ID: 1091763121

View in Genome Browser
Species Human (GRCh38)
Location 12:3100697-3100719
Sequence TCATCCTTCTGCACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091763109_1091763121 25 Left 1091763109 12:3100649-3100671 CCTGCATTATTTGAAGACTCACC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763111_1091763121 4 Left 1091763111 12:3100670-3100692 CCCCAGGCATCACCTCATTTCCT 0: 1
1: 0
2: 4
3: 26
4: 347
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763113_1091763121 2 Left 1091763113 12:3100672-3100694 CCAGGCATCACCTCATTTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763112_1091763121 3 Left 1091763112 12:3100671-3100693 CCCAGGCATCACCTCATTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763115_1091763121 -8 Left 1091763115 12:3100682-3100704 CCTCATTTCCTGGTGTCATCCTT 0: 1
1: 0
2: 5
3: 22
4: 321
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091763121 Original CRISPR TCATCCTTCTGCACTGGGGT GGG Intronic