ID: 1091762702

View in Genome Browser
Species Human (GRCh38)
Location 12:3097622-3097644
Sequence AGGGGTGGCAAGTACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091762695_1091762702 0 Left 1091762695 12:3097599-3097621 CCTCTTCTGTGACTTCCTGGAGG 0: 1
1: 0
2: 3
3: 39
4: 514
Right 1091762702 12:3097622-3097644 AGGGGTGGCAAGTACAGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 216
1091762693_1091762702 6 Left 1091762693 12:3097593-3097615 CCTCTTCCTCTTCTGTGACTTCC 0: 1
1: 0
2: 3
3: 94
4: 933
Right 1091762702 12:3097622-3097644 AGGGGTGGCAAGTACAGTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091762702 Original CRISPR AGGGGTGGCAAGTACAGTGC TGG Intronic
900499269 1:2992366-2992388 AGGACTGGCAAGCCCAGTGCTGG - Intergenic
900607917 1:3531972-3531994 AGGGGAGGACAGGACAGTGCAGG - Intronic
900618590 1:3576754-3576776 AGGGGTGGAATGTGCAGGGCTGG - Intronic
901222634 1:7592261-7592283 AGTGATGGCAAGGACAGTGATGG - Intronic
901306303 1:8235436-8235458 AGGGGTGGCAAAGACACTCCAGG + Intergenic
902919309 1:19656928-19656950 AGGCCTGGCAGCTACAGTGCAGG - Exonic
904428687 1:30447941-30447963 AGGGGAGGGATGGACAGTGCTGG + Intergenic
905146064 1:35887602-35887624 AGAGGTGGCAATTAGAATGCTGG - Intronic
907820897 1:57967370-57967392 GTGGGTAGCAAGTACAGTTCAGG - Intronic
912619535 1:111140611-111140633 AGGGGTGGGAAGAACCGTGGAGG + Intronic
914784575 1:150816847-150816869 TTGGGTGGCAGGGACAGTGCTGG + Exonic
915733879 1:158072462-158072484 TGGGGTGGCCAGTGCAGTGTGGG + Intronic
915979032 1:160408718-160408740 AGGGGTGGGAAGGGCAGAGCAGG - Intronic
916074707 1:161193693-161193715 AATGGTGGCAAGTACTGTGAGGG - Exonic
916620597 1:166492246-166492268 AGGGATGGCAAGTAAAGAGTAGG - Intergenic
919666571 1:200298410-200298432 AGGTGTGCCAAGTGCTGTGCAGG - Intergenic
922887089 1:229028432-229028454 GGGGGTGACCAGTGCAGTGCTGG - Intergenic
924073183 1:240304621-240304643 AGGAGGGGCAACTACAGTGGGGG + Intronic
924282205 1:242449746-242449768 AGGGGAGGCAGGCACCGTGCTGG + Intronic
924288986 1:242518893-242518915 AGTGGTGACAAGGACAGTGATGG + Intronic
924441149 1:244086474-244086496 AGAGGTAGCAAGCATAGTGCAGG - Intergenic
1062873255 10:925072-925094 AGGGGAGACAAGGAGAGTGCAGG + Intronic
1062955732 10:1539104-1539126 AGGGGAGGCAAGGCCAGAGCGGG + Intronic
1067307372 10:45077008-45077030 ACGTGTGGCAAGTACTGTGGAGG + Intergenic
1069928652 10:71868522-71868544 TGGTGTGGCAAGCACAGGGCAGG + Intergenic
1070729172 10:78813520-78813542 AGGATTGGCAAGTAGAGAGCTGG - Intergenic
1070975466 10:80602886-80602908 CGGGGTGGAAAGAACAGTGTGGG + Intronic
1072611297 10:97019140-97019162 AGGGGTGGGCAGCACAGGGCTGG + Intronic
1073152303 10:101320494-101320516 GGAGATGGCAAGTACTGTGCAGG + Intergenic
1073730369 10:106280577-106280599 AGGGGAGGCAGGTATGGTGCTGG + Intergenic
1075329091 10:121559725-121559747 AGGCATGGCAAGTACACTGTTGG + Intronic
1077317733 11:1926869-1926891 AGGGCTGGCCGGTACAGTGCAGG + Intronic
1077391065 11:2300870-2300892 AGGGGTGGCAACAAGAGTGAAGG - Intronic
1077683666 11:4270705-4270727 AGGGGTGGCAGGGGCAGTGGTGG + Intergenic
1077686376 11:4296059-4296081 AGGGGTGGCAGGGGCAGTGGTGG - Intergenic
1077691528 11:4347247-4347269 AGGGGTGGCAGGGGCAGTGGTGG - Intergenic
1078022833 11:7669844-7669866 AGGGGTGGGAAGAAGAGAGCAGG + Intronic
1078396218 11:10984410-10984432 AGGGCTGGGAAGTATAGTCCAGG - Intergenic
1078609551 11:12808585-12808607 AGGGGTGGCAGGTGGAGTGCTGG - Intronic
1079008749 11:16811403-16811425 AGGGGTGACAAGAACTATGCAGG + Intronic
1079202358 11:18386752-18386774 TTGGGTGGCAAGGACAGTGATGG - Intergenic
1079675944 11:23226649-23226671 AGGGATGGCAAGAACACTGTGGG + Intergenic
1080136222 11:28857784-28857806 AAGGGGCCCAAGTACAGTGCAGG - Intergenic
1080908313 11:36569198-36569220 TGGGGTGGCTTGGACAGTGCAGG - Intronic
1081435950 11:43027662-43027684 TGTGGTTGCAAGTACAGTGAAGG - Intergenic
1082234144 11:49802373-49802395 AGGGGTGGCATTTAAAGTCCAGG + Intergenic
1083878476 11:65537004-65537026 AGGGGTGGCAGGAACAGGGGTGG - Exonic
1084666057 11:70576977-70576999 AGGGGTGGCCAGGACACTGTGGG + Intronic
1084709363 11:70834501-70834523 AGGGGTGGCAGGTGCAGGGCAGG + Intronic
1085050903 11:73379721-73379743 AGGGATGGCAAGGCCAGAGCTGG - Intronic
1085221406 11:74876605-74876627 AGGGGTTGAAAGAACAGTGTAGG - Intronic
1086617446 11:88839064-88839086 AGGGGTGGCATTTAAAGTCCAGG - Intronic
1086766757 11:90705144-90705166 AAGTGTGGCAAGTACAATGATGG - Intergenic
1090226690 11:125076075-125076097 CGGGATGGAAAGAACAGTGCAGG - Intronic
1090798549 11:130156168-130156190 TGGGGTGGGAAGGACCGTGCAGG + Intergenic
1091073009 11:132586721-132586743 AGGAGTGGCAAGTACATTGGAGG + Intronic
1091762702 12:3097622-3097644 AGGGGTGGCAAGTACAGTGCTGG + Intronic
1094483129 12:30900893-30900915 AGGGTGGGAAAGGACAGTGCAGG + Intergenic
1095503720 12:42869203-42869225 GGGGTTGGCTAGTACAGGGCAGG + Intergenic
1096788227 12:54029963-54029985 AGGGGTGGCAGGGACAGTCCTGG - Exonic
1097249992 12:57627254-57627276 AGGGGTGGCGGGAACAGTGATGG + Intronic
1099423645 12:82495821-82495843 AGGAGTAGAAAGTACAGTGGTGG + Intergenic
1100349220 12:93762882-93762904 TGGGGAGGCTAGAACAGTGCTGG + Intronic
1101041681 12:100761988-100762010 AGGAGAGGCAAGTACACTGGAGG - Intronic
1101972999 12:109330193-109330215 AGAGGTTGCAAACACAGTGCAGG - Intergenic
1109915894 13:68984804-68984826 AGGGCTGGCAAGTTCAGGGCGGG + Intergenic
1110464540 13:75786236-75786258 AGGAGTGGCCACTGCAGTGCAGG - Intronic
1113490973 13:110691634-110691656 AGGGGTGGGAGGTAGAGTGTTGG - Intronic
1113880751 13:113624127-113624149 AGGGTTGGCAGGAACAGGGCTGG - Intronic
1117785071 14:59275070-59275092 TGGGCTGGCAAGAGCAGTGCTGG + Intronic
1118301911 14:64623912-64623934 AGGGGTGGAAATTACAGGGAAGG - Intergenic
1119752368 14:77088738-77088760 AGGGGTGGGAGGAACAATGCAGG + Intergenic
1120970541 14:90203478-90203500 AGGGGTGGCAAGGGCAGTAGGGG - Intergenic
1121570396 14:94942672-94942694 AGGGGTGGCTAGTGCTGTGAGGG - Intergenic
1121616645 14:95318449-95318471 AGGTTGGGCAAGGACAGTGCCGG - Intronic
1122839031 14:104445705-104445727 ATGTGTGGCTAGCACAGTGCTGG + Intergenic
1122890355 14:104729363-104729385 ACGGGTGACAAGCTCAGTGCAGG + Intronic
1125585185 15:40814613-40814635 AGAGGTGGCAGGAACAGAGCAGG + Exonic
1125590595 15:40852446-40852468 GTGGGTGACAAGCACAGTGCAGG - Intronic
1126310638 15:47312537-47312559 AGGGGAAGCAAGCACAGTCCAGG - Intronic
1130541164 15:84821698-84821720 AGAGGAGGAAAGTACAGTGGGGG - Intronic
1130937515 15:88482794-88482816 GGGGGTGGCGTGCACAGTGCTGG + Intergenic
1131059734 15:89397387-89397409 AGGGGTGGCAAGTGCACTCCTGG - Intergenic
1138544516 16:57707703-57707725 GGGTGTGGCAGGCACAGTGCAGG + Intronic
1138582536 16:57950979-57951001 GGGGGTGGCATCTACAGAGCAGG - Intronic
1142848668 17:2694055-2694077 AGGGGTGGCAAGGTCAGGACGGG + Intronic
1148105478 17:45116553-45116575 AGAGGTGGCACGAGCAGTGCGGG + Intronic
1149639506 17:58193658-58193680 AGGGATGGGAGGTACAGAGCAGG + Intronic
1150289084 17:63971418-63971440 AGGGTTGGGAAGGACAGTGCAGG + Intronic
1150522836 17:65887788-65887810 AGGGGTGGCAAGAGGACTGCAGG - Intronic
1152029816 17:77834997-77835019 AGGGGAGGCAAGGACAGAGGGGG - Intergenic
1152069656 17:78128404-78128426 AGGGGCGGGGAGGACAGTGCGGG - Intronic
1152352723 17:79792421-79792443 AGGGGCGGCAGGGACAGAGCTGG + Exonic
1152928468 17:83098599-83098621 TGGGGTGGCAGGGACAGTCCTGG + Intergenic
1153432411 18:5032250-5032272 GGGATTGGCAAGTACAGTGTGGG - Intergenic
1156707520 18:39900917-39900939 AGAAGTGGCAAGTACATTGAAGG + Intergenic
1157155574 18:45262353-45262375 AGGGGCAGCATGTACAGTGGTGG - Intronic
1157413159 18:47480630-47480652 GGGGTTGGCTAGGACAGTGCAGG + Intergenic
1157536356 18:48461013-48461035 AGGGGAGGCGAATACAGAGCTGG + Intergenic
1159913127 18:74165153-74165175 GGGGATGGCAAGTGCAGGGCTGG - Intergenic
1160508303 18:79439391-79439413 TGGGGTGGAAACTAAAGTGCAGG + Intronic
1162567167 19:11450879-11450901 AGGGGTGGCAGGGACAGGGCTGG - Exonic
1165462934 19:35954676-35954698 AGAGGTGGCAGGGCCAGTGCGGG - Intergenic
1167579891 19:50335110-50335132 AGGGGTGGGATGTAGTGTGCCGG + Intronic
1167583465 19:50359791-50359813 AGGGGTGGGATGTAGTGTGCCGG + Exonic
925358856 2:3263211-3263233 AGGGATGGCCAGAGCAGTGCTGG - Intronic
925691609 2:6529687-6529709 ACTGGTGGGAAGTACAGTGAGGG + Intergenic
927980887 2:27374457-27374479 AGGGGTGGGAGGTGCTGTGCTGG + Intronic
931914279 2:66935887-66935909 AAGAGAGGGAAGTACAGTGCTGG + Intergenic
933677389 2:85068900-85068922 TGAGTTGGCTAGTACAGTGCCGG + Intergenic
933714577 2:85350683-85350705 GGGGGTGGAGAGTGCAGTGCGGG - Intronic
937261932 2:120592004-120592026 AGGGGTGCCAGGGAAAGTGCAGG - Intergenic
938552366 2:132393851-132393873 AGCAGTGGGAAGTACAGTGGGGG - Intergenic
938552420 2:132394123-132394145 AGCAGTGGGAAGTACAGTGGGGG - Intergenic
938552433 2:132394185-132394207 AGCAGTGGGAAGTACAGTGGGGG - Intergenic
938552446 2:132394246-132394268 AGCAGTGGGAAGTACAGTGGGGG - Intergenic
938552464 2:132394337-132394359 AGCAGTGGGAAGTACAGTGGGGG - Intergenic
940269234 2:151873562-151873584 AGGGATGGGAAGTACAGGGAAGG + Intronic
944414100 2:199466549-199466571 AGGATTGGCAAGGAAAGTGCAGG + Intronic
946970274 2:225083372-225083394 AGGGGTGACTAGCACAGTGCTGG - Intergenic
947232271 2:227900598-227900620 AGGGGTGGCATGTGCATTCCAGG + Intronic
1171127206 20:22612964-22612986 AGGGATGGCAAGTTCACAGCAGG + Intergenic
1171284372 20:23925042-23925064 ACGGGAGCCAAGTCCAGTGCGGG + Intergenic
1172596771 20:36155338-36155360 AGGGGAGGCAAGCCCAGAGCGGG - Intronic
1173569755 20:44068560-44068582 GGGGGTGGGGCGTACAGTGCAGG + Intronic
1173880153 20:46406184-46406206 AGGGGCGGCAAGGAGAGGGCTGG - Intronic
1176735542 21:10542861-10542883 AAGGGTGGCAAATACATTACAGG - Intronic
1178569553 21:33723164-33723186 AAGGGTGGCAAATACAGTTTTGG + Intronic
1180225377 21:46388908-46388930 AGGGGCTGCAAGCACAGGGCTGG - Intronic
1181587055 22:23858457-23858479 AGCGGTGGGCAGTGCAGTGCGGG - Intronic
1182787549 22:32920280-32920302 AGGGATTGCAAATACAGGGCAGG - Intronic
1183329400 22:37211489-37211511 AGGCGTGCCAAGCACAGTGCCGG + Intronic
1183521624 22:38298999-38299021 GTGGGTGGCTAGGACAGTGCTGG - Intronic
1184813673 22:46854400-46854422 AGGGGTGGCTTGTTCAGTGGAGG - Intronic
1203274576 22_KI270734v1_random:78866-78888 ATGGGTGGCAAGGACAGAACAGG - Intergenic
951884717 3:27513140-27513162 AGGGGTGGAAAGTAGAGACCTGG + Intergenic
953064122 3:39453799-39453821 AGAGGTCGCAAGTCAAGTGCTGG + Intergenic
955289659 3:57679552-57679574 AAGGATGGAAAGTACAGTACTGG + Intronic
955805579 3:62730503-62730525 TGGAGTGGCAGGTACACTGCAGG + Intronic
956635147 3:71356520-71356542 TGGGGTGCCTAGTACAATGCTGG + Intronic
960485664 3:118249880-118249902 AGGATTGGCAAGTAAAATGCAGG + Intergenic
960993378 3:123325857-123325879 AGGGGGAGGAAGCACAGTGCGGG - Intronic
961369933 3:126422936-126422958 AGGGGAGGCAAGGTGAGTGCTGG + Intronic
962059691 3:131912683-131912705 ATAGGTGGCAAGCACTGTGCTGG + Intronic
963118434 3:141754190-141754212 AGGGGTAGGAAGTCCAGGGCTGG + Intergenic
965093529 3:164193037-164193059 AGAGGCTGCAATTACAGTGCTGG + Intergenic
966034237 3:175391269-175391291 AAGGGTGGCAAGTACATTAGTGG - Intronic
967535220 3:190594308-190594330 AGAGGTGGAAAGTTCAGGGCTGG + Intronic
968295489 3:197573358-197573380 ATGTGTGACAAGTACAGTGGGGG + Intergenic
968481449 4:834873-834895 AGGGGCGGGAAGTCCAGTGGTGG + Intergenic
968551596 4:1226278-1226300 TGGGGTGGGAAGTGCCGTGCAGG - Intronic
970842032 4:20484977-20484999 AGGGGTTGCAAGTTCACTGCAGG - Intronic
971536500 4:27758516-27758538 AAGGGGGGCTAGTACTGTGCGGG - Intergenic
972869692 4:43282194-43282216 AGGTTTGGAAACTACAGTGCAGG + Intergenic
973808882 4:54551068-54551090 GGAGGTGACAAGTACATTGCAGG + Intergenic
978330641 4:107609395-107609417 CGTGGTGGCAAGGACAGAGCTGG - Intronic
979596701 4:122542276-122542298 ATGGGTGGGAAGTGGAGTGCAGG - Intergenic
982065693 4:151652694-151652716 AGGAGGGGCATGGACAGTGCAGG + Intronic
982639547 4:157941026-157941048 AGAGATGGAAAGTACAGTGGTGG + Intergenic
983026558 4:162744932-162744954 AGGGGTGGTAAATACATTGAAGG - Intergenic
984924250 4:184792816-184792838 AGGGGTTGCAAGCTGAGTGCTGG + Intronic
988611567 5:32731852-32731874 AGGGGTGGGAAGTTGAGGGCAGG + Intronic
988694995 5:33613018-33613040 AGGGGTGGGAAAGCCAGTGCAGG + Intronic
990737446 5:58879601-58879623 AGGGGTGGCAAGTACAAAAAGGG - Intergenic
994954434 5:106510205-106510227 AGGGGAGGGAAGGACAGGGCAGG - Intergenic
996879746 5:128282733-128282755 AAGGGTAGAAAGTACAATGCTGG - Intronic
997435110 5:133868208-133868230 AGGTGTGCCAGGCACAGTGCTGG + Intergenic
997736524 5:136216415-136216437 AGGGGTGCCCTGCACAGTGCGGG + Intronic
999229406 5:150052796-150052818 TGGGGTGGAGAGGACAGTGCTGG - Exonic
1000993574 5:167935789-167935811 GGGGATGCCAAATACAGTGCTGG - Intronic
1001641611 5:173247708-173247730 AGTGGAAGCAAGTACACTGCTGG - Intergenic
1001904344 5:175459055-175459077 AGGGGTGGCAAGCAAACGGCAGG - Intergenic
1001960685 5:175878876-175878898 AGGGGTGGGAAGGAGAGGGCGGG - Intronic
1002888558 6:1316016-1316038 AGAGGTGGGAAGGACAGAGCTGG - Intergenic
1003411454 6:5866542-5866564 AGGTGTGGTCAGTGCAGTGCTGG + Intergenic
1003792510 6:9562684-9562706 AGAGGTGTCAGGTGCAGTGCGGG + Intergenic
1006784862 6:36659525-36659547 AGGGGTGGCATGTGGTGTGCTGG - Intergenic
1007166397 6:39831797-39831819 GGGGGGGGCAGGTGCAGTGCAGG + Intronic
1007376087 6:41457606-41457628 AGGCGTGGGAAGTGCAGCGCAGG + Intergenic
1007865815 6:44968983-44969005 AGGGGTGGCCAGCACAGTAATGG - Intronic
1008085367 6:47238903-47238925 AGGGTTGGCAAGGACACAGCTGG - Intronic
1008386531 6:50897584-50897606 CTGGGTGACAGGTACAGTGCAGG + Intergenic
1010555342 6:77272893-77272915 AGAGATGGCAAGTAGAGTGGTGG - Intergenic
1011659120 6:89578948-89578970 AGGGGTGGCCAGCATAGTGGTGG - Intronic
1013637662 6:112044532-112044554 AGGTGAGGCAAGGATAGTGCAGG + Intergenic
1014884502 6:126763360-126763382 AGGGGTGGCAAGTTGAGGGTGGG + Intergenic
1016384611 6:143518209-143518231 CAGGGTGGCAGGTGCAGTGCTGG - Intergenic
1019498983 7:1355047-1355069 AGGGGCGGCAGGTGCAGGGCAGG - Intergenic
1019699694 7:2468665-2468687 AGGAGGGGCACGTACAGGGCCGG - Intergenic
1022528892 7:31054731-31054753 AGGTGTGCCAAGTGCAGAGCCGG + Intronic
1022787150 7:33649955-33649977 TGGGGTGGCAAGTGAAGTGGTGG - Intergenic
1023222400 7:37932650-37932672 AAGGATGGGAAGGACAGTGCAGG - Intronic
1024150286 7:46564716-46564738 TGTAATGGCAAGTACAGTGCAGG - Intergenic
1028056584 7:86252661-86252683 AGATGTGGCCAGCACAGTGCTGG - Intergenic
1030621940 7:111799486-111799508 AGGGGTTGAAAGAACAGTGTAGG - Intronic
1031296438 7:120010000-120010022 AGGGGTGGCAAGTCAATTGCAGG + Intergenic
1033347298 7:140535366-140535388 AGGGTTTGCAAGTACAGTGATGG - Intronic
1033495762 7:141893629-141893651 ATAGGTGGCAAGTACATGGCTGG - Intergenic
1034826912 7:154273963-154273985 AGGTGTGGCAGGTGCAGTCCAGG - Intronic
1035751343 8:1998901-1998923 AGTGGTGGCCAGTCCAGGGCCGG - Intronic
1037715329 8:21392591-21392613 AGCTGTGGCAAGTACAATGGAGG + Intergenic
1043310588 8:78854386-78854408 AGGTGTGGCAGGTTCAGTGGAGG - Intergenic
1044004180 8:86921923-86921945 AGAGGTGGTAAGTGCAGTGTAGG + Intronic
1045029782 8:98124107-98124129 AGGGCAGGGCAGTACAGTGCAGG + Intronic
1047623802 8:126635185-126635207 AGGGCTGGCCAGCACAGTTCTGG + Intergenic
1048991666 8:139764092-139764114 AGTGATGGCAAGTACGGTGAGGG + Intronic
1049021490 8:139960439-139960461 AGGGGTGGCCAGTTCAGACCAGG - Intronic
1049286453 8:141778047-141778069 AGGGTTGGCACCCACAGTGCAGG - Intergenic
1049455402 8:142683893-142683915 AGGGGTGGAGAGTTCTGTGCGGG - Intergenic
1052411458 9:28127138-28127160 AGGTGTGGCAAGTACAGAGAAGG - Intronic
1052434888 9:28413711-28413733 AGGGGTGGCACCTGCTGTGCAGG + Intronic
1053478801 9:38400990-38401012 AGGGGAGACAATTACAGAGCCGG + Intergenic
1056073535 9:83014701-83014723 AAGTGTGTCTAGTACAGTGCCGG + Intronic
1059486630 9:114632327-114632349 AGGGATGGGATGGACAGTGCTGG - Intronic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060943066 9:127554420-127554442 GGGGGTTGCAAGCACAGGGCAGG - Intronic
1061258850 9:129468027-129468049 AGGAGTGGCAAGTGCAAGGCTGG - Intergenic
1061949267 9:133927108-133927130 AGTGGTGGCAAGAACAAGGCAGG + Intronic
1061987876 9:134140650-134140672 ACGGGTGGAACGTACAGTGGTGG + Intronic
1062360340 9:136185260-136185282 AGGAGTGGCGAGTGCCGTGCAGG - Intergenic
1062707613 9:137954050-137954072 AGGAGTGGGAAATACCGTGCAGG - Intronic
1185460836 X:332181-332203 AGGGGCGGCAGGGACAGTGATGG - Intergenic
1186466609 X:9788467-9788489 AGGGGTGTCAAGAACAAGGCTGG + Intronic
1187396829 X:18926750-18926772 AGGGGTGGCAAGGACAGAATGGG - Intronic
1189911001 X:45810459-45810481 AGGGGAGGCAAGGAAAGTGAAGG + Intergenic
1190922631 X:54870552-54870574 AGGCATGGCAGGTATAGTGCAGG + Intergenic
1194693965 X:97022120-97022142 AGGGCTAGAAAGTACAGAGCTGG - Intronic
1194977565 X:100409609-100409631 AGGGGAGGCAACAACAGTACCGG + Exonic
1195676276 X:107509398-107509420 GTGGCTGGCAAGTCCAGTGCTGG + Intergenic
1195990089 X:110673664-110673686 ACGGCTGGTAAGTACAGAGCTGG + Intergenic
1196058732 X:111385129-111385151 AGGGCTGGCAAATCCAGGGCAGG - Intronic
1197635533 X:128910883-128910905 CGGGGTGGCAGGCACAGTGGTGG + Intergenic