ID: 1091767021

View in Genome Browser
Species Human (GRCh38)
Location 12:3128021-3128043
Sequence CTACCGCCCAGTGACATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091767021_1091767025 8 Left 1091767021 12:3128021-3128043 CCTATGATGTCACTGGGCGGTAG 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1091767025 12:3128052-3128074 CAGCTCCGTTGTAATCTTAGGGG 0: 1
1: 4
2: 47
3: 445
4: 747
1091767021_1091767024 7 Left 1091767021 12:3128021-3128043 CCTATGATGTCACTGGGCGGTAG 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1091767024 12:3128051-3128073 TCAGCTCCGTTGTAATCTTAGGG 0: 1
1: 34
2: 385
3: 705
4: 721
1091767021_1091767027 27 Left 1091767021 12:3128021-3128043 CCTATGATGTCACTGGGCGGTAG 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1091767027 12:3128071-3128093 GGGGACCACTGTCGTATGTGTGG 0: 1
1: 2
2: 19
3: 151
4: 402
1091767021_1091767023 6 Left 1091767021 12:3128021-3128043 CCTATGATGTCACTGGGCGGTAG 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1091767023 12:3128050-3128072 TTCAGCTCCGTTGTAATCTTAGG 0: 1
1: 5
2: 20
3: 61
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091767021 Original CRISPR CTACCGCCCAGTGACATCAT AGG (reversed) Intronic