ID: 1091767597

View in Genome Browser
Species Human (GRCh38)
Location 12:3131917-3131939
Sequence GGCCTGGGGGGTCACAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091767597_1091767608 17 Left 1091767597 12:3131917-3131939 CCTTACCTGTGACCCCCCAGGCC 0: 1
1: 0
2: 0
3: 31
4: 234
Right 1091767608 12:3131957-3131979 ACTGATCTGCTTTCTATCTGTGG 0: 1
1: 0
2: 3
3: 46
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091767597 Original CRISPR GGCCTGGGGGGTCACAGGTA AGG (reversed) Intronic
900227836 1:1541022-1541044 GGCCGTGGGGGCCACAGGTCAGG + Intergenic
900400774 1:2472048-2472070 GGCCTGAGGGGTCCCAGCAAGGG - Intronic
900947666 1:5840489-5840511 GGCCTGTTGGGTCTCAGGCACGG + Intergenic
901068849 1:6507480-6507502 AGGCTGGGGGGGCACAGGTGGGG - Intronic
901274283 1:7978767-7978789 AGCCTGGGAGGTCAAAGCTATGG + Intronic
901777512 1:11570510-11570532 AACCTGAGGGGCCACAGGTAGGG + Intergenic
902392072 1:16112663-16112685 GACTTGGGGGGTCAGAGGGAAGG + Intergenic
902549257 1:17209584-17209606 GGCCTGGGGGGCCAGAGGGAGGG - Intronic
902662471 1:17914700-17914722 GTCCTGGGGGGTGTCAGTTATGG + Intergenic
903124698 1:21239668-21239690 GGGCTGGGGGCTGACAGGAAAGG + Intronic
903217111 1:21849328-21849350 GGCCTTGGGGGTCAGAGTGAGGG - Intronic
903355834 1:22746858-22746880 CCCCCGGGGGGTCACAGGTCAGG - Intronic
903458571 1:23505173-23505195 GGCCAGGGAGGCCACAGGTAAGG + Intergenic
904275588 1:29382126-29382148 GGCCTGGGGGTTCAAAGGTGGGG - Intergenic
904330870 1:29757182-29757204 GGCCTTGGGGGGCACAGGCCTGG - Intergenic
904497567 1:30895749-30895771 GCCCTGGTGGGTCACAGCCAGGG + Intronic
904775075 1:32901406-32901428 GGCCCGGGGGGTGACGGGAAGGG - Intronic
906129454 1:43447469-43447491 GGTCTGGTGGGGCACAGGGATGG - Intronic
907554663 1:55333835-55333857 GGCCTGGGTGGGCACAGTGATGG + Intergenic
908127326 1:61044062-61044084 GGCCTGGTGGGTGACAGTGAGGG + Intronic
914415037 1:147471754-147471776 GGCCTTGAGGGAAACAGGTAAGG + Intergenic
915142705 1:153777042-153777064 GGCCTGTGGGGTGGCAGTTATGG - Exonic
915898517 1:159829576-159829598 GCCCTGGGAGAACACAGGTAGGG - Intronic
921163865 1:212491925-212491947 GGGCTCATGGGTCACAGGTAAGG + Intergenic
924948042 1:248858912-248858934 CGCGTGGGGGCGCACAGGTAAGG - Intronic
1062833740 10:623236-623258 GGCGAGGGAGGTCACAGGAACGG + Intronic
1062877946 10:956834-956856 GGCCTGGGGGGTCAGGAGAAGGG + Intergenic
1063462758 10:6224976-6224998 GGCCTGGGGGGTGGCGGGTGGGG + Intronic
1064104581 10:12490197-12490219 GGCCTGGGAAGTCACTTGTAGGG + Intronic
1070819417 10:79346268-79346290 GGCCTGAGGGGTCAGAGAAAGGG - Intergenic
1070934725 10:80284390-80284412 GGGATGGGGGGTCACATGTGTGG - Intronic
1075584218 10:123645450-123645472 GCCCTGAGGGGTCACAGGTGAGG + Intergenic
1076775915 10:132698080-132698102 GGTCTGGGCTGTCACACGTAAGG + Intronic
1076924679 10:133476319-133476341 GGCCTGGGGTGGCTGAGGTAGGG + Intergenic
1077910107 11:6566035-6566057 GGCCTGTGGGGTCACAGAATGGG - Intronic
1078915126 11:15771615-15771637 GGCCTGGGGATTCACAGCTCAGG - Intergenic
1082964856 11:58956602-58956624 GGCCTTGGGGGTCTCTGCTATGG + Exonic
1083623769 11:64061471-64061493 GGACTGCGGGGTCAGAGGCAGGG - Intronic
1083637555 11:64128672-64128694 GGCCTGGGGGGTGTCAGGCGTGG - Intronic
1083643470 11:64158325-64158347 GGCCTGAGGGGTGACAAGGAAGG + Intronic
1084558512 11:69889539-69889561 CGCCTGGCAGGGCACAGGTAAGG + Intergenic
1084609307 11:70191941-70191963 AGCCTGGGAGGGCACAGGTGGGG + Intergenic
1085044060 11:73343261-73343283 AGCCTGGGGAGGCCCAGGTACGG + Intronic
1085405697 11:76260459-76260481 GGCCTGGGGGCTCAGTGGTGAGG - Intergenic
1085408093 11:76276000-76276022 GGCCAGGGGGGCCACAGGGGAGG + Intergenic
1085523528 11:77151623-77151645 GCCCTGTGGAGTCACAGGTTGGG - Intronic
1088945159 11:114504354-114504376 GGCTTGGGGTGGCACAGGTCTGG - Intergenic
1090741612 11:129667052-129667074 GGTCTGTGGGGCCACAGGGAAGG + Intergenic
1091439358 12:500670-500692 GGCCTGGTGGGTCCCGGGTTGGG - Intronic
1091606195 12:1953551-1953573 GGCCTGGGGTTTCACAGATTGGG + Intronic
1091767597 12:3131917-3131939 GGCCTGGGGGGTCACAGGTAAGG - Intronic
1092219084 12:6700665-6700687 GGGCTGGGGGGTCGCAGGAGCGG + Intronic
1092761861 12:11818035-11818057 GGCCTGCGGGGTGACAGGGAGGG + Intronic
1093247867 12:16762321-16762343 GGGCTGGGGGGTCTGGGGTAGGG - Intergenic
1094475377 12:30836743-30836765 TCCCTGGTGGGTCACAGGTCTGG - Intergenic
1095948347 12:47766652-47766674 GGCCTGGGGGGTCAGGGGGAGGG - Intronic
1097905149 12:64911987-64912009 GGGCTGGGGGATCACTGGCAAGG + Intergenic
1100689953 12:97029055-97029077 GGCCTGGGGGGTAGCAGTGAAGG + Intergenic
1102146637 12:110659493-110659515 GTCCTGGGAGGGCACAGGTCTGG - Intronic
1103270333 12:119668216-119668238 GGTCTGCGGGGACACAGGGAAGG - Exonic
1105572007 13:21611609-21611631 GGCCTGGCGGGTGCCAGGCATGG + Intergenic
1106438591 13:29745158-29745180 GGCTTGCGTGGTCACAGGTAAGG + Intergenic
1107929070 13:45291575-45291597 GGCTTGGGTGGTCACAGCTGGGG + Intergenic
1112709619 13:102112353-102112375 GGGCTGGGGGGTGGCAGGTGTGG - Intronic
1113695963 13:112345690-112345712 AGCCTTGGGGGTCCCAGGCAGGG - Intergenic
1113767726 13:112891442-112891464 AGCCTTTGGGGTCACAGGCACGG + Intergenic
1114680237 14:24478189-24478211 GGCCTGAGGAGTCATGGGTAGGG + Intergenic
1118818123 14:69326926-69326948 GGCCTGGGGTCTCGCAGGAAGGG - Intronic
1118930406 14:70234999-70235021 GGCTGGGTGGGTCAGAGGTAGGG - Intergenic
1119472282 14:74907528-74907550 TGCCTGGGAGGACACAGGGAAGG + Exonic
1121408747 14:93734923-93734945 GGGCTGGGGGCTCCCAGGAAGGG - Intronic
1122034214 14:98935767-98935789 GGCCTGGAGAGCCACAGGGAGGG + Intergenic
1122071009 14:99205319-99205341 GGCCTGGGCCGTCTCAGTTAGGG - Intronic
1122140991 14:99662948-99662970 GGCCTGGGAACTCACAGGTCTGG - Exonic
1122645131 14:103189136-103189158 GGCCTGGGCGGGCGCAGGGAGGG + Intergenic
1123783202 15:23646297-23646319 AGCCTGGCGGATCACAGGTGGGG + Exonic
1123783209 15:23646318-23646340 GGCCTGGCGGATCACAGGTGGGG + Exonic
1123783224 15:23646360-23646382 GGCCTGGCGGATCACGGGTGGGG + Exonic
1123783232 15:23646381-23646403 GGCCTGGCGGATCACGGGTGGGG + Exonic
1123783239 15:23646402-23646424 GGCCTGGCGGATCACCGGTGGGG + Exonic
1124212902 15:27777755-27777777 GGCCTGGTGGCTCAGAGGTCAGG + Intronic
1126449377 15:48789166-48789188 GGCCTGGAGGGTCCCAGCTAGGG - Intronic
1126588147 15:50310835-50310857 GGCATGGGGGCTCACACCTAGGG + Intronic
1126805698 15:52346566-52346588 GCTTTGGTGGGTCACAGGTATGG - Intronic
1128157783 15:65402520-65402542 GGGCAGGGGGGCCACAGGGAGGG + Intronic
1128979562 15:72176316-72176338 GGCCTGCGTGGTCACAGGCAGGG + Intronic
1129196398 15:73969774-73969796 GGCCTGGTAGGCCACAGGAAGGG - Intergenic
1129456283 15:75677575-75677597 GACCTGGGAAGTCACAGGGAGGG - Intronic
1129708615 15:77808881-77808903 GGCCTGGGGAGTCACACCTGAGG - Intronic
1131990450 15:98088500-98088522 CGCCTGTTGAGTCACAGGTAAGG - Intergenic
1132099694 15:99014797-99014819 CGCCTGTTGAGTCACAGGTAAGG + Intergenic
1132398465 15:101490317-101490339 GGCCTGGGGGTTCACCTGCACGG - Intronic
1132398486 15:101490380-101490402 GGCCTGGGGGTTCACCTGCACGG - Intronic
1132398500 15:101490422-101490444 GGCCTGGGGGTTCACCTGCACGG - Intronic
1132481253 16:167244-167266 GGGCTGCAGGGTCACAGGGAGGG - Intergenic
1132771908 16:1568158-1568180 GGCCTGGGAGGACAGAGGTGAGG + Intronic
1132782810 16:1637416-1637438 GTCCTGGGAGGGCACAGGTGAGG + Intronic
1133340984 16:5035784-5035806 GGTATGGGGGGACACAGATAGGG + Intronic
1135047009 16:19164315-19164337 GGACTGTGGGGTTACAGGTGAGG - Intronic
1137389948 16:48072877-48072899 GGGGTGGGGAGTCACAGGTGAGG + Intergenic
1137600061 16:49750376-49750398 GTCCTGGGGGATCCCAGGTGGGG + Intronic
1138470770 16:57234037-57234059 GGCCTGGGAGGTCACCGGAAAGG - Intronic
1139397681 16:66653471-66653493 GGCCCTGGGGGTCATAGGTTTGG - Intronic
1142079968 16:88143791-88143813 GGCCTGGGAGGACACAGGCAGGG - Intergenic
1142139213 16:88465211-88465233 GGGCTGGGGAGACACAGGCAGGG + Intronic
1142976180 17:3645971-3645993 GGCCTGGGGGGTCTGAGTGACGG + Intronic
1143184129 17:5000369-5000391 GGCCTGGCTGGGCACAGGCAGGG + Intronic
1143741970 17:8961017-8961039 GGCCTGGGCGGTCAGTGCTATGG + Intronic
1145104723 17:20105588-20105610 GGGCTGGGGGGTCTCTGGTGAGG - Intronic
1145294228 17:21575236-21575258 GGCCACAGAGGTCACAGGTAGGG + Intergenic
1145369603 17:22297950-22297972 GGCCACAGAGGTCACAGGTAGGG - Intergenic
1145760198 17:27421221-27421243 GGCCTGGGCGGTAGCAGGTGGGG + Intergenic
1146950438 17:36901653-36901675 CGCCTGGGAGGTCACATGTCTGG - Intergenic
1146965274 17:37022915-37022937 GGGCTGGGGGGAGACAGGTACGG - Intronic
1147037435 17:37692203-37692225 GGCCTTGGGGATTACAGGTCAGG - Intronic
1147135559 17:38432056-38432078 GCCCTGGGGGGCCACAGGCGGGG - Intronic
1147153900 17:38533647-38533669 GGCCTGGGTGGTCAGAGGGCAGG + Intronic
1147337749 17:39737679-39737701 GGCCTGGGGGCTGCAAGGTAAGG - Intergenic
1150003211 17:61454847-61454869 GGCCTGCGGGGTCGCAAGGAGGG - Intronic
1152460416 17:80439373-80439395 AGCCTGGGGGGAGACAGGGATGG - Intergenic
1160015056 18:75133942-75133964 ACGCTGGGGGGGCACAGGTATGG + Intergenic
1160559674 18:79748377-79748399 GGCCTGGGGGGACCCATGGAGGG + Intronic
1160819175 19:1049835-1049857 GGTCGGGGGGCTCACAGGGAGGG - Intronic
1161305343 19:3564273-3564295 GGCCTGGGGTGACAGAGGTGGGG + Intronic
1163002239 19:14375647-14375669 GGCCTGGGTGGTCTCTGGGATGG + Intergenic
1163594714 19:18214315-18214337 GCCCTGTGGGGTCACAGTTGGGG - Intronic
1164638796 19:29810815-29810837 GGGGTGGGGGGTGGCAGGTAGGG - Intergenic
1165707611 19:37987657-37987679 GGCCTAGGGGGTCCCAGGCATGG - Intronic
1166295847 19:41888875-41888897 GGGCTGGGTGGGCACAGGGAGGG + Intronic
1166343041 19:42150195-42150217 GGTCTTGGGGGGCACAGGGATGG - Intronic
1166375497 19:42324857-42324879 GTCCTGGAGAGTCACAGGCAGGG - Exonic
1167244523 19:48365343-48365365 GTTCTGGGGGGTCCCAGGAAAGG - Intronic
1167694431 19:51006503-51006525 TGCCTGGGGAGACACAGGTCTGG + Exonic
927495498 2:23549102-23549124 GGCCCTGGAGGTCACAGGGAAGG + Intronic
931720186 2:65061827-65061849 GGCATGGGAGGTCACATGAAAGG - Intronic
931756456 2:65378984-65379006 GGCCAAGGGGGTCCCAGGAAAGG - Intronic
931928132 2:67097663-67097685 GGCCTGGGGAGTCACAGTCCCGG + Intergenic
933163031 2:79046595-79046617 GGGGTGGGGGGACAAAGGTAAGG + Intergenic
934526743 2:95056785-95056807 GGCCTCGTGGGTCACTGCTAAGG + Intergenic
934691653 2:96365383-96365405 GGGGTGGGGGGACACAGGTCAGG - Intronic
935575433 2:104704905-104704927 GCCGTGGGAGGTCACAGGTACGG + Intergenic
938374841 2:130798383-130798405 GGCAGGAGGGGTCACCGGTAGGG + Intergenic
940515261 2:154676527-154676549 GGCTTGGTGGATCTCAGGTATGG - Intergenic
942928028 2:181457104-181457126 GGGCTGGGCGGTCACAGCGAGGG + Intergenic
945984343 2:216341816-216341838 GGTCTTGGGGGTCCCAGGGAGGG + Intronic
947588846 2:231373123-231373145 GGCCTGGTGGCTGACAGGTCAGG - Intronic
948809223 2:240466379-240466401 GGCCTGGGGTGGGACAGGGAGGG + Exonic
948836095 2:240626704-240626726 GCCCAGTGGGGTCACAGGTACGG + Intronic
949072427 2:242033576-242033598 GGGCTGGGGTGCCACAGGAATGG - Intergenic
1168762243 20:357172-357194 GGCCTTGGAGGCCACAGGGAGGG - Intronic
1168763919 20:368954-368976 GGCCTGAACGGTGACAGGTATGG - Intronic
1168819194 20:761862-761884 GGGCGGGGGGGTCAGAGGTCAGG - Intronic
1169845073 20:9981442-9981464 GGCCTGGTAGGTCCCAGGTAGGG - Intergenic
1171204001 20:23265280-23265302 GGCATGGGTGCTCACAGGGATGG - Intergenic
1172102008 20:32490343-32490365 GGACTGGGGGGTGAGAGGGAAGG + Intronic
1172381043 20:34492010-34492032 GGGATGGGGAGTCACAGGAAGGG + Intronic
1172785262 20:37464456-37464478 GGCCCGGGAGGACACAGGCAAGG - Intergenic
1173454225 20:43190234-43190256 GCCCTGTGGGGGCGCAGGTACGG + Intergenic
1174575277 20:51532830-51532852 GTCCTTGGGGGGCACAGGGAGGG + Intronic
1174931644 20:54822677-54822699 GGCCTGGAGGGTGAAAGGAAGGG - Intergenic
1175632723 20:60555951-60555973 CTCCTGGGGAGTCACAGGAAGGG + Intergenic
1175950119 20:62578898-62578920 GAGCTGGGGGGTCAGAGGTCTGG - Intergenic
1178049526 21:28732637-28732659 TGGCAGGGGGGCCACAGGTAGGG + Intergenic
1178716411 21:34968403-34968425 GGCCTGGGGAGCCACAGGTGGGG + Intronic
1179473860 21:41631060-41631082 GGCCTGGGCTGTCCCAGGGAAGG + Intergenic
1179625839 21:42649302-42649324 GGCCTGGCGGGTCAGAGCCATGG - Intergenic
1179994200 21:44966547-44966569 GCCATGGGGGGTGGCAGGTAGGG - Intronic
1180079486 21:45480272-45480294 GAGCTGAGGGGTCACAGGTGTGG + Intronic
1180223557 21:46375678-46375700 GGCCTGAGGGATCACATGTGGGG + Intronic
1180976182 22:19849978-19850000 GGCCTGGGGCCTCACAGCTCTGG + Exonic
1181570192 22:23764199-23764221 GGGCTGAGGGGTCCCAGGCAGGG + Intronic
1181985660 22:26798542-26798564 GGCCTGGTGGGTCTCAGGTGAGG + Intergenic
1182242107 22:28924217-28924239 GGCCTGGTGGGTCCATGGTAGGG + Intronic
1183358035 22:37369830-37369852 GGCAGGGGGGGCCACAGGGAGGG - Exonic
1183695014 22:39416771-39416793 GGCCTAGGGGGACACAGGACAGG - Exonic
1184878739 22:47291769-47291791 GGCCTGGCGGGGCCCAGGGAAGG + Intergenic
949929138 3:9064579-9064601 GACCTGGGGGTGCACAAGTAGGG + Exonic
950400988 3:12768963-12768985 GGCCTGGCGAGGCACAGGCAAGG + Intronic
950712075 3:14819914-14819936 GGCCACGGGTGTCACAGGTGGGG + Exonic
950734586 3:14995347-14995369 GGGCTGGGGGGTGAGAGCTAAGG - Intronic
953452320 3:43015315-43015337 GGCTTGTGAGGTCACAGGAAGGG + Intronic
956375701 3:68611399-68611421 GACCCGGGGGGTCACAGGTGGGG - Intergenic
960087588 3:113607532-113607554 GGCCTGGGAGGCCACAGGGCTGG - Intronic
961442571 3:126961591-126961613 GGGGTGAGGGGTCACAGGTCAGG + Intergenic
961448103 3:126990542-126990564 GGCCTCGGGGGTCCCAGGTCTGG - Intronic
961523689 3:127483381-127483403 GGGCTGAGAGGTCACAGGTGGGG - Intergenic
962748038 3:138412023-138412045 GGACTTGGGGGTCACAGGGATGG + Intergenic
966767730 3:183478205-183478227 GGCCTGGGGGGAGACAGGCGAGG + Intergenic
967429164 3:189361686-189361708 GGGCTGGGGGGTGAAAGGTTGGG - Intergenic
968133140 3:196203806-196203828 GAGCTGGGGAGTCACAGGTGGGG + Intronic
969514792 4:7641074-7641096 GGCCTGCGGTGGCACAGGGAAGG - Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
970120284 4:12745965-12745987 GGCCTTGGGGGACGCAGGGAGGG + Intergenic
970487754 4:16541587-16541609 TGCCTGGGGCATCCCAGGTAAGG + Intronic
971249008 4:24956531-24956553 GGCATGGAGGGCCCCAGGTAAGG - Intronic
972461397 4:39306966-39306988 GGCCTGTGCGTTCACAGGAAAGG - Intronic
972493679 4:39612534-39612556 GGCCTGGGGGGATACACGTCAGG - Intronic
972545073 4:40072629-40072651 GGCCTGGGGGGGTACAGGGAGGG - Intronic
974014779 4:56639043-56639065 TCCCTGAGGGGCCACAGGTAGGG - Intergenic
974204036 4:58675810-58675832 GGCCAAGGGGGTCCCAGGTGAGG + Intergenic
975404047 4:73968939-73968961 GTGCTGGGGGCTCACAGGGAAGG - Intergenic
984125332 4:175801676-175801698 TGCCTGGGGGGACACAGGCATGG + Intronic
985691733 5:1316705-1316727 GGCCTGGGGGGGCACACGGGAGG - Intergenic
990997362 5:61745917-61745939 GGCCTGAGGGGTCAAAAGCAAGG - Intronic
996702701 5:126465925-126465947 GGCCTGGTGGGTCCCCGGGATGG - Intronic
997585436 5:135040499-135040521 GGCCTGCGGGGCCACAGGGGTGG - Intronic
1001820060 5:174703448-174703470 GGTCTGGGGGCTCTCAGGAAGGG + Intergenic
1002081621 5:176740858-176740880 GGCCTGGGGGGCCCCGGGGAAGG + Intergenic
1002102151 5:176862933-176862955 GGCCTCCGGGGTCCCAGGTGGGG - Intronic
1006101086 6:31686808-31686830 GGCCTAGGGGGACACAGAGATGG + Intergenic
1006838717 6:37014791-37014813 GGACTGGGGGGTAACAGTGAGGG - Intronic
1006885926 6:37382263-37382285 GGCCTGGGGAGGTGCAGGTATGG + Intronic
1007210469 6:40189769-40189791 GGCATGGTGGGGCACAGGGAAGG + Intergenic
1016810515 6:148256921-148256943 AGCTTTGGGGGTGACAGGTATGG + Intergenic
1017002168 6:150004424-150004446 GGCCTGTGGGGTGACAGGGCTGG + Intergenic
1018983314 6:168616508-168616530 GGGCTGGGGAGTCCCAGATATGG + Intronic
1019330320 7:457746-457768 GGCCTGGGGGGTCCCAGCGTTGG - Intergenic
1019565090 7:1675136-1675158 GGCCTGGGGGTGCACAGGGGTGG - Intergenic
1019928643 7:4209235-4209257 GGCCTGGCAGGTCACAGCTGTGG + Intronic
1023874229 7:44278108-44278130 GGCCTGGGGAGTTCCAGGCAGGG + Intronic
1028087852 7:86658382-86658404 GGCCTGGGGAGTGAGAGGGAAGG - Intronic
1028447403 7:90941297-90941319 GGCCTGGCATGTCACAGGTATGG - Intronic
1029124293 7:98286196-98286218 TGCCTGTGGGGACACAGGGAGGG + Intronic
1029333366 7:99878794-99878816 GTGCTGGTGGGTCACAGTTATGG - Intronic
1029437714 7:100572361-100572383 GGCTGGGTGGGTCAGAGGTATGG + Exonic
1029987647 7:104936536-104936558 GTCCTGGGAGGGCAAAGGTAAGG + Intergenic
1032196376 7:129791345-129791367 GGCCAGGGGTCTTACAGGTAAGG - Intergenic
1034492326 7:151400024-151400046 GGGCTGAGGGGTCAGAGATATGG - Intronic
1034848784 7:154474100-154474122 GGCCTGTAGGCTCACAGGTCAGG + Intronic
1036168207 8:6457636-6457658 GGCCAGGAGGGTCTCAGGTGGGG - Intronic
1036195970 8:6715220-6715242 AGCCTGGTGGGTGAGAGGTAGGG + Intronic
1039900281 8:41746949-41746971 AGCCTGGGAGGTCATAGATAAGG - Intronic
1042872778 8:73413168-73413190 GGCATTTGGGGCCACAGGTATGG + Intergenic
1046740180 8:117819590-117819612 AGCCCGGGGGATAACAGGTAAGG + Intronic
1046825556 8:118688004-118688026 GGTCTGGGGAGTCACAGGTCTGG - Intergenic
1047940943 8:129826912-129826934 GGCCTGAGGGGTCACACTGAGGG + Intergenic
1048536875 8:135304714-135304736 GGACTGGAGGGTCACAGGTGGGG + Intergenic
1049880803 8:145061208-145061230 GTCCTGAGGGGCCACAGGAATGG - Intergenic
1054460539 9:65459929-65459951 GGCCTGGGAGGCCCCAGGCAGGG + Intergenic
1054805878 9:69395604-69395626 GGACTGGGAGGTAACAGGTGGGG + Intergenic
1055328377 9:75156069-75156091 GGCATGGGGCATCACATGTAAGG - Intergenic
1056402720 9:86243595-86243617 AGCCTGGGGGATCACAGTTAAGG - Intronic
1057266702 9:93622145-93622167 GGCCTGGGTGGCCAGAGGGATGG + Intronic
1057973721 9:99581598-99581620 GGCCTCGGGGGTGGGAGGTAGGG + Intergenic
1059997324 9:119924841-119924863 GGCCTGGTGGGCCAAATGTATGG + Intergenic
1060047638 9:120353462-120353484 GGCCTGCGGGGGGACAGGGAGGG + Intergenic
1060175318 9:121493314-121493336 GCCCTCGGTGGGCACAGGTAGGG - Intergenic
1060892643 9:127198511-127198533 GGCCAGTGGGGTCACAGAGAGGG - Intronic
1061238049 9:129353305-129353327 GGACTGGGGAGTCACAGGGAAGG + Intergenic
1061306198 9:129734632-129734654 GGCGTGGGGGGCCACAGGCGTGG + Intergenic
1061404321 9:130385176-130385198 GGCCTGTGGGCTCACAGCCATGG + Intronic
1061820937 9:133226875-133226897 GGCCGGGGGAGGCACAGGTCAGG - Intergenic
1061871323 9:133522265-133522287 GGCCTGGGGGGTCAGAGCTCAGG + Intronic
1062605942 9:137348901-137348923 TGCCTGGGGGGTCACTGCTCAGG - Intronic
1062626854 9:137447189-137447211 GGCCTGGGGGGCCTTATGTATGG - Intergenic
1185984098 X:4811287-4811309 GGCCTGTGGGGGCAGAGGAAGGG - Intergenic
1187098005 X:16167265-16167287 GGCCTGGAGGGTCTCAGGGAAGG + Intergenic
1188443165 X:30232237-30232259 AGCCTGGCGGGTCTCAGGGAGGG + Intronic
1189294650 X:39909898-39909920 GGCCTCGGGGGGCTCAGCTAAGG + Intergenic
1196883595 X:120222932-120222954 GGTGTGGGGGGTCACAGAAAAGG - Intergenic
1199947643 X:152681118-152681140 GCCCTGGGAGGCCACAGGCAGGG + Intergenic
1199962036 X:152787336-152787358 GCCCTGGGAGGCCACAGGCAGGG - Intergenic
1199981521 X:152923214-152923236 GGCCTGGGAAGTGACCGGTAGGG - Intronic
1200076431 X:153553586-153553608 AGCCTGAGGGGACACAGGTTTGG + Intronic
1200126504 X:153817545-153817567 GGCCTGGGGAGTCACTGCTGAGG + Intronic
1200236205 X:154468980-154469002 GGCCAGGCGGGCCAGAGGTAGGG + Intronic