12:57943866-57943888 CCTCCCAGCCACCCTGCCCTTGG - Intronic
1098819398 12:75209065-75209087 CCTCCCAGCCACCTCTCCCCAGG + Intronic
1100297176 12:93273939-93273961 CCTCCCTCCCACCATTCCCAGGG + Intergenic
1101606037 12:106248135-106248157 CCTCCCCGCCGCCACGACCCCGG + Intronic
1101877185 12:108603586-108603608 CCTCCCTGCCTCCCTGGCCATGG + Intergenic
1102254251 12:111406690-111406712 CCCCGCTGCCCCCACACCCAAGG - Intronic
1103014098 12:117480586-117480608 CCCCCCCGCCACCAAGCCCGAGG - Intronic
1104096187 12:125560076-125560098 CCTCCCTGACCCCAAGCCCTCGG - Intronic
1104455879 12:128911832-128911854 CCTCCCTGGCACCAAGCAAAAGG - Intronic
1104671275 12:130682204-130682226 CCTCCCTTCCCCCACTGCCAAGG + Intronic
1107721442 13:43252779-43252801 CTGACCTGCCACCATGCCCAGGG - Intronic
1108580305 13:51822596-51822618 CCTCCCTGCCACCTGGCCCCTGG - Intergenic
1110318547 13:74135429-74135451 CCTCCCCGCCTCCGCGCCCCGGG + Intergenic
1110332402 13:74287960-74287982 CCCCCCTCCCACCCGGCCCAGGG + Intergenic
1113133874 13:107067649-107067671 CCTGCCTGCTACCACACCCTTGG + Intergenic
1113423943 13:110192514-110192536 CCCCCCTGCCCACACACCCAGGG + Intronic
1117483212 14:56169216-56169238 TCTCCCTGCCGCCAAGCCCACGG + Intronic
1118846844 14:69553987-69554009 CCTTCCTCCAAACACGCCCAGGG + Intergenic
1118852345 14:69593598-69593620 CCTCCCTGACACCTCACCCACGG + Intergenic
1118935027 14:70279861-70279883 CCTCCCTCCCCCCACTCTCAAGG - Intergenic
1119694481 14:76701749-76701771 CCTCCCTGGAACCAGGCCAAAGG + Intergenic
1119728603 14:76937266-76937288 CCTCCCTGCCACCTTTCCCAGGG + Intergenic
1119742727 14:77025301-77025323 CCTCCCTCCCCTCACCCCCAAGG - Exonic
1119756536 14:77124004-77124026 CCTGCCTTCCCCCACCCCCATGG + Intronic
1121273586 14:92653084-92653106 CCTCCCTGCCACCTCCTCCCAGG - Intronic
1122205856 14:100147651-100147673 CCTCCCTGCCCCCCCCCCCCAGG + Intronic
1122297765 14:100714767-100714789 CCTCCCTGCCTCCAAGGCCTAGG - Intergenic
1122393625 14:101407495-101407517 GCTGCCTGCCCCCACGCTCACGG + Intergenic
1122833805 14:104421284-104421306 CCTCCCCACCTCCACCCCCAGGG - Intergenic
1122885453 14:104708521-104708543 CTTCCCTGCAGCCAAGCCCAAGG + Exonic
1123062451 14:105600442-105600464 CCTCCCTTCCCCCACGACCCCGG + Intergenic
1123087192 14:105722170-105722192 CCTCCCTCCCCCCACGACCCCGG + Intergenic
1125683055 15:41544869-41544891 CATCCCAGCACCCACGCCCACGG + Intergenic
1128238132 15:66081221-66081243 CCTTCCTGCCACCCCGCTCATGG - Intronic
1128344724 15:66846318-66846340 CCTCCCAGTCAGCACCCCCAAGG - Intergenic
1129228770 15:74184884-74184906 CTTCCCTCCCTCCAGGCCCAGGG + Intronic
1132046986 15:98572453-98572475 CCTGCCTTCCACCACTCCCCTGG - Intergenic
1132096420 15:98988287-98988309 CCTCCCCCCCACCAAGCTCAAGG - Intronic
1132275428 15:100559197-100559219 CCTCCCTGCCCCCACAGCCTGGG - Intergenic
1132288646 15:100684145-100684167 CCTCCCAGCCTCCACCCTCAAGG + Intergenic
1132396610 15:101479522-101479544 CTCCCCTGCCACCCAGCCCATGG - Intronic
1132606639 16:796384-796406 CCTCACCCCCACCACCCCCATGG - Intronic
1132656629 16:1044289-1044311 CCTTCCCGCCCCCACGCCCCTGG + Intergenic
1132663193 16:1070610-1070632 CCTCCTGGCCGCCACCCCCAGGG + Intergenic
1132833075 16:1939014-1939036 CCTTCCTGTCTCGACGCCCAGGG + Exonic
1133092296 16:3413904-3413926 CCTCCCTCCCAGCACGTCCCAGG - Intronic
1133212498 16:4271448-4271470 CCTCCCCCACACCACGCCCAGGG + Intronic
1134316278 16:13121699-13121721 CTTCCCTGCCCCCATCCCCACGG - Intronic
1134423347 16:14115004-14115026 CCTCCTTGCCACCACAGCCATGG + Intronic
1135516938 16:23143872-23143894 CCACCCTGCCCCCACCCCCTGGG - Intronic
1136428453 16:30184066-30184088 CCTTCCTGTCTCCAAGCCCAGGG - Intronic
1139593106 16:67943984-67944006 CCCCCCGCACACCACGCCCAAGG - Exonic
1139649874 16:68356862-68356884 CCTCCCTGCCCCCATGCTCTGGG + Intronic
1139950341 16:70665255-70665277 CCTCAGTCCCACCAGGCCCAGGG + Intronic
1141431663 16:83973349-83973371 CTGCCCTCCCACCATGCCCAAGG - Intronic
1142257335 16:89020348-89020370 CCTCCTTGTAACCACGCCCCTGG - Intergenic
1142264850 16:89058900-89058922 CCATCCTGCCACCACCCCAATGG - Intergenic
1142286423 16:89173281-89173303 CCTCCCCACCACCATGCCCTGGG - Intronic
1142411612 16:89919895-89919917 CGGGCCTGCCAGCACGCCCAGGG + Exonic
1142810329 17:2393046-2393068 CCTCCTCGCCACCCCTCCCACGG + Intronic
1143284786 17:5781060-5781082 CCTCCCTTTCACCACCCCCTGGG - Intronic
1144490536 17:15704672-15704694 CTTCCCTGCCTCCCCACCCAAGG - Intronic
1144910436 17:18677297-18677319 CTTCCCTGCCTCCCCACCCAAGG + Intronic
1144955789 17:19018210-19018232 CACCCCTGCCACCACAGCCAGGG + Intronic
1145266629 17:21382874-21382896 CCTCCCTGCCTCCACCCCAAGGG + Intronic
1145282585 17:21478530-21478552 CCTCTCTGCCTCCAGACCCATGG + Intergenic
1145394893 17:22487225-22487247 CCTCTCTGCCTCCAGACCCATGG - Intergenic
1145779293 17:27551776-27551798 CCTCCCTGCCTCCAGCACCACGG + Intronic
1146061793 17:29611738-29611760 CCTCCTTTCCACAATGCCCAAGG + Intronic
1146379945 17:32321069-32321091 CCTCAGGACCACCACGCCCAGGG - Exonic
1146695060 17:34902690-34902712 CCTCCCTGCCATCACAGCCTTGG - Intergenic
1147177385 17:38664266-38664288 CCCCCCTGCCTCTACCCCCAGGG + Intergenic
1148208019 17:45791711-45791733 GATCCCTTCCACCACCCCCAGGG + Intronic
1148913127 17:50953982-50954004 CCTCCCTGCCACTCAGCTCAGGG + Intergenic
1149895872 17:60427842-60427864 CCTTCCTGCCCCCACTCCCCTGG + Intronic
1150388546 17:64778368-64778390 CCTCCCCGCCTCCGCGCCCGGGG + Intergenic
1151449215 17:74187458-74187480 TCTCCCTGCCTCCAGGCACAGGG - Intergenic
1152293404 17:79453466-79453488 CTTCCCTTCCACCACCCCAAAGG - Intronic
1152368309 17:79870172-79870194 CCTCTCTGCCACCTTTCCCAGGG - Intergenic
1152797834 17:82316662-82316684 CCTACCTGTCACCAGGACCAGGG + Exonic
1152799482 17:82324173-82324195 CCTCCCTGCCACCCCCACCCCGG - Intronic
1152835594 17:82528638-82528660 TCTCCCTGCCACCACTTCCTAGG - Intronic
1153804988 18:8703999-8704021 CCTACCTGCCTCCCCGCCCAGGG + Intergenic
1153913195 18:9721865-9721887 CCTCCCAACCAGCATGCCCAGGG - Intronic
1154156409 18:11947749-11947771 CCTCCCTTCCACGCCGCCCCAGG + Intergenic
1156259921 18:35436778-35436800 CCTCCCAGCCCCCACTCCCCGGG - Intergenic
1156542572 18:37929444-37929466 CTCCCCTGCTACCATGCCCAGGG - Intergenic
1159607275 18:70487863-70487885 CCTCCCTGCCCCTACTCCCTTGG - Intergenic
1159938702 18:74389088-74389110 CCTCCCTGCCAGCAGGGCCCAGG + Intergenic
1160680375 19:409277-409299 CCTCCCTGCCACCAGCCTCCGGG - Intergenic
1160719902 19:592450-592472 CCTCCAGGCGACCACGCCCAAGG - Intronic
1160828484 19:1091615-1091637 CCTCCCTCCCACCGCGTCCATGG - Intronic
1160859662 19:1232301-1232323 TCTCCCAGCCCCCACCCCCAAGG - Intronic
1160860258 19:1234591-1234613 CCACCCGGCCACCTCTCCCAAGG - Exonic
1160865240 19:1253278-1253300 CCTCCCTGCCTCCCTCCCCATGG + Intronic
1160972393 19:1775464-1775486 CCTCCCTGCCTCCACGGCCTGGG + Exonic
1161235034 19:3193456-3193478 CCTCCCCACACCCACGCCCACGG - Intronic
1161668481 19:5590939-5590961 ACACCCTGCCACCACGCACGGGG + Intronic
1162079048 19:8208271-8208293 CCTCCCTGCCACAGGGCCCTAGG - Intronic
1162426238 19:10598089-10598111 CCTCCCTCCCACCATCTCCAGGG + Intergenic
1162554479 19:11378334-11378356 CCACACTGCCACCAGGCCCTGGG + Exonic
1162796976 19:13092083-13092105 CCTGCCTGCCCCCAGGCCCGAGG - Intronic
1162908360 19:13836538-13836560 CCTCTCTGCCACCCCGTCCCCGG + Intergenic
1163556825 19:17998002-17998024 CCTCCCAGCCACCCCTCACACGG + Intronic
1165588231 19:36941098-36941120 CCTTGCTGCCACCATGCACAGGG - Intronic
1165949317 19:39465053-39465075 CCCCCATGCCACCCCGCCCCGGG - Intronic
1166324033 19:42038226-42038248 TCTCCCTGCCATCACTGCCATGG - Intronic
1166364503 19:42271843-42271865 CCCCCCAGCCACCAGGGCCAAGG + Intronic
1166798971 19:45444309-45444331 CCTCCCCGCCCCTAGGCCCAAGG + Intronic
1166827078 19:45616415-45616437 CCGCGCCGCCACCCCGCCCAGGG - Intronic
1167214748 19:48157050-48157072 CCTCTCTGACACCTCTCCCATGG - Exonic
1168300878 19:55404401-55404423 CTTCCCTGCCTCCCCACCCAAGG - Exonic
1168471266 19:56642973-56642995 CCCCCCTGCAACCACGCCGCGGG + Intergenic
925371471 2:3348784-3348806 CTTCCCAGCCACCACTCCCCAGG + Intronic
925661518 2:6208316-6208338 CCTCCCTCCCTCTACTCCCAGGG - Intergenic
925915387 2:8600742-8600764 GCTGCCTGTCACCACGGCCATGG - Intergenic
926756990 2:16244359-16244381 CCCTCCTCCCACCAGGCCCACGG - Intergenic
927146410 2:20169171-20169193 CCTCCCAGCCAGCCCGCCCTTGG + Intergenic
927989949 2:27440969-27440991 TCTCCCTTCCACCACAACCATGG - Intronic
928388396 2:30889060-30889082 CCTCCCTGTCACCACCCCTGCGG + Intergenic
932022200 2:68098751-68098773 CCACCCTCCCACCAAGGCCAAGG + Intronic
932053127 2:68418764-68418786 ACACCCTCCCACCACCCCCATGG - Intergenic
932751292 2:74373335-74373357 CCGCCCAGCCACCACTCCCAAGG + Intronic
934649527 2:96083103-96083125 CCTCCCTCCCACCCCACTCATGG + Intergenic
936562932 2:113557486-113557508 CATCCCTGCCATCACGGCCATGG + Intergenic
937045769 2:118850703-118850725 CCTCTCTGCCACCCCGGCCTGGG - Intergenic
937072571 2:119075215-119075237 CCTCTCTGCCACCTCTCACATGG + Intergenic
937160928 2:119760165-119760187 CCTCCCTGCCACCTCCCCAGCGG + Exonic
937295301 2:120806546-120806568 CCTCCCTCCCCACACTCCCAGGG - Intronic
938125724 2:128669946-128669968 CCTCCCTGCAGCCACTCCCATGG - Intergenic
938364882 2:130726915-130726937 CCTCCCTGTCCCCGCGCCCTGGG + Intergenic
938409907 2:131055291-131055313 GGTCCCAGCCACCATGCCCATGG + Exonic
938595375 2:132783078-132783100 CATCCCTTCCATCACTCCCAGGG + Exonic
938596056 2:132788145-132788167 CCTCCCCACCATCACTCCCACGG - Intronic
938631997 2:133177705-133177727 CTTCCCTGATACCACTCCCATGG - Intronic
939630464 2:144522423-144522445 CCACCCTTCCACCACTCCTAAGG + Intronic
940140313 2:150485801-150485823 CCTCCCTACCACCGCGCGCCAGG + Intronic
941159276 2:162017588-162017610 CCCCGCTGCCCCCACTCCCATGG + Intronic
941674026 2:168324826-168324848 CCTCGCTGCCTCCACCCTCAAGG + Intergenic
942283068 2:174386666-174386688 CCTCCCTGCCACCCTGCCCAGGG - Intronic
945273469 2:207964485-207964507 CCTCCCTCCCTCCACTCTCATGG - Intronic
946163513 2:217849863-217849885 CCTCCCTGCCACCACCACCTTGG - Intronic
946347127 2:219119576-219119598 CCTCCCCGCCACCCTGCCCCTGG + Intronic
946391257 2:219418249-219418271 CCTCCCCGCCCCCACGGCCACGG + Intergenic
946429765 2:219619053-219619075 CCTTCATGCCAGCAAGCCCAAGG - Intergenic
947827004 2:233113307-233113329 CCTCCCTGGCCCCAGGTCCAAGG + Intronic
948167101 2:235871410-235871432 CCTCCCGGCCACCCCACGCAGGG - Intronic
948269852 2:236665937-236665959 CCCCCTTCCCACCACGCCCTCGG + Intergenic
948747656 2:240107926-240107948 CCTCCTGCCCACCAGGCCCAGGG - Intergenic
948897916 2:240935739-240935761 TCCCCCTGCCCCCACCCCCACGG - Intronic
1169388797 20:5172928-5172950 TTTCCCTGCCACCAGGCCCTGGG - Intronic
1170753038 20:19169467-19169489 CCCTCCTGCCACCACGTGCATGG + Intergenic
1171340913 20:24428018-24428040 CCTCCCTGACCCCTAGCCCATGG - Intergenic
1171456083 20:25273162-25273184 CCTCCCTGCCCCCTTGGCCAGGG - Intronic
1172274184 20:33670847-33670869 CACCCCTGCCACCAGGTCCAGGG + Intronic
1172914238 20:38431914-38431936 CTTCCCAGACATCACGCCCAGGG + Intergenic
1174053372 20:47782539-47782561 GCACCCTGGCACCACCCCCAGGG + Intronic
1174173826 20:48632725-48632747 CCTCCCTGCCCCCAGGTCCAGGG + Intronic
1174428882 20:50453172-50453194 CCTCCCCACCACCACCCCCAAGG - Intergenic
1174445389 20:50587595-50587617 ACTCCCTGCCACCCCAGCCATGG + Intronic
1174956506 20:55104238-55104260 CTTCTCTGCCACCACTCCAATGG + Intergenic
1175081356 20:56423022-56423044 CCTTCCTGCCACCCCAGCCATGG - Intronic
1175788382 20:61726069-61726091 GCCCCCAGCCACCACGACCAGGG + Intronic
1175873416 20:62218871-62218893 CCCTCCTGCCCCCAGGCCCAGGG - Intronic
1175946050 20:62559252-62559274 GCTCCCTGCACCCACTCCCAGGG - Intronic
1176029916 20:63006932-63006954 CCTCCCAGCCGCGACGCGCAGGG + Exonic
1176085628 20:63294264-63294286 TCCACCTGCCACCACGCCCAGGG - Intronic
1176101300 20:63365725-63365747 CCTCCCTGCCAGCCCTGCCATGG + Intronic
1176116558 20:63434161-63434183 CCTCCCTGCGAGCTCGCTCAGGG - Intronic
1176272133 20:64240819-64240841 CCACCCACCCACCACGCTCACGG - Exonic
1179790843 21:43755078-43755100 CCTCACTGCCAGGCCGCCCAAGG + Intronic
1179996308 21:44975997-44976019 CCTCCCCGCCACCAGGCTCAGGG + Intronic
1180007750 21:45031008-45031030 CCGCCCTGCCCCCCCGCCCCTGG - Intergenic
1180032966 21:45224628-45224650 CCTGACAGCCACCCCGCCCAGGG - Exonic
1180964497 22:19779361-19779383 CCTCCCAGCCACCAGGCCCTGGG - Intronic
1181621651 22:24095424-24095446 CCACCCCCCCACCACACCCACGG + Intronic
1181925435 22:26354923-26354945 CGTCGCTGCCACCACACGCAGGG - Intronic
1182425322 22:30268467-30268489 CCTCCCCCTCACCACCCCCAGGG + Intergenic
1182889828 22:33808449-33808471 CCTCCCTGCCCCTACCACCAAGG + Intronic
1183457999 22:37933148-37933170 CCTCCGTGTCACCAGGCCCCAGG - Intronic
1183485470 22:38085797-38085819 CCTCCCTCTCCCCATGCCCAAGG + Intronic
1183903441 22:41022526-41022548 CCACCCTGCCACCCAACCCAAGG + Intergenic
1184301292 22:43562631-43562653 CCTCCCTCCCACCCCGCACCAGG - Intronic
1184301325 22:43562710-43562732 CCTCCCTCCCACCCCGCACCAGG - Intronic
1184301358 22:43562789-43562811 CCTCCCTCCCACCCCGCACCAGG - Intronic
1184423656 22:44396337-44396359 CCTCCCCGCCACCTCCCCCATGG - Intergenic
1184817440 22:46882628-46882650 CCTCCCAGACAACACGCTCATGG - Intronic
1184937360 22:47734914-47734936 CATCCCTGCCACCATGGCCACGG + Intergenic
1185032288 22:48450410-48450432 CCCACCTGCCACCAGCCCCAGGG - Intergenic
1185182486 22:49371487-49371509 CCTCCCTGCCACCACGAAGATGG + Intergenic
1185273089 22:49937568-49937590 GCCCCCTCCCGCCACGCCCAGGG + Intergenic
950401957 3:12775746-12775768 CCTCCCTGCCACCTAGCACCTGG - Intergenic
950842765 3:15983421-15983443 CCTCCCTCCCAGCAAGTCCAGGG - Intergenic
953854724 3:46492471-46492493 CCTACCTGCCACCACTTCCTTGG - Intergenic
954467564 3:50665382-50665404 CCACCCTGCCCCCACCCCCAAGG + Intergenic
954661558 3:52229421-52229443 CCTCCCTGTCTCCAGGCCCAGGG + Intronic
955808351 3:62760088-62760110 CCTCCCTTCCTCCATGCCCAGGG + Intronic
958922607 3:100123416-100123438 ACTCCCTAGCACCACCCCCAGGG - Intronic
960943944 3:122953255-122953277 CCTCTCTGCCTCCCCGCCCCAGG + Intronic
961033947 3:123629364-123629386 CCTCCTTGCCACCCCGCCTTGGG - Intronic
961164150 3:124751904-124751926 CCACCCTGCCACCCTGCCCCTGG + Intergenic
961821216 3:129576584-129576606 CCGCTCTGACACCACCCCCAAGG + Intronic
961891724 3:130135907-130135929 CCTCCCTGGCACAAAGCACAGGG + Intergenic
963300556 3:143592770-143592792 CATCCCTGCCACCATCACCAGGG + Intronic
963651793 3:147989465-147989487 CCTCCCAGCCACCGCCTCCATGG - Intergenic
964003640 3:151806409-151806431 CCTCCCAGCCTCCAGGCCCTTGG + Intergenic
964707519 3:159635312-159635334 CATCCCTACCACCTCTCCCATGG - Intronic
966805866 3:183807040-183807062 TCTACCTGCCACCAACCCCAGGG + Exonic
968456728 4:704188-704210 CCTCCCTGCCTCCCCTCCCCCGG + Intergenic
969392768 4:6902066-6902088 CCTCCCTGCCCGCAGCCCCACGG - Intergenic
969529734 4:7724006-7724028 CCTCCCTGCCTCCCTGCCCTCGG - Intronic
969554364 4:7896529-7896551 CCTCACTCCCCCCACACCCAGGG + Intronic
969554382 4:7896587-7896609 CCTCACTCCCCCCACACCCAGGG + Intronic
969554400 4:7896645-7896667 CCTCACTCCCCCCACACCCAGGG + Intronic
969554445 4:7896790-7896812 CCTCACTCCCCCCACACCCAGGG + Intronic
969568204 4:7992625-7992647 CCTCCCTGCCCCCGACCCCAGGG - Intronic
970377232 4:15471311-15471333 CCTCCCTTCAGCCAGGCCCAGGG - Intronic
971292332 4:25355434-25355456 ACTCCCTGACCCCACCCCCATGG - Intronic
972391038 4:38613891-38613913 TCTCCCTCCCACCATGTCCAAGG - Intergenic
972437689 4:39049577-39049599 CCTCCCTACCCCCGCCCCCAAGG - Intronic
973335118 4:48948269-48948291 TATCCCTGCCACCAAGCACAGGG + Intergenic
974998711 4:69194744-69194766 CCTACCTAACACCAGGCCCATGG - Intronic
976868947 4:89767577-89767599 CCTCCCTGCCACCTCACTCATGG + Intronic
982157496 4:152536203-152536225 CCTTCCAGCCACCCCGCCCTGGG + Intergenic
984833806 4:184000436-184000458 CCTCCCAGCCATCATCCCCACGG + Intronic
985854368 5:2413428-2413450 CCTCCCTGGAGCCACGTCCATGG + Intergenic
985898431 5:2764827-2764849 CCCGCCCGCCACCACACCCAAGG + Intergenic
985924152 5:3002747-3002769 CCCCCTTGCCAACACGTCCAAGG - Intergenic
985950316 5:3217813-3217835 CCCCCCTGCCCCCACACCCCTGG - Intergenic
986032078 5:3904468-3904490 CCTCCCAGAGACCAGGCCCAAGG + Intergenic
986690295 5:10308073-10308095 CCTCCCTGCCTCCTCCCTCAAGG - Intergenic
989206799 5:38817322-38817344 CCACCCTGCCACCTCCCCAAAGG + Intergenic
991942425 5:71865421-71865443 CCTCCCAGGCACATCGCCCAGGG - Intergenic
991963635 5:72069899-72069921 CATCCCTTCCCCCACACCCAAGG - Intergenic
995659161 5:114461813-114461835 CCTCCTTGCCACCACAGCCCTGG + Intronic
998351608 5:141505538-141505560 TCTCACAGCCACCATGCCCACGG + Intronic
998401898 5:141852697-141852719 CCTCCCTACCCCCTCCCCCATGG + Intergenic
999202359 5:149825354-149825376 CCTCACAGCAACCTCGCCCAGGG - Intronic
999361267 5:150988586-150988608 CCTCCCTGCCCCTACAACCAGGG - Intergenic
999627999 5:153540503-153540525 CCTCTCTGCCTCAACTCCCATGG + Intronic
1000981791 5:167824273-167824295 TCACCCTGCCACCACCACCAAGG + Intronic
1001509283 5:172307563-172307585 CCTGCCTCCCCCCAGGCCCAAGG - Intergenic
1001516970 5:172362683-172362705 CTACCCTGCCACCAAGCCCCTGG - Intronic
1001848377 5:174941342-174941364 AATCCCTGCCACAACTCCCAGGG + Intergenic
1002436510 5:179234946-179234968 CCTGCCTGCCAACCCTCCCAGGG + Intronic
1002763104 6:217229-217251 CATCCCTCCCACCACCACCAGGG + Intergenic
1003054973 6:2809941-2809963 CTTCTCTCCCACCACACCCAGGG - Intergenic
1003128376 6:3374290-3374312 CCTCCCTGGCACCATGCACATGG + Intronic
1004509974 6:16277416-16277438 CCTCCCTCCCACCAGACCCGGGG - Intronic
1007238116 6:40405662-40405684 CCTCCCTGCCAGCCCAGCCAGGG - Intronic
1007259829 6:40555716-40555738 CAGCCCTGCCCCCACCCCCATGG + Intronic
1007390933 6:41549061-41549083 CCTCTCAGCCTCCACACCCAGGG + Intronic
1007464428 6:42041944-42041966 CCTCCCTGCCACCTCCCCTGAGG - Intronic
1015634807 6:135264691-135264713 CCTCCATGCCTACACGCGCAGGG + Intergenic
1017224866 6:152009102-152009124 CCTCCCTTCCCCCACCCCCTGGG + Intronic
1018030385 6:159836905-159836927 CCTCCCTCCCAGCCCTCCCAAGG - Intergenic
1018226764 6:161636356-161636378 TCTCCCTGCCACCTCTCGCAAGG + Intronic
1019152725 6:170019587-170019609 CCCCTGTGCCCCCACGCCCAGGG + Intergenic
1019410235 7:903661-903683 CCTCCCCGCCGCCACACCAAGGG + Intronic
1019472303 7:1227482-1227504 CCTGCCTGCCTCCCCGCCCTGGG + Intergenic
1020104879 7:5418078-5418100 TCTCCCTGCCCCCACACCCTAGG - Intronic
1020290623 7:6719806-6719828 CCTCCCATCCACCTCGCCCATGG - Intergenic
1022114320 7:27249116-27249138 CCTCCCTGCCACCACCCAAATGG - Intergenic
1022786230 7:33640256-33640278 CCTTCCAGTCACCACCCCCAGGG + Intergenic
1023514464 7:40987217-40987239 ACTCCCTGCCATCAGTCCCAGGG + Intergenic
1025245787 7:57316061-57316083 CCTCCCCACCACCGCCCCCAAGG + Intergenic
1026149084 7:67772899-67772921 CCTTCCTGCCACCACCGACAAGG - Intergenic
1027198435 7:76047616-76047638 CCTTCCTCCCACCCCGCCTAAGG + Intronic
1027237244 7:76305303-76305325 CCACCCTCTCACCAGGCCCAGGG + Intergenic
1029114528 7:98230539-98230561 CCTCTCTGCCCCCAGGCCCCGGG + Intronic
1029548331 7:101222988-101223010 CCTCCATGCCCCCAAGCCTAAGG - Intronic
1030368872 7:108674865-108674887 CCTGCCTGCCACCATGGCCATGG - Intergenic
1030505489 7:110416917-110416939 TCTCCATGAAACCACGCCCATGG + Intergenic
1032462031 7:132118945-132118967 CCTGCCAGCCACCTCTCCCAGGG + Intergenic
1032836825 7:135682567-135682589 CCTCCATGCCAAAATGCCCAGGG - Intronic
1032864635 7:135913617-135913639 CCTCCTTGCCCCCAAGGCCATGG - Intergenic
1034273369 7:149813808-149813830 CCTGCCTCCCACCACGGCGAGGG - Intergenic
1034873606 7:154705599-154705621 CATCCCTGCCACCCCAGCCATGG - Intronic
1035289416 7:157828034-157828056 CCTGCCTGCCTTCACGGCCACGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038328035 8:26587351-26587373 ACTCCCCGCCACCCCGCCCCTGG + Intronic
1038425707 8:27462634-27462656 CCTGCCTGCCGCCACCTCCAAGG + Intronic
1038855215 8:31323798-31323820 TCTCCCTGCCCCCAACCCCACGG + Intergenic
1040723152 8:50350191-50350213 CCTCCCTGCCCCCACCCCGTGGG + Intronic
1041296550 8:56362832-56362854 CCTCCCTGGCCACAGGCCCAAGG - Intergenic
1043217800 8:77617663-77617685 TCTCCCTCCCCCCACCCCCAGGG + Intergenic
1045178558 8:99754897-99754919 ACTCCCTGCCACAACACCTAGGG + Intronic
1047732716 8:127739335-127739357 ACTCCCTGCCACCCCGCCCCAGG - Intronic
1048956760 8:139543769-139543791 CCTCCTTCCCACCTGGCCCAGGG - Intergenic
1049207243 8:141369314-141369336 CCTCCCTGACTCCTCCCCCAGGG + Intergenic
1049208725 8:141375558-141375580 CCTCTCTGCCTCCAGCCCCATGG + Intergenic
1049288923 8:141791400-141791422 CATCCCTGCCTCCACCCCCAAGG - Intergenic
1049537578 8:143189507-143189529 CCTCCCCGCCCCCACCCCCGTGG + Intergenic
1049889800 9:58213-58235 CATCCCTGCCATCACGGCCATGG - Intergenic
1052770034 9:32679155-32679177 CCCCCCTGCCACCACCACCCAGG - Intergenic
1053015617 9:34660364-34660386 CCTCCCTCCAACCACACCCTCGG + Exonic
1053731281 9:41059488-41059510 CATCCCTGCCATCACGGCCATGG - Intergenic
1054697228 9:68372601-68372623 CACCCCTGCCATCACGGCCATGG + Intronic
1055865196 9:80804890-80804912 CCACCCTGCCCCCAAGCCCTTGG - Intergenic
1056304956 9:85281341-85281363 CCTCACTGCCACCACTTCCCTGG + Intergenic
1059318314 9:113446001-113446023 ACTCCCTCCCACCAAACCCAAGG - Intronic
1059557034 9:115291843-115291865 CCACCTTGCCACTACCCCCAAGG - Exonic
1060104581 9:120865829-120865851 CCTCCTTGCCCCCTTGCCCAGGG - Exonic
1061149738 9:128821884-128821906 CCTCCCTTCCACCAGGCCCTAGG - Exonic
1061261296 9:129482372-129482394 CCTGCCGGCCCCCCCGCCCATGG + Intergenic
1061261506 9:129483009-129483031 CCTCCCTGCTCCCCCGCCCTGGG - Intergenic
1187700847 X:21963228-21963250 CCTCCCTGTCACCCAGCCCTTGG - Intronic
1190485781 X:50923503-50923525 CCTCCCTCCCAGCAAACCCATGG - Intergenic
1195093918 X:101488329-101488351 CCTCTCTTCCACCAAGCACATGG + Intronic
1195683081 X:107563255-107563277 CCCTCCTGCCCCCACACCCAAGG - Intronic
1195782235 X:108479047-108479069 CACCCCTGCCACCATGGCCAGGG + Intronic
1200309658 X:155065295-155065317 ACTCCCTCCCCCCAGGCCCAAGG + Exonic