ID: 1091767428

View in Genome Browser
Species Human (GRCh38)
Location 12:3130688-3130710
Sequence CTGACTCTGCACATCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091767428_1091767432 24 Left 1091767428 12:3130688-3130710 CCCACAGAGATGTGCAGAGTCAG 0: 1
1: 1
2: 2
3: 16
4: 242
Right 1091767432 12:3130735-3130757 AGCAGAGTGTCTGGCACACACGG 0: 1
1: 0
2: 18
3: 77
4: 470
1091767428_1091767431 15 Left 1091767428 12:3130688-3130710 CCCACAGAGATGTGCAGAGTCAG 0: 1
1: 1
2: 2
3: 16
4: 242
Right 1091767431 12:3130726-3130748 AAAACGCTTAGCAGAGTGTCTGG 0: 1
1: 0
2: 27
3: 229
4: 1218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091767428 Original CRISPR CTGACTCTGCACATCTCTGT GGG (reversed) Intronic
900307560 1:2018760-2018782 CTGACTCTCCACACCTCTCATGG - Intergenic
900333089 1:2146288-2146310 CTCACCCTGCTCATCTCTGCCGG - Intronic
900714982 1:4138390-4138412 CTGACTCTGGACAGCGATGTCGG + Intergenic
903633191 1:24792899-24792921 CTGGCTCTGCAGACCACTGTAGG + Intronic
904309072 1:29613875-29613897 CAGCCTCTGCCCATCTCTCTGGG - Intergenic
904949260 1:34223082-34223104 CTGACTCTGCTCACCTCTCAGGG + Intergenic
905363775 1:37437718-37437740 CTGACTTTGTACATGTCTTTGGG + Intergenic
906129790 1:43449276-43449298 CTGGCTGGGCCCATCTCTGTGGG - Intronic
906546832 1:46625752-46625774 TTGACTCTTCACATCTATGATGG + Intergenic
911816940 1:102365239-102365261 CTGACTCCTCTCATCTCTCTAGG + Intergenic
912024728 1:105154822-105154844 TTGACTCTGGACATCTTTTTGGG + Intergenic
912519392 1:110234813-110234835 CTTACTCTGGGCATCTGTGTAGG + Intronic
915633309 1:157168728-157168750 CCCACCCTACACATCTCTGTAGG + Intergenic
916842962 1:168619079-168619101 CTGAGTCTGCACATCATCGTTGG + Intergenic
918480569 1:184973634-184973656 CTGAGTCCCCACATCTCTGAGGG + Intronic
918825328 1:189316575-189316597 CTGACTCTGCCCAGGTCTCTTGG - Intergenic
919543352 1:198879304-198879326 CTAACTCTTCAGATTTCTGTGGG + Intergenic
920448254 1:206036778-206036800 CTGACCCTGCACATCTTACTAGG - Intergenic
921843236 1:219851386-219851408 CTGAATCTGCAGATCGCTTTAGG - Intronic
921877668 1:220217168-220217190 ATCACCCTGCTCATCTCTGTGGG + Intronic
922167652 1:223129267-223129289 CGGACACTGCACATTTATGTGGG - Intronic
924803357 1:247343964-247343986 CTGGCTGTGAACACCTCTGTAGG - Intergenic
1062836691 10:640465-640487 CGGACTCTGCTCCCCTCTGTTGG + Intronic
1062861923 10:816913-816935 CTGACTCTGCAGACCTGGGTGGG + Intronic
1063835280 10:10005191-10005213 CTGACCCTGCCCTTCCCTGTTGG + Intergenic
1064033810 10:11899748-11899770 CTGAGTCTTCACCTCCCTGTTGG - Intergenic
1066030218 10:31413891-31413913 CTGACCCTAAACAGCTCTGTTGG + Intronic
1066107376 10:32167650-32167672 CTGGCTCTGCTGATCTCTGCTGG - Intergenic
1067999283 10:51312593-51312615 CTGGTTCTGCACATGTCTGAAGG + Intronic
1069253578 10:66303472-66303494 CTGGCTCTGCACATCATTATGGG + Intronic
1069908026 10:71743505-71743527 CTGACTCTGGGCACCCCTGTGGG + Intronic
1074122142 10:110500777-110500799 CTGTCTCTCCACACCTCTGATGG + Intronic
1074213736 10:111363625-111363647 TTGAATCTGTACATCTCTCTGGG + Intergenic
1074626806 10:115199070-115199092 CTGAATCTGTAGATCACTGTGGG + Intronic
1076438360 10:130462045-130462067 CTGAATCTGTAAATATCTGTAGG + Intergenic
1078536507 11:12179267-12179289 CTGCCTCTGCCCAGCACTGTAGG + Intronic
1078700492 11:13676746-13676768 CAGTCTGTGCACAGCTCTGTGGG - Intronic
1079967373 11:26995049-26995071 GAGACACTGGACATCTCTGTGGG + Exonic
1080182831 11:29444999-29445021 CTGAATATGCATATCACTGTTGG + Intergenic
1080279173 11:30536646-30536668 CTATCTCTCCACATCTCAGTTGG - Intronic
1083979193 11:66151761-66151783 CTGACTCTGAGCATCTAAGTGGG + Intronic
1084658726 11:70534902-70534924 TTGACTATCCTCATCTCTGTTGG - Intronic
1084765846 11:71307902-71307924 CTGTCTCTGCACATGTCTGCAGG + Intergenic
1084823001 11:71706818-71706840 TTGACTCTGCCCATTTCTCTAGG + Intergenic
1084965724 11:72743555-72743577 CTCACTCTGCCCATCTCTCCAGG - Intronic
1086170065 11:83826025-83826047 CAGACTCTGCAAAATTCTGTGGG + Intronic
1086336919 11:85810096-85810118 CTTCCTCTGCACATCCCTGCCGG + Intronic
1087043618 11:93825522-93825544 TTGACTCTGCAGATCGCTTTGGG + Intronic
1087667004 11:101061792-101061814 CTCCCTCAGCACAGCTCTGTAGG - Intronic
1088594295 11:111428436-111428458 GAGGCTCTGCACAACTCTGTAGG - Intronic
1090032548 11:123219599-123219621 CTGACTCACCACAGCTCTGCAGG + Intergenic
1090591693 11:128277842-128277864 CTGATTCTCCACCTCTCTGGTGG - Intergenic
1091767428 12:3130688-3130710 CTGACTCTGCACATCTCTGTGGG - Intronic
1091844494 12:3645431-3645453 CTGTCTCTTCACAGCCCTGTGGG + Intronic
1091846039 12:3657012-3657034 CTGCTTCAGCACCTCTCTGTGGG - Intronic
1094523965 12:31219650-31219672 CTGACTTTCCACATGCCTGTGGG - Intergenic
1097047426 12:56197621-56197643 CTGACTAAACACATCTATGTGGG + Intergenic
1099964113 12:89426973-89426995 CTGAATCTGCATATCAATGTGGG - Intronic
1100158025 12:91824515-91824537 CTGAGTCTGCACAGATGTGTAGG + Intergenic
1102155045 12:110718572-110718594 GTGTCTTTGCACATCTCGGTTGG - Intergenic
1104717802 12:131027970-131027992 CTGACTGTGCCCTTCTTTGTGGG + Intronic
1104972332 12:132537586-132537608 CTAATTCTGCACATGTCTGATGG + Intronic
1105089295 13:16257916-16257938 TTGAAACTGCTCATCTCTGTGGG - Intergenic
1105739091 13:23303450-23303472 CTGATTCTGAACATGCCTGTGGG - Intronic
1106070253 13:26404127-26404149 CTGACTGTGCAGCTCTCTGCGGG + Exonic
1106698756 13:32206520-32206542 CTGACTCTGCACCCCACTGGAGG - Intronic
1107055882 13:36102991-36103013 ATGAGTCTGCACATTTATGTGGG - Intronic
1108368490 13:49742673-49742695 CTGAATCTGTACATCACTTTGGG + Intronic
1109477976 13:62909857-62909879 CTGACTCTGCAAATTGCTTTGGG - Intergenic
1109985800 13:69983270-69983292 TTGAATCTGCAGATCACTGTAGG - Intronic
1110724716 13:78807104-78807126 TTGAATCTGTAGATCTCTGTGGG + Intergenic
1114935103 14:27525438-27525460 CTGACTTTGCAGATCACTTTGGG + Intergenic
1118488140 14:66233489-66233511 GTGACTCTGTAAATCTCTCTTGG - Intergenic
1118650326 14:67884705-67884727 CTCACTCTTCACACCTCTTTTGG + Intronic
1120626761 14:86837029-86837051 CTGCTTCTGCAGATCTCTCTTGG + Intergenic
1120972835 14:90222781-90222803 CTGAATCTGCATATCACTTTAGG - Intergenic
1123130939 14:105984794-105984816 CAGGCCATGCACATCTCTGTGGG - Intergenic
1123581167 15:21716015-21716037 CAGGCCATGCACATCTCTGTGGG - Intergenic
1123617816 15:22158638-22158660 CAGGCCATGCACATCTCTGTGGG - Intergenic
1123635041 15:22297017-22297039 CTGAATCTGCAGATATCTTTAGG - Intergenic
1125074766 15:35601394-35601416 CTGAATCTGCACATCACTTTAGG - Intergenic
1126564781 15:50083936-50083958 CTTGCTGTGCACATATCTGTGGG - Intronic
1126661895 15:51040525-51040547 CTGAATCTGTAGATCACTGTGGG + Intergenic
1127131757 15:55872783-55872805 CGGACTATGCACATGTCTGCAGG + Intronic
1129051574 15:72785656-72785678 CTGACTCTTCAGTTCTCAGTTGG - Intronic
1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG + Intergenic
1129516299 15:76159648-76159670 CTGACTGTGCACAGCACTTTGGG + Intronic
1130991118 15:88876723-88876745 CTGACTCAGCAGGTCTCTGCTGG + Intergenic
1132862947 16:2080421-2080443 CTGAGTGTCCACAGCTCTGTGGG - Intronic
1136057869 16:27703937-27703959 GTGACTCTGCCCATCTCGGCAGG + Exonic
1140315221 16:73889789-73889811 CTGACTCTTCTCCTTTCTGTAGG + Intergenic
1140997436 16:80274843-80274865 CTGCCTCTGTACATCTCTCTGGG - Intergenic
1141108802 16:81255159-81255181 ATCAAGCTGCACATCTCTGTAGG + Intronic
1141415824 16:83872728-83872750 CTGAATCTGTAGATCTCTTTGGG + Intergenic
1141898513 16:86974352-86974374 CTGACTCTTCAGCTCTGTGTGGG - Intergenic
1142861495 17:2764905-2764927 CAGACTCTTGCCATCTCTGTGGG - Intergenic
1144148633 17:12421940-12421962 CTTTCTCTGCAGCTCTCTGTGGG - Intergenic
1144165413 17:12605322-12605344 CTGAATTTGCACAACTCTGGGGG + Intergenic
1148038370 17:44686235-44686257 CTGACTCTCCACTTTTCTTTGGG - Intronic
1148358500 17:46993029-46993051 CTGACAGTGGCCATCTCTGTAGG + Intronic
1149395345 17:56235921-56235943 CTGAATCTGCAAATCACTTTAGG + Intronic
1150580843 17:66472579-66472601 CTGACTCTTCACTTCTATTTTGG - Intronic
1151815523 17:76469671-76469693 CTGACGCTGCACAGGTCTGGGGG + Exonic
1151874061 17:76856580-76856602 CTGACACTGAACATCACCGTAGG - Intergenic
1152062334 17:78086961-78086983 CTGTCTCTGCACCCCTCTGCAGG + Exonic
1152268215 17:79308534-79308556 CTCACTCTGCCGATCTGTGTTGG + Intronic
1152621183 17:81365655-81365677 GTGACTCCACACATCTCTCTGGG - Intergenic
1155353318 18:24927701-24927723 CTGACTCCTCACATCTTCGTGGG + Intergenic
1155662782 18:28271266-28271288 TTGACTCTGTAGATCTCTTTGGG + Intergenic
1158758460 18:60355275-60355297 CTGACTCACTACATCTGTGTGGG - Intergenic
1159019323 18:63130316-63130338 ATGACCCTGGACATCGCTGTTGG + Intronic
1160844343 19:1159897-1159919 CTGCCACTGCCCAGCTCTGTGGG - Intronic
1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG + Intronic
1164961675 19:32436424-32436446 CTGACTTTTCACATATCTATAGG + Exonic
1165523138 19:36330168-36330190 TTGACTCTGCCCATTTCTCTAGG - Intergenic
1165827740 19:38714801-38714823 CTGTCCCTGAGCATCTCTGTAGG - Intronic
1168495867 19:56849837-56849859 CTGAATCTACACATCACTTTGGG + Intergenic
925357952 2:3255674-3255696 CTGTCTCTGCACATCCCAGCAGG + Intronic
925776855 2:7344232-7344254 CTGATTCTCCTCATCTCTCTGGG - Intergenic
925777607 2:7350035-7350057 CTGATTCTCCTCATCTCTCTGGG + Intergenic
926006545 2:9377489-9377511 CTGCCTGTGCACATCTCTAAAGG - Intronic
926479387 2:13371325-13371347 CTGAATCTGCAGATATCTTTAGG - Intergenic
928447873 2:31349079-31349101 CTGACTGTTCTCATCTTTGTGGG - Intronic
932362483 2:71120628-71120650 CTGACTTAGCATATATCTGTTGG - Intronic
933071814 2:77868258-77868280 CTGACTATTCTCATCTCTGGTGG + Intergenic
936486905 2:112933500-112933522 CTGACTGTGCAGCTCTCCGTGGG + Intergenic
937099277 2:119256274-119256296 CTGGCTCTGCTCATCTCAGAAGG + Intronic
937327476 2:120999862-120999884 CGGGCTCTGCCCATCTTTGTGGG + Intergenic
938572512 2:132573134-132573156 CTGCCTCTGAGCATCTCTGAAGG - Intronic
938700806 2:133877653-133877675 ATGACTCTGCTCATTTCTGTGGG + Intergenic
938986202 2:136578994-136579016 CTGCCTCTTCACATCTGTCTTGG + Intergenic
939952994 2:148497935-148497957 ATAATTCTGCACATCTTTGTGGG - Intronic
939996281 2:148923278-148923300 CTGACCCTGGACACCTGTGTGGG + Intronic
940133306 2:150408470-150408492 CTGACTCTGCAAGGCTCTGCTGG + Intergenic
940571316 2:155438380-155438402 CTGAATCTGCAGATTTCTTTGGG + Intergenic
942115232 2:172722131-172722153 CTGACTTCCCACATCACTGTGGG - Intergenic
942812347 2:180014058-180014080 CTTACTCTGGACCTCTCTGTTGG - Intergenic
946308344 2:218868901-218868923 CTGACCCTGCACAGCCATGTTGG + Intronic
946643259 2:221806826-221806848 CTGACTCTGCACCTCTCTGGTGG + Intergenic
1170173874 20:13445567-13445589 CTGAGTCTTCAGTTCTCTGTAGG - Intronic
1171288842 20:23968011-23968033 CTGACTTTCCACATCACTGCAGG - Intergenic
1172025635 20:31946391-31946413 CGGACACTGCCCATCTCTGAGGG + Intronic
1172216054 20:33236609-33236631 CTGGCTCTGGACAACTCTGCTGG + Intronic
1173670176 20:44793465-44793487 CTCACTCTGCACATCTGTGCCGG + Intronic
1174568717 20:51485743-51485765 CTGACCCTGCACACCTCACTAGG + Intronic
1175142454 20:56871072-56871094 CTGTATCTACAGATCTCTGTGGG + Intergenic
1177513479 21:22120154-22120176 TTTAATCTGCATATCTCTGTAGG - Intergenic
1177606402 21:23384317-23384339 TTGACTCTGCAGATCACTGTGGG + Intergenic
1178456671 21:32760700-32760722 CTGACTCTGTAGGTCTCTGGGGG + Intronic
1180597001 22:16983380-16983402 TTGACTCTGCAGATTTCTTTAGG - Intronic
1181053273 22:20247548-20247570 CTGCCCCTGCACGTGTCTGTGGG - Intronic
1182651627 22:31856124-31856146 CCAACTCAGCACATCTCTGAGGG - Intronic
1182775734 22:32829737-32829759 CTCACTCTGCACATCAGTGCTGG + Intronic
1185092757 22:48785200-48785222 CTGAGTCTGCACAGCCCTGGAGG - Intronic
1185195948 22:49469739-49469761 CTGATTCTCCACATCTCTGGGGG - Intronic
950900193 3:16490540-16490562 CTGATTCTGCACAACTCTTTAGG - Intronic
951842675 3:27050967-27050989 CTCATTCTGCAGCTCTCTGTGGG + Intergenic
952844310 3:37674291-37674313 CAGCCTCTGCTCACCTCTGTGGG - Intronic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
955096288 3:55801392-55801414 CTGACTTTTCACATCCCTCTTGG - Intronic
957041481 3:75338909-75338931 CTGTCTCTGCAGCTCTCTCTCGG - Intergenic
957997685 3:87711135-87711157 CTGAATCTTCACATGTCTTTGGG - Intergenic
961046194 3:123709731-123709753 CTGTCTCTGCAGCTCTCTCTTGG - Intronic
961181770 3:124883523-124883545 CTGGGTCTGCAGCTCTCTGTAGG - Intronic
961289306 3:125832768-125832790 TTGACTCTGCCCATTTCTCTAGG + Intergenic
962380228 3:134892702-134892724 CTGACTCTAGACATCTCTGTAGG + Intronic
962655277 3:137537684-137537706 TTGAATCTGCACATTTCTTTGGG + Intergenic
963717235 3:148817522-148817544 CATAGTCTGCACATCTCTGGTGG - Intronic
964608821 3:158588247-158588269 CTGACTCAGGGCCTCTCTGTAGG - Intronic
965137704 3:164794287-164794309 CTGACTCTGCAGATGTCATTTGG + Intergenic
965205224 3:165713334-165713356 CTGACTCAGCACAGGCCTGTAGG - Intergenic
965995718 3:174880276-174880298 CTGGCATTGCACATCTCAGTTGG + Intronic
966944080 3:184765324-184765346 CTGACTCAACACTGCTCTGTTGG - Intergenic
966983372 3:185157836-185157858 CTGGCTCAGCAGATCTCTGTTGG - Intergenic
967666140 3:192174426-192174448 CTGACTCTGCATAGCCCTGTTGG - Intronic
973151504 4:46894087-46894109 TTGACTCTGTACATTTCTTTGGG - Intronic
976531929 4:86165265-86165287 CTGACTTTGCACAACAATGTTGG - Intronic
977299313 4:95249837-95249859 TTCACTCTGCACACCTCTGATGG + Intronic
980106434 4:128592848-128592870 CTGACTCAGTAGATCTCAGTAGG - Intergenic
983190398 4:164748059-164748081 CTGGCTATAGACATCTCTGTTGG - Intergenic
984318812 4:178164423-178164445 CTGACTCAGCACACTTCTGTGGG + Intergenic
986000477 5:3627204-3627226 CTTACTCTGCATATGTCTGTAGG - Intergenic
986826518 5:11528561-11528583 CAGACTCTGCACCTCCCTTTTGG - Intronic
987061327 5:14246795-14246817 CTGTCTCTGCACCTGTCTCTCGG + Intronic
987149697 5:15026349-15026371 CAGACTCTGCAGTACTCTGTCGG + Intergenic
991511104 5:67376981-67377003 CTGGGTCTGCACATGTCTGCAGG - Intergenic
993465777 5:88244709-88244731 CTGAATCTGCACATTGCTTTGGG + Intronic
995075778 5:107981341-107981363 CTGTTTCTGCACATCTGTGCTGG + Intronic
997017268 5:129950826-129950848 CTGAATCTGCAGATCGCTTTGGG - Intronic
997230177 5:132236764-132236786 ATGACTATGCACATCTATGATGG - Intronic
998975483 5:147641614-147641636 CTGATTCATCACATCTTTGTAGG + Intronic
999303368 5:150504587-150504609 CTCATGCTGCACAGCTCTGTCGG - Intronic
999709442 5:154303405-154303427 AGGACTCTGTAGATCTCTGTAGG - Intronic
1000403780 5:160863963-160863985 CTGATTCTGCACTTTTTTGTTGG - Intergenic
1000879379 5:166679848-166679870 CTGGTTCTGCACATCTCTTGGGG + Intergenic
1000978990 5:167796398-167796420 CTGTTTCTGCAAATCGCTGTGGG + Intronic
1001321878 5:170689132-170689154 CTAAATTTCCACATCTCTGTTGG - Intronic
1001810921 5:174627685-174627707 CTGACTCTTCACACCTTTCTGGG + Intergenic
1002437341 5:179239701-179239723 CTCCCTCTGCACCCCTCTGTGGG - Intronic
1004465370 6:15880425-15880447 GCGACTCTGCACACCACTGTAGG + Intergenic
1004764371 6:18709071-18709093 CTGACTATAAACATCTCTGGTGG - Intergenic
1006028079 6:31159850-31159872 CTGACTGTGCACACTTCTGGTGG - Intronic
1008899353 6:56593705-56593727 CTTGCGCTGCACTTCTCTGTGGG + Exonic
1011072104 6:83396545-83396567 CTGAATCTGTAGATCTCTTTGGG - Intronic
1013537112 6:111073117-111073139 CTGACTTTGGACAGCTCTGATGG + Intergenic
1013972447 6:116038013-116038035 CTAACTGTGCACATCTTTGCTGG - Intronic
1015462208 6:133504376-133504398 CTGACTCTTCACATATCTGATGG - Intronic
1015567797 6:134591375-134591397 CTGACCCTTCACAAGTCTGTTGG - Intergenic
1017354537 6:153487692-153487714 CTTTCTCTGCATATCTCTTTAGG - Intergenic
1018126529 6:160688440-160688462 CTGGCTCTGCCAATTTCTGTTGG + Intergenic
1019396236 7:820140-820162 TTGAATCTGTACATCACTGTGGG + Intronic
1020099060 7:5384434-5384456 CTGAAGCTGCTCTTCTCTGTTGG - Intronic
1024454028 7:49582310-49582332 CTAACTCTGGTCATCTATGTTGG + Intergenic
1024890816 7:54200735-54200757 CTGACTCAACACATCTGTATTGG - Intergenic
1025873120 7:65453568-65453590 CTGGCTCTGCTCATGGCTGTGGG + Intergenic
1026565546 7:71487058-71487080 CTGATTCAGGACATCTCTGCAGG + Intronic
1027507502 7:79036039-79036061 CTGACTCCTCACATTTCTGATGG - Intronic
1028018087 7:85739854-85739876 CTGACTTTGGAGATCTCTATAGG + Intergenic
1028313221 7:89365372-89365394 CTGATTCTGCTCTTCTCTTTTGG + Intergenic
1028947777 7:96600572-96600594 CTGCCTCTGCCCATCACCGTGGG - Intronic
1031989836 7:128190273-128190295 CTGACTCTGGAGAGCTCTGCAGG - Intergenic
1033130769 7:138743748-138743770 CTGTCTCTGCCCATCTCCTTTGG - Intronic
1033766040 7:144491555-144491577 CTGACGAGGCACATCTCTGCTGG + Intronic
1034329945 7:150273790-150273812 CAGACTCTGAGCATCTCTGAGGG + Intronic
1034524358 7:151647538-151647560 CTGCCTCTGCACATCTCTGTAGG - Intronic
1034663959 7:152799059-152799081 CTGACTCTGTACCTCACTTTGGG + Intronic
1034668113 7:152836070-152836092 CAGACTCTGAGCATCTCTGAGGG - Intronic
1035028856 7:155844468-155844490 CTGACTCTGAGAATCTCTGGAGG + Intergenic
1035067497 7:156118496-156118518 CTGTCTCTGCAAATCTGTTTTGG - Intergenic
1035627783 8:1085835-1085857 CTGAATCTGCACATCCCTTTGGG + Intergenic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1036410671 8:8497439-8497461 CTGACTCTGAACCCTTCTGTAGG + Intergenic
1036735932 8:11316687-11316709 CTGACTGTGCACAGCGCTGCTGG - Exonic
1037327242 8:17704831-17704853 CTGAATCTGTAGATCTCTTTGGG + Intronic
1038450228 8:27634659-27634681 CTGACACTGCAGGTCTCTTTTGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040684496 8:49855946-49855968 CAGCTTCTCCACATCTCTGTTGG - Intergenic
1041380009 8:57244751-57244773 ATGACCCTGCTCATCACTGTAGG + Intergenic
1043125359 8:76387768-76387790 CTCACTTTGAACATCTCTGAGGG + Intergenic
1043299209 8:78705737-78705759 GGGACTTTGCAAATCTCTGTAGG + Intronic
1043942288 8:86209662-86209684 CTGATTTTGCTTATCTCTGTAGG - Intergenic
1049112575 8:140657033-140657055 CTGCCTCTGCTCAACTCTGGTGG + Intergenic
1049163365 8:141111690-141111712 CTGTTTCTGCACCTGTCTGTTGG + Intergenic
1050224340 9:3434055-3434077 CTGATTCTGTACATCTGGGTGGG + Intronic
1051501202 9:17779544-17779566 CTTAATCTTCACAACTCTGTGGG - Intronic
1051947909 9:22594352-22594374 CTGATTCTGCACATATGTGCAGG + Intergenic
1055664640 9:78541133-78541155 CTGATTCTGCACATCTGGGGTGG + Intergenic
1057131648 9:92658097-92658119 CTTTCTGTGCAAATCTCTGTTGG - Intronic
1057224654 9:93285641-93285663 CTGAATCTGCAGATCTGTTTGGG - Intronic
1059243751 9:112831776-112831798 CTTTCTCTGCACTTCCCTGTTGG + Intronic
1061018738 9:127999795-127999817 CTGAATCTGTACATCACTTTGGG + Intergenic
1062088598 9:134662011-134662033 CTGACTCTGTGCCTGTCTGTTGG + Intronic
1062210044 9:135358676-135358698 CTGTCTCTTCCTATCTCTGTTGG - Intergenic
1062384703 9:136304568-136304590 CGGACCCTGCACATCCCAGTGGG + Intronic
1186872542 X:13786596-13786618 CTGACTCTGAACGTGTGTGTCGG - Intronic
1187891448 X:23938975-23938997 TTGATTCAGCACATCTCTGATGG + Intronic
1189181353 X:39007639-39007661 CTGGTTCTGAACATCTATGTTGG + Intergenic
1193635264 X:83943036-83943058 CTGGTTCTTCACATCTTTGTGGG + Intergenic
1199232733 X:145457053-145457075 CTGAATCTGAACATCACTTTGGG + Intergenic
1199516679 X:148685068-148685090 CTGACTATAGACATTTCTGTAGG + Intronic
1200595365 Y:5133924-5133946 CTGAATCTGTAGATTTCTGTGGG + Intronic
1202081053 Y:21084718-21084740 GTGACTCTTCACATCTTTCTAGG + Intergenic