ID: 1091763121

View in Genome Browser
Species Human (GRCh38)
Location 12:3100697-3100719
Sequence TCATCCTTCTGCACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091763109_1091763121 25 Left 1091763109 12:3100649-3100671 CCTGCATTATTTGAAGACTCACC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763113_1091763121 2 Left 1091763113 12:3100672-3100694 CCAGGCATCACCTCATTTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 276
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763112_1091763121 3 Left 1091763112 12:3100671-3100693 CCCAGGCATCACCTCATTTCCTG 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763111_1091763121 4 Left 1091763111 12:3100670-3100692 CCCCAGGCATCACCTCATTTCCT 0: 1
1: 0
2: 4
3: 26
4: 347
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203
1091763115_1091763121 -8 Left 1091763115 12:3100682-3100704 CCTCATTTCCTGGTGTCATCCTT 0: 1
1: 0
2: 5
3: 22
4: 321
Right 1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG 0: 1
1: 0
2: 3
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091763121 Original CRISPR TCATCCTTCTGCACTGGGGT GGG Intronic
903035804 1:20491841-20491863 TGCCCCTTCTGAACTGGGGTGGG - Intergenic
903557507 1:24204337-24204359 ACAGCCTTCTGCACTGGGGAGGG + Intergenic
906530025 1:46518399-46518421 GCATCCATCTGGACTGGGGGAGG + Intergenic
907405682 1:54252101-54252123 TCATCCTGCTGTCTTGGGGTAGG + Intronic
908910904 1:69071691-69071713 CCATCCTTCCTCACTGGGCTGGG - Intergenic
912915992 1:113815523-113815545 TCATCCTCCTTCTTTGGGGTGGG - Intronic
914883032 1:151562307-151562329 TCAGCCTTCTGCACTGCTTTGGG + Intronic
916105218 1:161424667-161424689 TCCTCCCTCTGCACTGGTGAGGG - Intergenic
917062564 1:171056409-171056431 TCATCCTTCCTCACTGGGTGGGG + Intronic
917356429 1:174131185-174131207 TCATCCTTCCTCACTGGGCAGGG - Intergenic
924113047 1:240718696-240718718 TCTTCCTTATGCACTTAGGTTGG + Intergenic
924131509 1:240914067-240914089 TCATCATTCTGTTGTGGGGTGGG - Intronic
924555587 1:245115731-245115753 CCATCATTCTGCCCTGGTGTTGG - Intronic
924587296 1:245371236-245371258 TCGTCCTGATGCCCTGGGGTGGG + Intronic
1066657119 10:37706190-37706212 TCATCCTTGTGATCTGGGGAGGG + Intergenic
1067041666 10:42956429-42956451 TCATCCTTGTGATCTGGGGAGGG + Intergenic
1067308515 10:45090685-45090707 TCATCTTTCTGCACTGTGTTCGG + Intergenic
1067684678 10:48459205-48459227 TCCTCCATCTGCTCTGGGGCCGG - Intronic
1067764201 10:49072884-49072906 TCAAGATTCTGCACTGGGCTGGG - Intronic
1068126868 10:52851342-52851364 TCATCCTTCTTCAGTGGGTGGGG - Intergenic
1069319317 10:67148359-67148381 TTTTCCTTCTGCACTGGCTTGGG - Intronic
1069747746 10:70726608-70726630 CCTTCCTTCTGTACTGGGGTGGG - Intronic
1070286568 10:75087850-75087872 TCTGCTTTCTGCCCTGGGGTGGG - Intergenic
1072361546 10:94664199-94664221 CCATCCTTCTTCACTGGGTGGGG - Intergenic
1073013901 10:100382884-100382906 TCAGTCTTCAGCACTGGGGGTGG + Intergenic
1073125306 10:101145629-101145651 TGAGCCTTCCGCCCTGGGGTGGG + Intergenic
1076362407 10:129898507-129898529 CCATCCTTCTGGGTTGGGGTGGG - Intronic
1076387438 10:130067383-130067405 TCATCCCTGTGGACTGGGGGAGG + Intergenic
1076615250 10:131750571-131750593 TCATTCTGCTTCACTGGGGAGGG + Intergenic
1076920164 10:133447173-133447195 TTATCTTTCTGCACTGGGTTTGG + Intergenic
1084194213 11:67515003-67515025 CCATTCTCCTGCTCTGGGGTGGG + Intergenic
1084440390 11:69169455-69169477 TCCTCTTTCTGCCCTGGGGACGG - Intergenic
1084440649 11:69170914-69170936 TCCTCTTTCTGCCCTGGGGGCGG + Intergenic
1086050490 11:82583285-82583307 TCATCCTTCTGGCTTGGGCTAGG + Intergenic
1087890629 11:103533693-103533715 TCATGCTTGTGCACTGTGGGAGG - Intergenic
1087896578 11:103593099-103593121 TCATCCCCGTGAACTGGGGTGGG - Intergenic
1089356986 11:117860337-117860359 TCAGCCTGCTGGACTGGGATGGG - Intronic
1089956282 11:122574367-122574389 CCATCCTCCTGCTCTGGGGCAGG + Intergenic
1091763121 12:3100697-3100719 TCATCCTTCTGCACTGGGGTGGG + Intronic
1092144219 12:6203503-6203525 CCATCCTACTCCACTGAGGTTGG - Intronic
1095049834 12:37545721-37545743 TCATCCTTCTTCACCCGGATTGG + Intergenic
1096577372 12:52561380-52561402 CCATCCTCCTGCCCTGGGGAAGG - Intergenic
1097822952 12:64146032-64146054 TCAGCCTTTTGGACTGGGTTGGG + Exonic
1097959858 12:65521905-65521927 TCAGTATTCTGCACTGGGCTTGG - Intergenic
1101208788 12:102515164-102515186 TCATCCTTCTACTCTGTGCTAGG + Intergenic
1102381189 12:112468189-112468211 CCATCCTTCTCCACTGGCCTTGG - Intronic
1103564958 12:121810812-121810834 TCATCCATCTTCTCTGAGGTCGG - Exonic
1104000126 12:124854969-124854991 TCATCCCTCATCCCTGGGGTGGG - Intronic
1105420320 13:20246576-20246598 ACATCCTTCTGCAGCGGGGCTGG - Intergenic
1109781443 13:67115412-67115434 TCATCCTTCTGCTCCTGGGTGGG - Intronic
1110224033 13:73101115-73101137 TCAGCCTTCTTCACTGAGATCGG + Intergenic
1112592283 13:100774860-100774882 TCTTCCTTCATCAGTGGGGTGGG + Intergenic
1116436550 14:44900916-44900938 TGATCCTCCTGCACTCGAGTTGG - Exonic
1118530691 14:66702063-66702085 TCATCCTTCCTCACTGGGTGGGG + Intronic
1119214295 14:72856720-72856742 TCATACTTCTGGATTTGGGTTGG - Intronic
1119596465 14:75939182-75939204 TCATTCTGCTGCACTGGGGTGGG - Intronic
1120988670 14:90355715-90355737 TCATCCTTCCTCACTGGTGTAGG + Intergenic
1122361455 14:101169273-101169295 TCACCCTTCAGCAATGAGGTGGG - Intergenic
1122856375 14:104562177-104562199 ACCTCCTTCTGCTATGGGGTGGG - Intronic
1125389769 15:39179468-39179490 TTATCTTTCTTCCCTGGGGTAGG + Intergenic
1126247660 15:46527968-46527990 TCATTCCTCTTCACTGGGATTGG - Intergenic
1126284580 15:46996535-46996557 TCATCCTTCCTCACTGGGTGGGG - Intergenic
1128795703 15:70465012-70465034 TCATGCATCTGCTCTGGTGTTGG - Intergenic
1130910812 15:88269719-88269741 TCCTCCTGCAGCTCTGGGGTTGG + Intergenic
1130936053 15:88471491-88471513 TCATCCTTCAGCAATGGAGCTGG - Intronic
1132065088 15:98724478-98724500 TCTGCCTATTGCACTGGGGTAGG + Intronic
1132571325 16:645666-645688 CCCTCCATCTGCCCTGGGGTCGG - Intronic
1133382460 16:5342636-5342658 TCTTCCTTCTGTGCTGGGGTAGG + Intergenic
1135083555 16:19456668-19456690 GCCTTCTTCTCCACTGGGGTGGG - Intronic
1140239629 16:73189331-73189353 TGATCATTGTTCACTGGGGTCGG + Intergenic
1140430410 16:74898226-74898248 TGATCTTTCTGCACTGGGGAAGG + Intronic
1140662117 16:77198027-77198049 ACATGCAGCTGCACTGGGGTAGG + Intronic
1144087227 17:11821741-11821763 TCGTTCTTCTGCCCTGGGTTTGG + Intronic
1148141787 17:45334153-45334175 CCAGCCTCCTGCACTGGGCTTGG + Intergenic
1148856514 17:50581849-50581871 TCATCCTTTTGCACTGGAGTTGG + Intronic
1149377931 17:56064456-56064478 TCATCCTTCCTCACTGGGCAGGG - Intergenic
1149856753 17:60089242-60089264 TCGTCCTGCAGCTCTGGGGTGGG + Intergenic
1153984147 18:10338208-10338230 TTCTCCTTGTCCACTGGGGTGGG + Intergenic
1154078027 18:11224348-11224370 TCTTCCAACTGCACTGGGCTGGG + Intergenic
1155157126 18:23167311-23167333 TGATCATTCTCCACTGGGGGAGG - Intronic
1156263301 18:35464357-35464379 TCACCCTACAGGACTGGGGTGGG + Intronic
1156454110 18:37283208-37283230 TCCTCCTTCTACCCTGAGGTTGG + Intronic
1156778490 18:40822056-40822078 TCATCCTTCCTCACTGGGAGGGG + Intergenic
1157203554 18:45679565-45679587 TGAGCCCTCTGCACTGGGGTTGG - Intronic
1157302103 18:46486495-46486517 GCATCCTTCTGCAGTAGGGAGGG + Intronic
1157538211 18:48476870-48476892 TCATCCTCCTGAATTGGAGTGGG - Intergenic
1158729164 18:60003695-60003717 TCATCCTTCCTCACTGGGCAAGG - Intergenic
1158882370 18:61793055-61793077 TCATCCTTCAGTCCTGGGGGAGG - Intergenic
1159942119 18:74416256-74416278 CCATCCTTTTCCATTGGGGTCGG - Intergenic
1159943816 18:74428874-74428896 TCATCCTTCTCCACAGGAGATGG - Intergenic
1161153051 19:2719651-2719673 TCTACCTGCTGCACTGGGGGTGG + Intronic
1163958419 19:20665053-20665075 TCATCCCTCCACACTGGGCTGGG - Intronic
1165868731 19:38955256-38955278 TCTTGCTTCTTCACTCGGGTGGG + Intronic
925240230 2:2319129-2319151 TCAGCTGTCTGCACTGGGGCAGG + Intronic
926119572 2:10234804-10234826 CCATCCTCCAGCACTGGGGAAGG - Intergenic
926423685 2:12722157-12722179 TCATCATTTTGCAGTGTGGTAGG - Intronic
927978275 2:27356839-27356861 TTTACCTTGTGCACTGGGGTGGG - Intronic
928542714 2:32298599-32298621 TCATCCTGCTGCAGTGCAGTGGG + Intronic
928656095 2:33453113-33453135 TCTTATTTCTGTACTGGGGTAGG + Intronic
930218072 2:48717671-48717693 TCATCCTTCTCCAATGAAGTAGG + Intronic
930318591 2:49827300-49827322 TCATCCTTCCTCACTGGGCAGGG - Intergenic
935818817 2:106873280-106873302 TTCTCCATCTGCAATGGGGTTGG + Intronic
936849075 2:116873939-116873961 TCACCCTTCTTCACTGGGTGGGG - Intergenic
937882774 2:126880912-126880934 GAATCCTTGTGCACTGGGGTGGG + Intergenic
937917282 2:127105494-127105516 TCCTCCTCCTTCCCTGGGGTGGG + Intronic
939362486 2:141190945-141190967 TTATCCTTCTCCCCTGGAGTAGG + Intronic
941308419 2:163898559-163898581 CTATCCTTGTGCCCTGGGGTGGG - Intergenic
941907664 2:170732543-170732565 TCATCCTTCTGGACTGGGCGTGG + Intergenic
942368797 2:175258433-175258455 GAATCCTACTGCACTGGGTTTGG - Intergenic
947480081 2:230491390-230491412 TCATCCTTCCTCACTGGGTGGGG - Intronic
947750740 2:232530679-232530701 CCTTCCATCTGCAGTGGGGTTGG + Intronic
948136517 2:235640390-235640412 TTATCCTTCTGACCTGGGTTGGG - Intronic
948151451 2:235747819-235747841 TCTTCCTGCTGCTTTGGGGTAGG + Intronic
949058100 2:241940208-241940230 ACATCCTTCTTCACAGGGGAGGG - Intergenic
1169068365 20:2707130-2707152 TCTTCCCTCTGCCCTGGGATTGG - Intronic
1169811843 20:9616560-9616582 TCATCCTTCAGGGCTGGGCTGGG + Intronic
1170143823 20:13151523-13151545 TCATCCTTGAGAACTGGAGTTGG + Intronic
1171441014 20:25163013-25163035 TAATACTACTGCACTGGGGATGG - Intergenic
1172107213 20:32523959-32523981 TCCTCCTTCTGCCCTGAGGGTGG + Intronic
1174501922 20:50991440-50991462 TCATCCCTCAGGTCTGGGGTGGG + Intergenic
1174953332 20:55067162-55067184 TCATCCCTCCTCACTGGGTTGGG - Intergenic
1179422200 21:41245618-41245640 TCTTCCCTCTGCCCTGGGGCAGG + Intronic
1180030197 21:45201704-45201726 ACCTCTTCCTGCACTGGGGTAGG + Intronic
1182026188 22:27121107-27121129 TAATCCTTCTGAAGTTGGGTGGG - Intergenic
1182115053 22:27751627-27751649 TCATCCTTCCCCCCTGGAGTTGG - Intronic
1184339565 22:43878904-43878926 TCTCCCCTCTGCACTGGGGGAGG + Intergenic
1185182748 22:49372626-49372648 TCTGCCGTCTGCACTGGGGACGG + Intergenic
951764762 3:26185352-26185374 TCTTCCTTCTGCCCTGAGGGTGG + Intergenic
953150549 3:40320422-40320444 TCATGCTTCTCCCCTGGAGTAGG + Intergenic
953511842 3:43549382-43549404 TCATCCTTCTGCCTTGGCTTGGG + Intronic
953694602 3:45147455-45147477 TCCTCCTTGTGGACAGGGGTGGG + Intergenic
954648235 3:52144283-52144305 TCAGCCTTCTGCTCTGGGCCAGG - Intronic
954748031 3:52798073-52798095 TCCTCCTTGCCCACTGGGGTTGG + Intronic
955633812 3:61003974-61003996 TCATCCTTATGCTTGGGGGTGGG + Intronic
955800502 3:62681207-62681229 CCATCCTTCTGCCCTAGGGCAGG + Intronic
957268850 3:78003160-78003182 TCATCCTTCCTCACTGGGTGGGG - Intergenic
957751777 3:84428668-84428690 TCATTCTTCTGCATGGTGGTGGG - Intergenic
959253032 3:103972510-103972532 TCTACCTTCTGCACTGGGGCAGG + Intergenic
959811548 3:110626092-110626114 TCATACTTATGCTCTGGGTTGGG - Intergenic
961036977 3:123649182-123649204 TCATCCTTCGGCTCTGGGGGGGG + Exonic
961129729 3:124454931-124454953 TCATCCCTCAGTGCTGGGGTGGG - Intronic
961455789 3:127023235-127023257 GCATCCTTCTGCTGGGGGGTGGG - Intronic
962678590 3:137775404-137775426 TCATTCTTCTTCACTGGGGAGGG + Intergenic
964546761 3:157842764-157842786 TCTTCCTTTTAAACTGGGGTGGG + Intergenic
967978383 3:195048296-195048318 TCAGCCTGCAGCACTGGGGCTGG + Intergenic
968935514 4:3608119-3608141 TCCTCCCTCTCCACTGAGGTGGG + Intergenic
970287960 4:14539419-14539441 TCATCCTTCCTCACTGGGTGGGG + Intergenic
972131767 4:35845532-35845554 TCATACTTCTGAATTGTGGTTGG - Intergenic
972231131 4:37073820-37073842 TCCACTTTCTCCACTGGGGTTGG + Intergenic
973584683 4:52377975-52377997 TCATCCTTCCTCACTGGGTGGGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
982131430 4:152232286-152232308 TCATCTTTCAGCACTGGAGAAGG - Intergenic
983583641 4:169333641-169333663 TCATCATTCTGCACAGGGTTGGG + Intergenic
986140671 5:5026648-5026670 TCATCCTTCCTCACTGGGCAGGG + Intergenic
986412160 5:7492086-7492108 TCACCCTCCTGCACTGGACTTGG + Intronic
990772492 5:59264926-59264948 TAAGCCTTCTGCACTGAGCTGGG + Intronic
991479840 5:67065986-67066008 TCAACACTCTGCACTGGAGTTGG + Intronic
995527711 5:113063954-113063976 TCAGCCTTCTGCTCTGGGGTGGG - Intronic
995594200 5:113730957-113730979 TCATCCTTCCTCACTGGGCCAGG - Intergenic
995666199 5:114544931-114544953 CCATCCTTCTTCACTGGGTGGGG + Intergenic
995816710 5:116177531-116177553 ACATTATTCTGCAGTGGGGTGGG - Intronic
997096950 5:130923970-130923992 TCATCCTTCCTCACTGGGTCGGG + Intergenic
997824931 5:137097927-137097949 TCTGCCTTCTGCTCTCGGGTAGG - Intronic
999145348 5:149389602-149389624 ACATTCTTCAGCACTGGGATGGG + Intronic
1002079607 5:176729516-176729538 TCTTCCTCCTTCCCTGGGGTGGG - Intergenic
1002943117 6:1735052-1735074 CCATCCTTATCCACTGGGGGTGG - Intronic
1005170628 6:22980720-22980742 TCATCCTTCCTCACTGGGTGGGG + Intergenic
1005354922 6:24973310-24973332 TCATCCTTCTAGGCTGGGCTTGG + Intronic
1005774760 6:29118865-29118887 TCTTGCTCCTGCACTGGGGGTGG + Intergenic
1006625149 6:35392515-35392537 TCATCCATCTGGACTGGCCTTGG - Intronic
1006734347 6:36262052-36262074 TTCTCCTTCTCCACTGGGGAGGG + Intronic
1006934601 6:37708607-37708629 AGATCCCTCTGCACTGGAGTGGG - Intergenic
1007128747 6:39449677-39449699 TCATCCTACTGTACTGGAGAAGG - Intronic
1008976461 6:57433176-57433198 CCATCATTTAGCACTGGGGTTGG - Intronic
1010587711 6:77674147-77674169 ACTTCCTTCAGCAGTGGGGTTGG + Intergenic
1010688058 6:78875609-78875631 TTCTGTTTCTGCACTGGGGTAGG - Intronic
1011944195 6:92880685-92880707 TCATCCTTCCTCACTGGGTGGGG + Intergenic
1012634929 6:101526116-101526138 TGAGCCATCTGCACTGAGGTCGG - Intronic
1012758345 6:103263115-103263137 TCATCCCTCTCCACTGGGTTAGG + Intergenic
1015818730 6:137237529-137237551 GCATGTTTGTGCACTGGGGTGGG + Intergenic
1019140097 6:169937571-169937593 TCGTGCTTCTGCACAGGGCTCGG - Intergenic
1020840006 7:13204641-13204663 TCATCCTTCTGTGCTTGGCTTGG + Intergenic
1021353172 7:19620570-19620592 TCCTCCTTCTGGATTGTGGTAGG - Intergenic
1022240202 7:28503885-28503907 TGGTCCTTCTGCTCTGGGGGTGG - Intronic
1023136524 7:37058459-37058481 CTTTCCTGCTGCACTGGGGTGGG + Intronic
1026727675 7:72882292-72882314 TCTTCCTTCTGCTCTGGTGATGG - Intronic
1029457615 7:100679017-100679039 TCCTTCTGCTGCCCTGGGGTTGG + Exonic
1032854420 7:135822557-135822579 CCATTCTTCTGCACAGGGGACGG - Intergenic
1034195075 7:149239982-149240004 GCTTCCTTCTGCAGCGGGGTCGG + Intronic
1035047701 7:155980160-155980182 TCACCCCTCTCCACTGGGTTAGG + Intergenic
1036470652 8:9049658-9049680 TGATCCTTCTGCATTGAGGGAGG + Intronic
1039402246 8:37279648-37279670 TCATCCTTCCTCACTGGGTGGGG + Intergenic
1042961802 8:74311270-74311292 TCTTCTGTCTGCACTGGGCTAGG + Intronic
1044386861 8:91599233-91599255 TCCTCCTTCTGCATGAGGGTAGG - Intergenic
1044741516 8:95332234-95332256 CCATTCTCCTGCAGTGGGGTGGG + Intergenic
1047140971 8:122139271-122139293 TAATCATTTCGCACTGGGGTCGG - Intergenic
1048223716 8:132565714-132565736 TCATCTTTCTTCAGTGGGGGTGG + Intergenic
1048621185 8:136134469-136134491 CCAACATTCTGAACTGGGGTTGG - Intergenic
1049134334 8:140881266-140881288 TAAACCTTGTGCTCTGGGGTGGG + Intronic
1049925599 9:404078-404100 TCATATTTCTGTGCTGGGGTGGG + Intronic
1052546662 9:29889015-29889037 CCATCCTTCTTCACTGGGTGGGG + Intergenic
1054454670 9:65423738-65423760 TCCTCCCTCTCCACTGAGGTGGG - Intergenic
1055589474 9:77796370-77796392 ACATCCATCTTCAATGGGGTGGG + Intronic
1055596393 9:77869333-77869355 TTCTCCTTATGCACTGAGGTTGG - Intronic
1056860350 9:90175362-90175384 TCAACCATCTGCCCTTGGGTTGG + Intergenic
1057047701 9:91898775-91898797 GTCTCCTTCTGCACTGGGGCTGG - Intronic
1057055756 9:91959474-91959496 TCATCCTGCTGAACTGTGATGGG - Intergenic
1057667989 9:97061490-97061512 TGATCCTACTGCACTGGGACAGG + Intergenic
1060969040 9:127727521-127727543 GCATCCTTCAGCCCTGGGCTGGG - Intronic
1186640452 X:11449687-11449709 GCATCCTTCAGCACAGGGGCTGG + Intronic
1186987513 X:15032853-15032875 TCATCCTTGGCCAGTGGGGTTGG + Intergenic
1188089324 X:25943429-25943451 TCATGCTTGTGGAGTGGGGTAGG + Intergenic
1189474825 X:41343279-41343301 GCATGCTTTTGCACTGGAGTTGG - Exonic
1189960597 X:46321234-46321256 TCATCTTTCTGCTCTGCGGATGG - Intergenic
1190399022 X:50013217-50013239 TCATTCTTCTGCACATGGGAGGG - Intronic
1190605349 X:52136243-52136265 TCTTCTTTCTGTACTAGGGTGGG - Intergenic
1192413198 X:70953486-70953508 CCATCATGCTGAACTGGGGTCGG - Intergenic
1193257494 X:79367169-79367191 TCCTCCTTTTGCACGGCGGTAGG + Exonic
1195979344 X:110561145-110561167 TCATCCTTCCTCACTGGGTGGGG - Intergenic
1196054489 X:111340293-111340315 TCATCCTTCCTCACTGGGTGGGG + Intronic
1197030095 X:121802910-121802932 TCATGCTTCTTCACTGGGCAGGG - Intergenic
1197485491 X:127045326-127045348 TAAACCTTCTACTCTGGGGTAGG - Intergenic
1200074950 X:153546272-153546294 TCCTCCCTCTGCACTGGGACGGG - Intronic