ID: 1091763452

View in Genome Browser
Species Human (GRCh38)
Location 12:3102975-3102997
Sequence CCAGGCCACTTGCTGTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091763446_1091763452 25 Left 1091763446 12:3102927-3102949 CCATCTTTTGAATGAGGAAGATG 0: 1
1: 0
2: 3
3: 34
4: 442
Right 1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 134
1091763444_1091763452 30 Left 1091763444 12:3102922-3102944 CCTGCCCATCTTTTGAATGAGGA 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 134
1091763445_1091763452 26 Left 1091763445 12:3102926-3102948 CCCATCTTTTGAATGAGGAAGAT 0: 1
1: 0
2: 2
3: 37
4: 529
Right 1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091763452 Original CRISPR CCAGGCCACTTGCTGTTAGG TGG Intronic
900525373 1:3125877-3125899 CCAGGCCCATTGCTGTCACGGGG + Intronic
902301477 1:15505625-15505647 CCAGGCCCCTTGCTGCTGGTGGG - Intronic
903298911 1:22364049-22364071 ACAGGGCACTTGCTGTTTGTCGG + Intergenic
903847474 1:26287069-26287091 CCAAGCCACTTGGTGAGAGGAGG + Intronic
907555024 1:55335943-55335965 TCAGGCTATTTGCTGTTAGAAGG + Intergenic
908804092 1:67912202-67912224 CCAGCCCTCTTGATGTTAGAAGG - Intergenic
910798852 1:91125172-91125194 CTAGCCCACTTGCAGTTGGGTGG + Intergenic
910804164 1:91173921-91173943 CCAGCCTCCTTGCAGTTAGGAGG - Intergenic
913123701 1:115765841-115765863 CCAGGGCTGTGGCTGTTAGGGGG - Intronic
915063938 1:153209321-153209343 TCAGGCAACTGGCTGTGAGGTGG + Intergenic
915192640 1:154164497-154164519 CCTGGCCACTTGATGTGAGGAGG - Intronic
915497643 1:156293102-156293124 CCAGGGCTCATGCTGCTAGGGGG - Exonic
919470457 1:197972505-197972527 CCAGGACAAATGCTGTTAGAAGG + Intergenic
920369371 1:205468341-205468363 CCAGGCCCCTTGCTATAAGAGGG + Intergenic
921298510 1:213727121-213727143 TCAGCCCCCTTGCAGTTAGGTGG - Intergenic
923478756 1:234362970-234362992 CCAGGCCTGTTTCTGGTAGGTGG - Intergenic
1070779165 10:79127543-79127565 CCAGCCCACTTGATATTATGAGG - Intronic
1071416452 10:85446173-85446195 CCAGTGCCCTTGCAGTTAGGTGG - Intergenic
1075526440 10:123190997-123191019 CAAGGCCACATGCTGCTAAGAGG - Intergenic
1076186430 10:128453225-128453247 CCAGGACTCTTGCTGTCAGAGGG + Intergenic
1076423498 10:130351125-130351147 ACAGGCCACTTGCTGTGTTGGGG + Intergenic
1076692431 10:132230648-132230670 CCAGGGCTCTTGCTGCTGGGGGG + Intronic
1080497279 11:32832190-32832212 CCAGGCCCCGTGCTGTGTGGTGG + Intronic
1080669007 11:34358808-34358830 CGATACCACTTGCTGTCAGGTGG + Intergenic
1080728139 11:34917232-34917254 CTAGGCCTCTCTCTGTTAGGAGG + Intronic
1081650454 11:44820286-44820308 GAATGCCTCTTGCTGTTAGGTGG + Intronic
1085379105 11:76096697-76096719 CCAGGCCTCTTGCTGTCATCTGG + Intronic
1088670040 11:112131845-112131867 TCAGCCACCTTGCTGTTAGGAGG - Intronic
1089242075 11:117090244-117090266 CCAAGCTACTCGCTATTAGGAGG + Intronic
1089351777 11:117825383-117825405 CCAGGCCAAATGGTGGTAGGAGG - Intronic
1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG + Intronic
1095954926 12:47800463-47800485 CCAGGCCTCTTGATATTCGGGGG - Intronic
1100224272 12:92540515-92540537 CCAGGGCAATTGCAGTTTGGCGG - Intergenic
1103091301 12:118099990-118100012 CTAAGCCACTTGCTGAAAGGTGG + Intronic
1103392362 12:120583896-120583918 CCCGGCCAGGTGCTGTCAGGAGG + Intergenic
1110373035 13:74760521-74760543 CCAGGCTCCTTGCAGTTAGACGG - Intergenic
1113634688 13:111911581-111911603 CCAGGAAACTTGCTGTTGGGAGG - Intergenic
1116744839 14:48804811-48804833 CCAGGCAGCTTGCTGTTTGATGG + Intergenic
1119787443 14:77324070-77324092 CCAGGCCACGCTCTGTTGGGGGG + Intronic
1121686180 14:95836897-95836919 CCACGCCACCTGCTGCTAAGAGG + Intergenic
1122274001 14:100581863-100581885 CCAGGCCACAGGATGTTGGGAGG + Intronic
1124158368 15:27248265-27248287 CCAGGGCACCTGCTCCTAGGAGG - Intronic
1125947534 15:43722050-43722072 CCAGGTCTCTTGCAGTTAGCTGG + Intergenic
1131444523 15:92486255-92486277 CCAACCCACTTCCAGTTAGGTGG + Intronic
1133476887 16:6132262-6132284 CCAGCCCCCTGGCAGTTAGGTGG + Intronic
1134243517 16:12523136-12523158 CCAGGGCACGTGATGCTAGGTGG + Intronic
1134862272 16:17571128-17571150 CCAGGGCACAGGCTGTGAGGAGG - Intergenic
1137701268 16:50499672-50499694 CCAGTACCCTTGCTGTGAGGTGG - Intergenic
1138424113 16:56919127-56919149 CCAGCACCCTTGCAGTTAGGTGG - Intergenic
1140219249 16:73031930-73031952 CCAGGCCACTTACTCTTATAAGG - Intronic
1140903972 16:79394876-79394898 CCAGAACATCTGCTGTTAGGAGG + Intergenic
1141482003 16:84313050-84313072 CCAGGCCGCGCGCTGTCAGGCGG + Exonic
1141912719 16:87070936-87070958 CCAGGCCAGTTGCAGCTTGGGGG + Intergenic
1150247768 17:63689150-63689172 CCAGGCCACCTGCTGCTGTGGGG - Intronic
1151872288 17:76844545-76844567 CCGGGAGATTTGCTGTTAGGAGG + Intergenic
1152984095 18:306415-306437 CCAGACCACCTGCTATTAGAAGG + Intergenic
1153143269 18:1999712-1999734 CCAGCCCCCTTGTAGTTAGGTGG - Intergenic
1157577711 18:48754748-48754770 CCAGGCCACTTGGCATTAGTGGG - Intronic
1158316429 18:56215741-56215763 CAAGGCCCCTTGAAGTTAGGAGG + Intergenic
1159903821 18:74072547-74072569 CCTGGCCACTTTCTCTTTGGAGG - Intergenic
1160874753 19:1291799-1291821 CCAGGCCGCTTGCTGGAAGCTGG + Intronic
1162380827 19:10330746-10330768 CCAGGCAACATGCTCTTAGAGGG + Intronic
1162794492 19:13079489-13079511 CCAGGCCTCTTGCTGCCAGGTGG - Intronic
1162926721 19:13933894-13933916 CCAGGCCACTGTCTGTCAGCTGG + Exonic
1163752754 19:19087902-19087924 ACAGGACACCTGCTGTTAGCTGG - Intronic
925091991 2:1163501-1163523 ACATGCCACTTCCTGTTGGGAGG - Intronic
925387361 2:3471527-3471549 CCAGCCCCCTTGCTGTGTGGAGG - Intronic
927216474 2:20670370-20670392 CTGGGCCATTTGCTGTTAGGAGG + Intronic
927596867 2:24404611-24404633 CCAGCTCCCTTGCAGTTAGGAGG + Intergenic
928589863 2:32803128-32803150 CCAGGCCACTTGGTGATGGTGGG - Intronic
931173156 2:59826343-59826365 CCAGGCCACATGCTGGAAGCTGG + Intergenic
931849823 2:66241112-66241134 TCAGGCTAGTTGCTGATAGGTGG - Intergenic
932010157 2:67968461-67968483 CCCGGCCCCTTGCAGTTAGATGG - Intergenic
932294067 2:70609756-70609778 CCAAGCCATTTGCTCTTGGGTGG + Intronic
932470423 2:71951450-71951472 CCAGCCCCCTTGCAGTTAGGTGG + Intergenic
933357719 2:81233881-81233903 CCAGGCTATTTGCTGTTATTTGG - Intergenic
935529494 2:104215531-104215553 CCACGCTAACTGCTGTTAGGGGG - Intergenic
938938992 2:136152741-136152763 CCAGCCCTCTTGCAGTTAGATGG - Intergenic
940139483 2:150477603-150477625 CCAGCCCACTTGATTTTAGTAGG - Intronic
940992199 2:160109161-160109183 CCAGGCATCATGCTGTTAGTGGG - Intronic
945536717 2:211026494-211026516 CCAGGAAACTTCGTGTTAGGTGG + Intergenic
945743936 2:213697774-213697796 TCAGGCCATTTCCTGTTAGCAGG + Intronic
946335176 2:219031148-219031170 GCAGGCCACGTGCTGGTACGGGG - Exonic
948663300 2:239519869-239519891 CCAGGCCCATTGCGGTGAGGAGG + Intergenic
1173699106 20:45051388-45051410 CCAGGCCTCTTGTTGCTAGGGGG + Intronic
1174087064 20:48016807-48016829 TCAGCCCACTTCCTGTTGGGGGG - Intergenic
1174205999 20:48839662-48839684 CCAGGCCTCTTGCAGGTGGGTGG + Intergenic
1175167588 20:57055910-57055932 GAAGGCCACCTGCTGTTAGTTGG - Intergenic
1175912862 20:62413032-62413054 CCAGGGCACTGGCTGACAGGAGG + Intronic
1178411327 21:32365926-32365948 TCAGGCAACTTGGGGTTAGGAGG + Intronic
1181171993 22:21015092-21015114 CCAGGCCAGTTGCTGTTAAAGGG - Exonic
1183115212 22:35686556-35686578 CCAGACCCCTTGCTGTGAGCTGG + Intergenic
1184396275 22:44243541-44243563 CCAGCCAACGTGGTGTTAGGGGG - Intergenic
1184409412 22:44317980-44318002 TCAGGCCCCTTGGTGTCAGGAGG - Intergenic
949832450 3:8230096-8230118 CTAGGCCACTTGCTGTAACTGGG + Intergenic
951886794 3:27532456-27532478 CCAGGCCACTTGCCTTAAAGTGG + Intergenic
953217753 3:40937145-40937167 CCAGGCCTCTTCCTGTGAAGAGG + Intergenic
954112797 3:48444836-48444858 CCAGCCCACTTGCTGGTGGATGG + Intergenic
954265224 3:49466320-49466342 ATCTGCCACTTGCTGTTAGGTGG + Intergenic
955418177 3:58712140-58712162 CCAGGCCACATGCTTTATGGTGG - Intergenic
957776188 3:84759455-84759477 CTAGACCACTTGCTGTTGGCAGG + Intergenic
959089441 3:101886618-101886640 CCTGGTAACTTGCTGTTAGTGGG - Intergenic
969054836 4:4395159-4395181 CCTGCCCACTTGCTGTGGGGTGG + Intronic
973289942 4:48461149-48461171 CCAGGCCTCTTGCACCTAGGTGG + Intergenic
981828078 4:148967861-148967883 CCAGTCCACTTGCTGTAGTGGGG - Intergenic
982219687 4:153113913-153113935 CCAGGCCACTTGGTGCTCTGTGG + Intergenic
986992993 5:13575604-13575626 CCAGTCCCCTTGCGGTTAGCAGG + Intergenic
988651799 5:33160506-33160528 CCAGTGCCATTGCTGTTAGGTGG + Intergenic
991420878 5:66440360-66440382 AAAGGCCAGTTGCTGTCAGGAGG + Intergenic
992399929 5:76403086-76403108 CCAGGCCACCAGCTGTGCGGGGG + Intergenic
1001180110 5:169512569-169512591 ACAGGCCACTTGCCGGCAGGTGG - Intergenic
1003298075 6:4851989-4852011 CCAGGCCAGTTGCTTCTTGGTGG + Intronic
1006502399 6:34466865-34466887 CCAGGCCACTTGCTGCCTGTTGG + Intronic
1007098194 6:39227436-39227458 CCAGGACTCTTGCTGTTAGGAGG + Intronic
1008951730 6:57168482-57168504 CAAGGCCACTTGATGTTGTGTGG - Exonic
1013592354 6:111629960-111629982 CCAGACTTCTTGCTGCTAGGTGG + Intergenic
1015717317 6:136205896-136205918 CCAGGCAGCTTGCTGTTACAGGG + Intergenic
1019477160 7:1249575-1249597 CCAGGCCAATGGCTGGTGGGGGG - Intergenic
1020469619 7:8521373-8521395 CCAGCCCCCTTGCTGTTAGGTGG + Intronic
1024561693 7:50650080-50650102 CCAGGCTGCTTGGTGTTTGGAGG - Intronic
1028168292 7:87564520-87564542 CCAGGTCACTTGCTGTGATTGGG + Intronic
1029188602 7:98756258-98756280 CCAGTCCCTGTGCTGTTAGGTGG - Intergenic
1029617261 7:101666738-101666760 CCTGGAGACTTTCTGTTAGGGGG - Intergenic
1029851332 7:103464651-103464673 CCATGCCACTTGCACTTACGGGG - Intergenic
1035348633 7:158226917-158226939 CCAGGCGACAGGCTGTTTGGAGG + Intronic
1036545998 8:9770578-9770600 CCAGGGCAGCTGCTGTTAGTGGG + Intronic
1037845527 8:22278645-22278667 CCAGGCCACAGGCTGGTTGGGGG + Intronic
1038119838 8:24600824-24600846 CTAGGCCACTTTCAGCTAGGTGG + Intergenic
1046788136 8:118290414-118290436 CCAGCCCACTTACTGTATGGTGG - Intronic
1047485943 8:125330788-125330810 CCAGGCCACGTGCTTGTGGGAGG - Intronic
1047899606 8:129405798-129405820 CCAAGTCTCTTGCTTTTAGGTGG - Intergenic
1049241611 8:141540259-141540281 CCAGGCCACAGGGTGTTAGTGGG - Intergenic
1052998492 9:34564509-34564531 CAAGTCCCCTTCCTGTTAGGGGG - Intronic
1056240586 9:84642551-84642573 CCAGTCCACCTGCTTCTAGGTGG + Intergenic
1056462609 9:86822919-86822941 CCTGTCCACTTGCAGATAGGTGG + Intergenic
1056972085 9:91213584-91213606 CCACACCACTTGCTGGGAGGAGG + Intergenic
1057034750 9:91803766-91803788 CAAGGCCACATGCTGTCATGAGG - Intronic
1059413135 9:114146346-114146368 CCAGACCCCTTGCTATGAGGTGG - Intergenic
1060596769 9:124853340-124853362 CCAGACCGCTTGCAGTTCGGCGG - Intergenic
1060918168 9:127403440-127403462 CCAGGGCACTTCCTGATAGGTGG - Intronic
1061320837 9:129828225-129828247 GCAGGACGCTTGCGGTTAGGAGG + Exonic
1062426790 9:136509869-136509891 CCGGGGCACTTTCTGTGAGGAGG - Exonic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1191697303 X:64003420-64003442 CAAAGCCACTTTCTTTTAGGGGG - Intergenic
1195762731 X:108264302-108264324 CCTGTACACTTGGTGTTAGGAGG - Intronic