ID: 1091769568

View in Genome Browser
Species Human (GRCh38)
Location 12:3142229-3142251
Sequence GTAAAATAAAGGCTGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091769568_1091769572 9 Left 1091769568 12:3142229-3142251 CCTCACTGCAGCCTTTATTTTAC 0: 1
1: 0
2: 1
3: 32
4: 281
Right 1091769572 12:3142261-3142283 TCCCCACCCAGCCACACCACTGG 0: 1
1: 0
2: 3
3: 48
4: 476
1091769568_1091769580 22 Left 1091769568 12:3142229-3142251 CCTCACTGCAGCCTTTATTTTAC 0: 1
1: 0
2: 1
3: 32
4: 281
Right 1091769580 12:3142274-3142296 ACACCACTGGGCTTCCCACTTGG 0: 1
1: 0
2: 1
3: 25
4: 322
1091769568_1091769574 10 Left 1091769568 12:3142229-3142251 CCTCACTGCAGCCTTTATTTTAC 0: 1
1: 0
2: 1
3: 32
4: 281
Right 1091769574 12:3142262-3142284 CCCCACCCAGCCACACCACTGGG 0: 1
1: 0
2: 1
3: 75
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091769568 Original CRISPR GTAAAATAAAGGCTGCAGTG AGG (reversed) Intronic
900229544 1:1549541-1549563 GAAAAAAAAAGGCTGCAGCCAGG + Intronic
901828010 1:11875121-11875143 GCAAAACTAAGGATGCAGTGAGG - Intergenic
902109770 1:14068468-14068490 TTTAAAAAAAGTCTGCAGTGGGG + Intergenic
902950067 1:19875338-19875360 ATAAAATAAAGACTGCCGAGGGG + Intergenic
905163261 1:36056338-36056360 GAGAAATAAAGGCGGTAGTGGGG - Exonic
906263000 1:44407295-44407317 GAAAAAAAAGGGCGGCAGTGAGG + Intronic
906712417 1:47940795-47940817 GAGAAATAAAGGCAGCAGTGTGG + Intronic
906972480 1:50531013-50531035 GCAACAAAAAGGCTGCTGTGAGG + Intronic
907006436 1:50919455-50919477 ATAAAATAAAGGCTGCCGGGGGG + Intronic
907199733 1:52716190-52716212 GGAAAGTGGAGGCTGCAGTGAGG + Intergenic
908221796 1:62014637-62014659 GTAAGGTTGAGGCTGCAGTGAGG - Intronic
910080408 1:83334838-83334860 GTAACCCAAAGGCTGGAGTGTGG - Intergenic
910447887 1:87317374-87317396 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
910737892 1:90482303-90482325 GTAGAACAATGGCGGCAGTGTGG - Intergenic
910751671 1:90637828-90637850 GTCATTTAAAGGCTGCAGTAGGG + Intergenic
911204110 1:95075415-95075437 GTGAAAGAAAGTCTGCTGTGAGG - Intergenic
912165389 1:107037270-107037292 GTAAAATAAAGGGTGAAGTTTGG - Intergenic
914686693 1:149986032-149986054 GTAGCATACAGGGTGCAGTGGGG - Intronic
917726763 1:177835297-177835319 GTAAAATAATAGCTACAGAGGGG - Intergenic
918556618 1:185808444-185808466 GGAAAGTTGAGGCTGCAGTGAGG + Intronic
918667613 1:187171763-187171785 GTAAAGTAACTGCTGCAGTGTGG + Intergenic
919037824 1:192338687-192338709 GAAAAGTTAAGGCTACAGTGTGG - Intronic
919243866 1:194951843-194951865 GTAAAAAATAGGCTTGAGTGTGG - Intergenic
920218115 1:204375872-204375894 GGGAAATAAAGGCACCAGTGGGG - Intronic
920525455 1:206662901-206662923 GTTAAAAAAAGGCTTCAGAGAGG + Intronic
921771843 1:219049673-219049695 GCAAAATGAAGGCTGAATTGGGG + Intergenic
1062817773 10:513575-513597 GTGAATTGCAGGCTGCAGTGTGG - Intronic
1063751701 10:8956259-8956281 GTAAAAAGAAGGCTGCTGTGAGG + Intergenic
1063889648 10:10616540-10616562 GTAACATAAATACTGCTGTGTGG + Intergenic
1064300757 10:14120719-14120741 GTAAAATCAAAGCAGCAGGGAGG - Intronic
1064626317 10:17265575-17265597 CAAAAATAAAGGAGGCAGTGGGG - Intergenic
1066638271 10:37529358-37529380 GTAAAAAAAGGGGTGCAGTGGGG + Intergenic
1066662181 10:37747632-37747654 GGGAATTGAAGGCTGCAGTGAGG - Intergenic
1067686345 10:48468163-48468185 GTGAAATAAAGGCAGGAATGTGG - Intronic
1068171046 10:53395239-53395261 GAAAAATATAGTCTGCAGAGAGG + Intergenic
1068557751 10:58477869-58477891 GTAAAATATAGGCAGTGGTGTGG - Intergenic
1069467281 10:68652759-68652781 GGGAGATCAAGGCTGCAGTGAGG - Intronic
1070034531 10:72709223-72709245 GCAAAATACAGGATACAGTGGGG - Intronic
1070436362 10:76397547-76397569 GTAAAATAAATTATGCCGTGTGG - Intronic
1073686229 10:105756993-105757015 GTAAATTAAAATATGCAGTGAGG + Intergenic
1074028984 10:109665239-109665261 CCAAGATAAAGGCTGCATTGAGG - Intergenic
1074670853 10:115789012-115789034 ATAAAATAAAGGATTCTGTGGGG + Intronic
1078506359 11:11951266-11951288 GTAAAATAAGGTCTTCAGGGTGG - Intronic
1078921119 11:15831577-15831599 ATAAAATAAAACCTGCAGTAAGG + Intergenic
1079992532 11:27261678-27261700 GTAAAATACAGAGTACAGTGGGG - Intergenic
1082831621 11:57622728-57622750 TGAAAATAAAGGCTAGAGTGGGG - Intergenic
1082877489 11:58002900-58002922 GTAGAATAAATGCAGGAGTGAGG + Intergenic
1083112676 11:60427242-60427264 GTAAAATAACGTCTGTACTGGGG + Intergenic
1085154249 11:74278878-74278900 GTAAGTAAAGGGCTGCAGTGGGG + Intronic
1086157179 11:83680267-83680289 GTAAAATAAACCGTGGAGTGTGG + Intronic
1087033395 11:93729318-93729340 CTAAGATTGAGGCTGCAGTGAGG + Intronic
1087595187 11:100244557-100244579 TTAAAATGAAGGTAGCAGTGGGG + Intronic
1087820492 11:102706285-102706307 GTTAAATACAGCCTGCACTGGGG + Intergenic
1088105873 11:106206140-106206162 ATAAAGTCAAGTCTGCAGTGAGG - Intergenic
1090460930 11:126890976-126890998 ATTAAATAAAGGCAGCAGAGTGG - Intronic
1090629555 11:128634106-128634128 GTAAAAGAAAGCTTGAAGTGAGG + Intergenic
1091108860 11:132946664-132946686 GTATGACAAAGGCAGCAGTGGGG + Intronic
1091429682 12:423191-423213 GGTAGGTAAAGGCTGCAGTGAGG - Intronic
1091769568 12:3142229-3142251 GTAAAATAAAGGCTGCAGTGAGG - Intronic
1093457521 12:19379455-19379477 GGGAGATGAAGGCTGCAGTGAGG + Intergenic
1093752063 12:22811067-22811089 TCAAAATAAAGGCTGAAGTTTGG + Intergenic
1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1094696921 12:32829006-32829028 GGAAAGTTGAGGCTGCAGTGAGG - Intronic
1095918666 12:47506914-47506936 GGAAAATAAAGGGTTCTGTGGGG + Intergenic
1096121762 12:49093182-49093204 GTAAAATGAGGGTGGCAGTGGGG + Intronic
1096421689 12:51464129-51464151 GTATGATAAAGGCTGTAATGTGG - Intronic
1097797434 12:63879075-63879097 GAAAGATTGAGGCTGCAGTGAGG - Intronic
1098747500 12:74258543-74258565 GAAAAATGAAAGATGCAGTGAGG + Intergenic
1098901666 12:76117572-76117594 TTAAAATAAAGACTCCAGAGGGG - Intergenic
1100647963 12:96551183-96551205 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1100682943 12:96948833-96948855 GCAAAATAGAGGCTGAAGTTTGG - Intronic
1101505613 12:105343574-105343596 GTAATTAAAAGGTTGCAGTGAGG + Intronic
1101699238 12:107156178-107156200 GTGAAATATACTCTGCAGTGGGG + Intergenic
1102218167 12:111176642-111176664 GGAAAATAGAGCCTGGAGTGGGG - Intronic
1103273271 12:119690664-119690686 GTAAATGAAAGCCTGCACTGAGG - Intronic
1104252177 12:127105477-127105499 GGGAAATCAAGGCTGCAGTGAGG - Intergenic
1104482232 12:129117843-129117865 GGAAAACAAAGTCTCCAGTGAGG - Intronic
1105799739 13:23892929-23892951 ATAAAATAAAGCCTGCATCGAGG + Intronic
1105849307 13:24320103-24320125 ATAAAATAAAGCCTGCATCGAGG - Intronic
1106058805 13:26265320-26265342 GTAGGATAAGGGCTGCAGTAGGG + Intronic
1106493138 13:30247267-30247289 GTAAAATAAAGTCTTAAGAGTGG - Intronic
1107027653 13:35819595-35819617 GTAAAACAAAGTATGCTGTGAGG + Intronic
1107152207 13:37124813-37124835 GGGAAATCGAGGCTGCAGTGAGG + Intergenic
1107408316 13:40135943-40135965 TTAAGATAGAGGCTTCAGTGAGG - Intergenic
1109493940 13:63143426-63143448 GTAAAATCAAGACTGGAGAGCGG + Intergenic
1110351539 13:74513991-74514013 GTGAAAAAAAGGCTGGAGTGAGG + Intergenic
1110924497 13:81133083-81133105 GTAAAATAAATGCTCTAGTTTGG - Intergenic
1111755376 13:92387952-92387974 ATAAAATACAGGCTGCATTGGGG - Intronic
1113036717 13:106057688-106057710 GGGAATTCAAGGCTGCAGTGAGG + Intergenic
1115044120 14:28969122-28969144 CTAAAATAAAGGCTTCAATTTGG - Intergenic
1115204524 14:30887495-30887517 GTAATATTAAGGCTGGGGTGAGG - Intronic
1117663357 14:58031135-58031157 TTAAAATGAAGACTGCAGTTAGG + Intronic
1118562618 14:67102717-67102739 TTAAAATGAAGGCAGCAGTTTGG + Intronic
1119149432 14:72344839-72344861 GTATCATATAGGCTGCAGTGTGG + Intronic
1122611137 14:102984322-102984344 TTAGAATAAAGACTCCAGTGGGG + Intronic
1126171062 15:45695734-45695756 GTAGAATAGAGGCTGCAGAAGGG + Intergenic
1126580083 15:50234684-50234706 GGCAAATCAAGGCTGCAGTGAGG + Intronic
1129320455 15:74771888-74771910 GGAAAGTAAGGGCTCCAGTGCGG + Intergenic
1131871136 15:96765784-96765806 GTGAGTTCAAGGCTGCAGTGAGG - Intergenic
1132017571 15:98332468-98332490 GAAAACTAAAGTCTGAAGTGGGG - Intergenic
1137544933 16:49396167-49396189 GTGAGATAGAGGCTGCAGTGAGG + Intronic
1140069364 16:71635657-71635679 GAAAAATTCAGGCTGAAGTGTGG - Intronic
1140536811 16:75717242-75717264 GTAAAAACTAGACTGCAGTGAGG - Intronic
1140770157 16:78196058-78196080 GTAAAACAAAGGGTTAAGTGGGG - Intronic
1140968232 16:79988001-79988023 GAAAAATAAAAACAGCAGTGAGG - Intergenic
1140986278 16:80160821-80160843 GAGAAAAAAAGGCTGCAGAGGGG - Intergenic
1141369529 16:83474224-83474246 GTAAAATATAGGGGGCACTGAGG - Intronic
1141377916 16:83548714-83548736 GAAAAAAAAAGGCTGCCTTGTGG - Intronic
1141573015 16:84945936-84945958 AGGAAATCAAGGCTGCAGTGAGG - Intergenic
1143104839 17:4524197-4524219 GTAGAACAAGGGGTGCAGTGTGG + Intronic
1144342537 17:14321846-14321868 CTAAAATAAAGGCATTAGTGCGG + Intronic
1146230519 17:31103946-31103968 AGGAAATTAAGGCTGCAGTGAGG + Intronic
1148565451 17:48630313-48630335 GTAAAATAAATGCTTCAAAGTGG + Intronic
1149001673 17:51763939-51763961 GTAAAATAAGGGCTTAAGTTGGG - Intronic
1149357126 17:55851470-55851492 GTAGAATAAACTCTGCAGTGTGG - Intergenic
1149817223 17:59737228-59737250 GTAAGGAAAAGGCTACAGTGGGG + Intronic
1150125141 17:62630385-62630407 GTAAGTGAAAGGCTGGAGTGTGG + Intronic
1151950688 17:77351992-77352014 ACAAAATAAGGGCTGCCGTGGGG + Intronic
1153854280 18:9129724-9129746 GTAACAGTATGGCTGCAGTGAGG + Intronic
1153886502 18:9472834-9472856 GAAAAGTACAGGCTGGAGTGAGG + Intergenic
1153910269 18:9700572-9700594 GTAAAATAAATATTGCATTGGGG + Intergenic
1154077392 18:11217342-11217364 GCAAAATAAAAACAGCAGTGAGG + Intergenic
1155083786 18:22435422-22435444 GTTAAATAAAGGCTGAATAGTGG + Intergenic
1155231288 18:23777783-23777805 GTAAAAGACAGGCTGGAGTGGGG - Intronic
1155368680 18:25075370-25075392 TTAAAATAGAGTCTGCATTGTGG + Intronic
1155590555 18:27422515-27422537 GGAAAAGAAAGTCTCCAGTGTGG - Intergenic
1156752430 18:40475368-40475390 GTAAAAGAAAGGCAGCACAGAGG + Intergenic
1157123960 18:44937598-44937620 GTAGCTGAAAGGCTGCAGTGTGG - Intronic
1157137735 18:45073517-45073539 GTGAAATGCAGTCTGCAGTGAGG - Intergenic
1158185345 18:54765193-54765215 GCAAAATAAAGACTGAATTGGGG - Intronic
1158806800 18:60983471-60983493 TGAAAATTCAGGCTGCAGTGAGG + Intergenic
1159168240 18:64729048-64729070 GGAAAAGAAAGGGAGCAGTGGGG + Intergenic
1161337063 19:3720437-3720459 GTAAAAGAAAGGCTGCCTGGAGG - Intronic
1161507443 19:4651471-4651493 TTGAATTATAGGCTGCAGTGCGG + Intronic
1162203077 19:9035337-9035359 GTGAAATTTAAGCTGCAGTGAGG - Intergenic
1162324514 19:9991167-9991189 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
1164322392 19:24161257-24161279 GAAAAAAAAAGGCTGCGGTAGGG - Intergenic
1164442879 19:28292764-28292786 GTAAAATAACGGCTTCAGCCAGG + Intergenic
1166087121 19:40484040-40484062 ATAAAATCCAGGCTGGAGTGCGG - Intronic
1166205799 19:41268018-41268040 CTAAACTGAAGGCTTCAGTGGGG + Intronic
925329180 2:3044972-3044994 CTAGACTAAAGGCGGCAGTGCGG - Intergenic
925839561 2:7978845-7978867 GTAAGATGAAGGCGGCACTGCGG - Intergenic
925968488 2:9088950-9088972 ATAAAAGAAAGCCTGCAGGGTGG - Intergenic
927312957 2:21651073-21651095 GTGAAATAAAGACATCAGTGTGG - Intergenic
928098563 2:28420981-28421003 GCAAAGTACAGGCTGCTGTGGGG + Intergenic
928117348 2:28555939-28555961 GGGAGATCAAGGCTGCAGTGAGG - Intronic
928872621 2:35998589-35998611 GTAAAATCATAGCAGCAGTGAGG - Intergenic
930413252 2:51054151-51054173 GTAAATTAAGGACTGAAGTGGGG - Intergenic
930431527 2:51282790-51282812 GAAAAATAAGGGCTGCAGAGTGG - Intergenic
931052657 2:58431124-58431146 GTAAATTGTAGGCTCCAGTGAGG + Intergenic
931163418 2:59718953-59718975 TTAAAATAAAGTCTTTAGTGGGG - Intergenic
931207972 2:60166128-60166150 GTATAACAAATGCTGGAGTGGGG + Intergenic
931522166 2:63110809-63110831 GAAAAATAAAGATAGCAGTGAGG + Intergenic
931863406 2:66381687-66381709 GTAAAGTAAAAGCTGAAGTTTGG + Intergenic
933213052 2:79593858-79593880 CTAAAAGAAAGGCAGCACTGGGG - Intronic
933436039 2:82251186-82251208 TTAAAATAAAGGTTGCAGAGTGG - Intergenic
935258699 2:101335861-101335883 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
935691535 2:105736367-105736389 CTAAAATCAAGGTGGCAGTGGGG - Intergenic
936805853 2:116331751-116331773 GTAAATTAAAGTCACCAGTGTGG - Intergenic
937100234 2:119263027-119263049 GGGAAAAAAAGGCTGGAGTGAGG - Intronic
938097700 2:128474311-128474333 TTAAAACAAAAGCAGCAGTGGGG + Intergenic
938411555 2:131068941-131068963 GAAAAGTCGAGGCTGCAGTGAGG + Intronic
939391703 2:141576679-141576701 AGGAAATCAAGGCTGCAGTGAGG + Intronic
940204668 2:151189789-151189811 GTAAAGAAAACGCTGCAGTTTGG + Intergenic
940977723 2:159964952-159964974 GGGAGATAAAGGTTGCAGTGAGG + Intronic
941539110 2:166760499-166760521 GGGAGATCAAGGCTGCAGTGAGG - Intergenic
941772325 2:169358528-169358550 GTGAAATTAAAGCAGCAGTGAGG + Intronic
942331955 2:174835762-174835784 GTAGACTAAAGGTTGTAGTGAGG - Intronic
942902749 2:181142232-181142254 CTAAAATAATGCCTGCAATGTGG + Intergenic
943121758 2:183744728-183744750 GTAAAATAAAGACTAGAGTAGGG + Intergenic
945568462 2:211433726-211433748 GTAAAATAAAGGCTGCAATTTGG + Intronic
947241471 2:227998957-227998979 GTAAAATATTGGCTGCAGAAAGG + Intronic
947992829 2:234500042-234500064 GGAAAATATTGGCTGCACTGTGG + Intergenic
948482121 2:238256761-238256783 GTAAAATGCAGGGTGGAGTGCGG - Intronic
948644574 2:239396047-239396069 GGAAAGTCAAGGTTGCAGTGAGG - Intronic
1170776440 20:19378912-19378934 AAAAAAAAAAGGATGCAGTGGGG + Intronic
1171416917 20:24988299-24988321 TAAAAATATAAGCTGCAGTGTGG - Intronic
1173300650 20:41799427-41799449 ACAAAAGAAATGCTGCAGTGTGG - Intergenic
1174365790 20:50055410-50055432 GAAAAATAAACGCTGCAGGAGGG - Intergenic
1176588787 21:8619647-8619669 GTAAATAAAAGTTTGCAGTGAGG - Intergenic
1177278104 21:18942193-18942215 CTAAAATAAAGGTGACAGTGAGG + Intergenic
1178509848 21:33195223-33195245 GTAAAATAAAGGCAGAACTAAGG + Intergenic
1179535804 21:42050685-42050707 GAAGAATAAAGGCAGGAGTGAGG - Intergenic
1180080783 21:45486698-45486720 TTAGAAGAAAGGCTGCTGTGGGG + Intronic
1180271613 22:10596643-10596665 GTAAATAAAAGTTTGCAGTGAGG - Intergenic
1181341236 22:22181865-22181887 GAAAACTAAAGGCTGAGGTGAGG + Intergenic
1181403503 22:22666020-22666042 GTAAATTAAAGCCTGCTGAGGGG + Intergenic
1182957664 22:34442481-34442503 CTAAAATTAAGGCTTCAGTAGGG + Intergenic
1183218686 22:36497867-36497889 CTAAGATGAAGGCTGCTGTGGGG - Intronic
1184304700 22:43589389-43589411 GTGAAATAAGGGCTGCAGCAGGG + Intronic
949138535 3:602123-602145 GTAAACAAAAGTTTGCAGTGAGG + Intergenic
950834219 3:15903830-15903852 CTAAAATAAGTGCTGCTGTGGGG + Intergenic
953060589 3:39425567-39425589 GTAAATTAAAGGCTGCACTTGGG - Intergenic
953129977 3:40128482-40128504 GTTAAATGAAGGCTGCAAGGTGG - Intronic
954726544 3:52616231-52616253 ATAAAATAAAGTATGCATTGAGG - Intronic
955038822 3:55294544-55294566 ATCAAGTAAAGGCAGCAGTGAGG - Intergenic
957812068 3:85235886-85235908 GTAAAATAAGAGCTTTAGTGTGG - Intronic
958442270 3:94170359-94170381 GTAAACTAAAGGATGCAGCAGGG - Intergenic
958936139 3:100257892-100257914 GTCATCTAAAGGCTTCAGTGGGG - Intergenic
959055537 3:101563883-101563905 GCAAAATAAAGCCTGAACTGGGG + Intronic
960254770 3:115500237-115500259 GTAAGATAAAGTCTGCTGTCTGG + Intergenic
960416690 3:117393617-117393639 TTAAAAAAAAGAATGCAGTGAGG - Intergenic
961484712 3:127208703-127208725 GGAGAATCCAGGCTGCAGTGGGG + Intergenic
962113918 3:132481506-132481528 GGGAAGTCAAGGCTGCAGTGAGG + Intronic
962654108 3:137525219-137525241 GGAAAACAAAGGCTGAGGTGAGG + Intergenic
963586759 3:147201256-147201278 ATAAAATAAAGGTTGGAATGAGG - Intergenic
964796965 3:160509021-160509043 GTAACAAAAAGGCTGCAGACTGG - Intronic
965353413 3:167644093-167644115 GTAAAATAAAGACAGTAGAGTGG + Intronic
965603509 3:170477477-170477499 GTAAAATAGAGATTGCTGTGAGG + Intronic
966703074 3:182877643-182877665 GAAAAATAAAGGCAGCAAAGGGG + Intronic
967708177 3:192676752-192676774 GAAAGATGAAGGCAGCAGTGAGG + Intronic
968188285 3:196648873-196648895 ATCAAAGAAAGGCTGGAGTGGGG - Intronic
968796324 4:2707800-2707822 GGGAAATAAAGTCCGCAGTGAGG - Intronic
969196050 4:5564808-5564830 AGAAAATAAAGGGGGCAGTGAGG + Intronic
970581305 4:17476663-17476685 GTAAAATAAAGGCCACTGGGGGG - Intronic
971116156 4:23647770-23647792 ATTAAAAAAAGGCTGCACTGGGG - Intergenic
972015202 4:34234858-34234880 CTGAAATAAAGGCTGCAGCCAGG - Intergenic
972101745 4:35428751-35428773 GAAAAAGAGAGGCTGGAGTGAGG - Intergenic
972517773 4:39825118-39825140 TTAAAATAAAAACTGCAGCGTGG + Exonic
973936474 4:55851672-55851694 GGAAAATAAAGGCTGAAGGTGGG + Intergenic
974492326 4:62582868-62582890 GTAAAATAAAAGCTGCCTAGAGG - Intergenic
975127265 4:70797011-70797033 GGGAAATCGAGGCTGCAGTGAGG - Intronic
976017486 4:80575396-80575418 GGGAAGTCAAGGCTGCAGTGAGG - Intronic
977095826 4:92742748-92742770 GAAAAAGAAAGGTTGCTGTGAGG - Intronic
977338885 4:95731794-95731816 GTATAATAAAAGCTGGAGTCAGG - Intergenic
977872944 4:102114740-102114762 GTCAAATAAAGGCTGGAATATGG - Intergenic
978042169 4:104080783-104080805 GGAAAATAAGGGCTGAAGAGAGG + Intergenic
978331705 4:107620531-107620553 TTTAAATAAAGGCTAGAGTGTGG + Intronic
979475643 4:121154456-121154478 ACAAAATCTAGGCTGCAGTGTGG - Intronic
979904111 4:126262853-126262875 GTAAAATAAAGACAGGAGTGGGG + Intergenic
981156683 4:141445604-141445626 GTAAAATGATGGCTGTGGTGGGG + Intergenic
982240423 4:153294838-153294860 GTTAAACAAAGGCTGCAGTCAGG - Intronic
984526243 4:180862029-180862051 GTAGAATAAATGTTGCAGAGCGG + Intergenic
984846778 4:184115163-184115185 GTCAACTCATGGCTGCAGTGAGG + Intronic
985025730 4:185737470-185737492 TTAAAATAAAGTGGGCAGTGGGG + Intronic
985863142 5:2490354-2490376 TAAAGATAAAGTCTGCAGTGAGG - Intergenic
986244968 5:5998804-5998826 GGAAGAAAAAGGCTGCAGTTTGG + Intergenic
986735624 5:10665511-10665533 GCATAATACAGCCTGCAGTGGGG + Intergenic
988520553 5:31941482-31941504 CAAAAATAAAGGATGCAGTTTGG + Intronic
989007575 5:36831838-36831860 GGAAAATAAATCCTGCAGAGTGG - Intergenic
990725090 5:58744558-58744580 GAAAAATGAAGCCAGCAGTGGGG - Intronic
991207307 5:64064767-64064789 GAAAAATAAAGCCAGCAGTGGGG + Intergenic
991344425 5:65648142-65648164 GTCAAATAATGACTGCAGGGTGG - Intronic
992130411 5:73686209-73686231 TTAAAAAAAAGGCTGGACTGAGG + Intronic
992543833 5:77790809-77790831 GAAAAATATAGGCTGCATTGAGG - Intronic
993860415 5:93129749-93129771 GGGAAATAAAGGATGCAATGGGG + Intergenic
994400327 5:99271780-99271802 GGAAAATAGAGGCAGCAGTGTGG - Intergenic
995843089 5:116463803-116463825 ATAAAATAAAGTCTGAAGTAGGG + Intronic
999347479 5:150836961-150836983 CTAAAAAAAAAGCTGCAGGGTGG - Intergenic
999638650 5:153648905-153648927 GGAAAATGAAGGCTGCAGTTGGG + Intronic
1000554461 5:162707796-162707818 GTAAAATAATGGCTGATGTTTGG - Intergenic
1000905741 5:166963707-166963729 GTCTAATAATGTCTGCAGTGGGG + Intergenic
1002897358 6:1387417-1387439 ATAAAATAGAAGCTGGAGTGGGG - Intergenic
1003186276 6:3833528-3833550 GTAAAACACAGGATGCACTGGGG - Intergenic
1003680642 6:8250591-8250613 GTAAAATAAAAAATGTAGTGAGG + Intergenic
1004446183 6:15700938-15700960 AGAAAGTCAAGGCTGCAGTGAGG + Intergenic
1004446831 6:15708050-15708072 GTTAAACAAAAGATGCAGTGAGG + Intergenic
1004916635 6:20338903-20338925 GGGAAGTCAAGGCTGCAGTGAGG + Intergenic
1005416493 6:25605527-25605549 GTTAAATTAAGGCAGCAGTATGG + Intronic
1006806561 6:36793060-36793082 GTGAAGTAAAGGGTGCAGGGAGG - Intronic
1007013864 6:38443186-38443208 GAAAAATTCAGGCTGCTGTGAGG + Intronic
1007492860 6:42237435-42237457 GTAAAATAAAAGCTGAAATGAGG - Intronic
1008502683 6:52199370-52199392 TTAAAATAAAAGCTGATGTGGGG - Intergenic
1009418313 6:63439551-63439573 GTAAAATAAAGTCTGAAGTATGG + Intergenic
1010585333 6:77651197-77651219 GAAAAATAAAGGCAAGAGTGAGG + Intergenic
1010767408 6:79792009-79792031 GTAAAGAGAAGACTGCAGTGAGG - Intergenic
1011989148 6:93490623-93490645 TTAGAAGAAAGGATGCAGTGAGG - Intergenic
1014804164 6:125810670-125810692 GAAGCATGAAGGCTGCAGTGTGG + Intronic
1016633280 6:146256922-146256944 GTAACACAAAAGCAGCAGTGGGG - Intronic
1017134821 6:151139143-151139165 ATAAAATAATGAGTGCAGTGGGG - Intergenic
1018523020 6:164673456-164673478 ATAAATTGAAGGCTGGAGTGAGG + Intergenic
1018742696 6:166742699-166742721 GTAATAAAAAGTATGCAGTGTGG - Intronic
1021053693 7:16020729-16020751 GTAAAATAAATTTTGTAGTGGGG + Intergenic
1021087521 7:16440303-16440325 GTACAAAAAAAGCTTCAGTGAGG - Intergenic
1021151780 7:17160289-17160311 GTAAAATAAAGGCAGGACTAAGG - Intergenic
1021286617 7:18788402-18788424 ATATAATAAAGTCTGCAGAGTGG - Intronic
1022329687 7:29365859-29365881 GGAAAAAACAGGCTGCAGGGTGG + Intronic
1024847349 7:53662392-53662414 GTAGAATAAAGGTTACTGTGGGG - Intergenic
1025111359 7:56219076-56219098 AGGAATTAAAGGCTGCAGTGAGG - Intergenic
1027298185 7:76800103-76800125 GTAACCCAAAGGCTGGAGTGTGG - Intergenic
1032101665 7:128984285-128984307 GAAAAATAAACGCTGAATTGAGG + Intronic
1033845725 7:145429435-145429457 GCAGAAAGAAGGCTGCAGTGAGG + Intergenic
1034905313 7:154939566-154939588 GTGAAATTAAGGCTGCAATTTGG - Intronic
1037444494 8:18951327-18951349 ATGAATTAAAGGCTACAGTGAGG + Intronic
1039052198 8:33505243-33505265 TAAAAATAAAGGCAGCAGGGTGG + Intronic
1040039608 8:42902895-42902917 GAAAAATAGAGGCAGCAGTGAGG - Intronic
1040317967 8:46274973-46274995 GTGAAAACAAGGCTGCAGGGTGG + Intergenic
1040333619 8:46404949-46404971 GCAAAAACAAGGCAGCAGTGTGG + Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1042310611 8:67375577-67375599 CTAAAATCAAGGCATCAGTGGGG + Intergenic
1042778792 8:72467115-72467137 GTACAAAAATGGCAGCAGTGGGG - Intergenic
1043225926 8:77729977-77729999 GCAAAATAATGGCTGCATTTAGG + Intergenic
1046451807 8:114402584-114402606 GTAAAGTAAAGCCTACAGAGTGG + Intergenic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1047896589 8:129373230-129373252 AAGCAATAAAGGCTGCAGTGAGG - Intergenic
1050629794 9:7546290-7546312 GTCAAAGCAAGGCAGCAGTGAGG + Intergenic
1054799815 9:69335909-69335931 AGAAAGTCAAGGCTGCAGTGAGG + Intronic
1057808950 9:98242791-98242813 AAAAAAAAAAGGCAGCAGTGTGG - Intronic
1058884743 9:109314640-109314662 TTAAAAGAAAGGCTGAGGTGGGG - Intronic
1058950748 9:109901663-109901685 GTATAATAAAGGCCGTTGTGAGG + Intronic
1059308358 9:113372040-113372062 GTGGAATGAAGGCTGCTGTGAGG - Intergenic
1059582887 9:115570766-115570788 GGGAGATAGAGGCTGCAGTGAGG + Intergenic
1060819716 9:126654316-126654338 GTGAAATCAGGGCTGGAGTGGGG - Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061953224 9:133948102-133948124 CTTAAAGAGAGGCTGCAGTGCGG + Intronic
1203618794 Un_KI270749v1:98226-98248 GTAAATAAAAGTTTGCAGTGAGG - Intergenic
1185555978 X:1021525-1021547 GTCAGACACAGGCTGCAGTGTGG - Intergenic
1186569521 X:10699468-10699490 GTAAACTGAAGGCTGCAGTTTGG + Intronic
1187283645 X:17882404-17882426 GTGAAATAAAGGCTGCACACTGG - Intergenic
1187340545 X:18417227-18417249 GGAAAATACAGCCTGCTGTGGGG + Intergenic
1189383747 X:40520185-40520207 GGAAAGTCGAGGCTGCAGTGAGG + Intergenic
1195549447 X:106150514-106150536 GGGAAATTGAGGCTGCAGTGAGG + Intergenic
1196531601 X:116793643-116793665 GTGAAATATAGGGTGCAGTTAGG - Intergenic
1197597721 X:128486758-128486780 GCAGAATAAAGGCTACAGAGAGG + Intergenic
1198596117 X:138237699-138237721 GTAAAATAAAAGCTGTAGCTGGG - Intergenic