ID: 1091769958

View in Genome Browser
Species Human (GRCh38)
Location 12:3145103-3145125
Sequence CTGTGTGCTCACAAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 1, 2: 1, 3: 57, 4: 752}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091769958_1091769963 6 Left 1091769958 12:3145103-3145125 CCCACTCCCTTGTGAGCACACAG 0: 1
1: 1
2: 1
3: 57
4: 752
Right 1091769963 12:3145132-3145154 CAGCAGCCCTCGGCGTCCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 196
1091769958_1091769962 -4 Left 1091769958 12:3145103-3145125 CCCACTCCCTTGTGAGCACACAG 0: 1
1: 1
2: 1
3: 57
4: 752
Right 1091769962 12:3145122-3145144 ACAGTGCGTGCAGCAGCCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 192
1091769958_1091769964 9 Left 1091769958 12:3145103-3145125 CCCACTCCCTTGTGAGCACACAG 0: 1
1: 1
2: 1
3: 57
4: 752
Right 1091769964 12:3145135-3145157 CAGCCCTCGGCGTCCTCTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091769958 Original CRISPR CTGTGTGCTCACAAGGGAGT GGG (reversed) Intronic
900689961 1:3974573-3974595 CTGTGTGCTGAGCAGGCAGTGGG + Intergenic
900972719 1:6000424-6000446 CTTCGTGCTTACAAGGCAGTGGG + Intronic
901627234 1:10631222-10631244 CTGTGTGGACACAAGGGCTTCGG + Intergenic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
902677433 1:18018519-18018541 CTGTGTGCTCTGCAGGGTGTCGG - Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
903985264 1:27222886-27222908 CTGTGTCCTCACATGGCAGTAGG + Intergenic
904309614 1:29620343-29620365 CTTTGTGCTCATAAGGGATGAGG - Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
904407510 1:30302650-30302672 CTGTGTCCTCATAGGGGAGGGGG - Intergenic
904889665 1:33770439-33770461 CTGGGTACTCAGTAGGGAGTGGG + Intronic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905319398 1:37105224-37105246 CAGTGTGCTCAAGAGAGAGTGGG + Intergenic
905443527 1:38009545-38009567 CTGTGTTCTCACTAGGGGGAAGG - Intronic
905664544 1:39755035-39755057 CTGTGAGCTCAGCAGGGGGTGGG - Intronic
906656763 1:47553967-47553989 CAGTGTGGTCGCAAGAGAGTGGG + Intergenic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
906882776 1:49610649-49610671 CTGTATCCTCACAGGGGAGAAGG - Intronic
906935565 1:50211346-50211368 CTGTGTCCTCACATGGTAGAAGG + Intergenic
907021056 1:51067119-51067141 CTGTGTGCACCCTAGGGACTTGG - Intergenic
907271928 1:53296367-53296389 CTGGGTGCACAGAAGGGACTTGG + Intronic
907397507 1:54201420-54201442 CAGTGTCCTTACAAGGTAGTGGG + Intronic
907811227 1:57872354-57872376 CTGTGTCCTCACGTGGGAGAAGG - Intronic
907883858 1:58576039-58576061 GTGTGTGCGCAAAAGGGAGGGGG + Exonic
907964166 1:59313130-59313152 CTGTGTCCTCACATGGTAGAAGG + Intronic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908719403 1:67108298-67108320 CTGTGTCCTCACATGGGAGAAGG + Intronic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909239122 1:73190527-73190549 CTATGTCCTCACATGGGAGAAGG + Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909878833 1:80847465-80847487 CTGTGTACTCACATGGCAGAAGG + Intergenic
910253481 1:85222517-85222539 CTGTGTCCTCACATGGTAGATGG + Intergenic
910437938 1:87224752-87224774 CTCTGTGCTCAGAAGGGCCTTGG + Intergenic
910544641 1:88400110-88400132 CTGTGTCCTCACATGGTAGAAGG + Intergenic
911378033 1:97075628-97075650 CTGTGTCCTCACATGGTAGAGGG - Intergenic
912406986 1:109447598-109447620 CTGGGTGGTAAAAAGGGAGTGGG + Intergenic
912453050 1:109779136-109779158 CTGTGTCCTCACATGGTAGAAGG + Intergenic
912667607 1:111596736-111596758 CTGTGTCCTCACATGGTAGAAGG + Intronic
913050293 1:115111664-115111686 CTGTGTCCTCACATGGTAGAAGG - Intergenic
913353383 1:117888283-117888305 ATGTGGGATCACAAAGGAGTTGG + Intronic
915663147 1:157420250-157420272 CTGTGTCCTCACATGGTAGAAGG - Intergenic
915822219 1:159036828-159036850 CTGTGTGGTCACAGTGCAGTTGG - Intronic
916882591 1:169034354-169034376 TTGTGTCCTCACATGGGAGAAGG + Intergenic
917082616 1:171272086-171272108 CTGTGTGCAGCCAAGGGACTTGG + Intronic
917253268 1:173086451-173086473 CTGTGTCCTCACAAGCAAGAAGG + Intergenic
918119643 1:181527255-181527277 CTGTGTCCTCACATGGTAGAAGG + Intronic
918507935 1:185278314-185278336 CTGTGTTCTCACATGGCAGAAGG - Intronic
918841332 1:189543357-189543379 ATGTGTGCCCACAAAGGAGCAGG + Intergenic
918961136 1:191279682-191279704 CTGTGTTCTCACATGGCAGAAGG + Intergenic
919360758 1:196591180-196591202 CTCTGAGTTCACAAGAGAGTTGG + Intronic
919454628 1:197806588-197806610 CTGTGTCCTCACATGGCAGCAGG + Intergenic
919462446 1:197894006-197894028 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920724990 1:208426708-208426730 CTGTGTCCTCACATGGTAGAAGG + Intergenic
920839005 1:209538129-209538151 CTGTGTGCTCCCTCGGGAGAAGG - Intergenic
921685563 1:218085262-218085284 AGGTGTGCTATCAAGGGAGTGGG - Intergenic
921773534 1:219071433-219071455 CTGTGTGCACCCTAGGGACTTGG + Intergenic
922466160 1:225846597-225846619 GTGTGTGCTCAGAAGGGAGGAGG + Exonic
922527059 1:226312081-226312103 CTGTGTCCTCACATGGTAGAAGG + Intergenic
922610748 1:226925229-226925251 CTGTATACTCACAAGGAAGTGGG + Intronic
923068048 1:230538256-230538278 CTGTGTTCTCACATGGTAGAAGG + Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923790549 1:237107701-237107723 TTGTGTGGTCACAAAGGTGTAGG + Intronic
923800550 1:237204987-237205009 CTGTGTCCTCTCAGGGCAGTGGG - Intronic
924187594 1:241511227-241511249 CTGTGTCCTCACATGGTAGAAGG - Intronic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063108171 10:3012007-3012029 CTGTGTCCTCACATGGTAGATGG - Intergenic
1063133621 10:3198488-3198510 CTGTATCCTCACATGGGGGTGGG + Intergenic
1063337370 10:5229066-5229088 ATGTGTGCTGAGAAGGGAGGTGG + Intergenic
1063388512 10:5632607-5632629 CTCTGTGCTGACAAGTGACTTGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063962514 10:11318768-11318790 CTGTGTACAGAGAAGGGAGTTGG + Intronic
1064934087 10:20660694-20660716 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065327466 10:24561481-24561503 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1065460343 10:25956070-25956092 CTGTGTTCTCACATGGCAGAAGG + Intronic
1065774093 10:29103223-29103245 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1067911422 10:50350579-50350601 CTGTGTGCAGACTAGGGACTTGG + Intronic
1068153121 10:53160021-53160043 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1068519499 10:58062998-58063020 CTGTGTGCACCCTAGGGACTCGG - Intergenic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069747549 10:70725559-70725581 CTGTGTCCTCACATGGTAGAAGG + Intronic
1070706698 10:78644827-78644849 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1071688769 10:87792900-87792922 CTGAGGGCTCACAATGGAGAAGG - Intronic
1071924947 10:90395443-90395465 CTGTTTCCTCACATGGCAGTGGG + Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072200838 10:93157434-93157456 ATGTGTGGTCACAAGAGAGCAGG + Intergenic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072603833 10:96960207-96960229 CTGTGTGCTTACTTGGGGGTAGG - Intronic
1072627437 10:97122099-97122121 CTCTGTCCTCACGAGGGAGCTGG - Intronic
1073153410 10:101327686-101327708 CTGTGTGCAGACTAGGGATTTGG + Intergenic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073789203 10:106922602-106922624 CTGTGTGTGTACAAGGGAGGGGG - Intronic
1073817590 10:107224502-107224524 CTGTGTGCACTCTAGGGATTTGG - Intergenic
1073821611 10:107270873-107270895 CTGTGTTCTCACATGGGAGAAGG + Intergenic
1074034363 10:109723479-109723501 CTGAGTGCTCACCAGGCAGCAGG + Intergenic
1074532865 10:114309006-114309028 CAGTCTGCTCACAGGGGTGTTGG + Intronic
1075089411 10:119435088-119435110 CTGTGTGCAGCCAAGGGACTTGG - Intronic
1075098264 10:119487924-119487946 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1076002562 10:126923860-126923882 CTGTGTCCTCACAGGGTAGAAGG - Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1078412696 11:11140439-11140461 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1078891547 11:15562470-15562492 ATGTATGCTCACAAGGTACTAGG - Intergenic
1079837248 11:25350345-25350367 CTGGGGGCTCACAAGGAAGGAGG + Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080715650 11:34797492-34797514 CTGTGTGCTGCCTAGGGACTTGG + Intergenic
1081142022 11:39513253-39513275 TTGTGTTCTCACAAGGCAGAAGG + Intergenic
1081150453 11:39622916-39622938 TTGTGTGCTCACATGGTAGAAGG + Intergenic
1081348302 11:42017669-42017691 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082114312 11:48311586-48311608 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082268262 11:50142811-50142833 CTGTGTGCAGCCTAGGGAGTTGG + Intergenic
1082287812 11:50335704-50335726 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1083224095 11:61273784-61273806 CTCTCTGCTCCCCAGGGAGTGGG - Intronic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084331910 11:68435553-68435575 CTGTGAGTTCACATGGGAGCTGG - Intronic
1084554543 11:69868130-69868152 CTGGGTGCCCACAAGGGCCTGGG - Intergenic
1084788129 11:71455629-71455651 CTGTGTCCTCACATGGTAGAAGG - Intronic
1085707147 11:78796576-78796598 CTGTATGCTGACAATAGAGTAGG + Intronic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1086388569 11:86336480-86336502 CTGTGTTCTCACGTGGTAGTAGG - Intronic
1087238201 11:95744696-95744718 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088120882 11:106367854-106367876 CTCTGTGTTCAGAAGAGAGTAGG + Intergenic
1088324193 11:108585453-108585475 CTGTGTCCTCACATGGTAGAAGG - Intronic
1088435261 11:109805073-109805095 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1090961885 11:131564407-131564429 CTGTGTGCTCACATAGTAGAGGG + Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1091958260 12:4667108-4667130 CTGTGTGCTCACATGGTGGAAGG + Intronic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093973914 12:25400640-25400662 CTGTGTGCAGTCTAGGGAGTTGG + Intergenic
1094027422 12:25973746-25973768 CTGTGTCCTCACATGGTAGAAGG - Intronic
1094083109 12:26559460-26559482 CTGTGTCCTCACATGGTAGAAGG + Intronic
1094762555 12:33551245-33551267 CTGTGTGCACTCTAGGGACTTGG + Intergenic
1095131612 12:38549198-38549220 CTGTGTGCAGTCTAGGGAGTTGG - Intergenic
1095825348 12:46525019-46525041 CTCTGTTCTGACAAGGGAGGTGG + Intergenic
1096063349 12:48720299-48720321 CTGTGTGCCACCTAGGGAGTTGG - Intergenic
1096727507 12:53576533-53576555 CTGTGTCCTCACATGGCAGTTGG - Intronic
1097325553 12:58272418-58272440 CTGTGTCCTCACATGGCAGTAGG + Intergenic
1097424562 12:59427523-59427545 CTGTGTCCTCACATGGGAGAAGG + Intergenic
1097905908 12:64919569-64919591 CTGTGTGCTCACACGGTGGAAGG + Intergenic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098345385 12:69497444-69497466 CTGTGTCCTCACATGGTAGAGGG + Intronic
1098535780 12:71592183-71592205 ATGTGTGCTCACATGGTAGAAGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099744097 12:86679683-86679705 CTGTGTCCTCACATGGTAGAAGG - Intronic
1100610094 12:96184704-96184726 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100759040 12:97785941-97785963 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1100854397 12:98746065-98746087 CTGTGTGCTCACAAGGGCAAGGG - Intronic
1102248910 12:111372482-111372504 CTGTGTGCATCCTAGGGAGTTGG - Intergenic
1102410679 12:112715639-112715661 CTGTGAGCTCACCATGTAGTTGG - Intronic
1103588402 12:121973118-121973140 CTGTGTGCTGCCTAGGGACTTGG + Intronic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1106932440 13:34681391-34681413 GTGTGTGCTCACAAGAGCCTTGG + Intergenic
1106933478 13:34692535-34692557 CTGTGTCCTCACAAGGAGGCAGG + Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107406199 13:40116072-40116094 CTACGTTTTCACAAGGGAGTTGG + Intergenic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107872292 13:44758670-44758692 GTGTGTGCACACAAAGGAGAGGG + Intergenic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1108374185 13:49797973-49797995 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1108374190 13:49798004-49798026 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109641940 13:65202722-65202744 CTGTGTGCTGTCTAGGGACTTGG + Intergenic
1109732656 13:66436303-66436325 CTGTGTCTTCACAAGGCAGAAGG - Intronic
1109874259 13:68378754-68378776 CTGTGTACTCACATGGCAGAAGG + Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110157037 13:72329920-72329942 CTGTGTCCTCACAAGGCAGAAGG + Intergenic
1110797380 13:79655960-79655982 CTGTGTGCTCCCTTGGGAATTGG - Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1112751565 13:102588834-102588856 CTGTGTCCTCACAGGGGAAGGGG - Intergenic
1112764259 13:102724001-102724023 CTGTGTGCTCACACGGTGGAAGG - Intergenic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1113492576 13:110704003-110704025 CTGTGTCCTCACATGGTAGAAGG - Intronic
1113501539 13:110779355-110779377 CTGTGTGCTCACATGGTGGAAGG + Intergenic
1113601962 13:111575840-111575862 CTGTGTCCTCATATGGGGGTAGG + Intergenic
1114250008 14:20951228-20951250 CTGTGTGCTCAAAATGCAATGGG + Intergenic
1114260001 14:21029756-21029778 CTGTGTCCTCACATGGTAGAAGG - Intronic
1114622259 14:24103277-24103299 CTGTGTGCACACACAGGAGAGGG - Intronic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1114838357 14:26232027-26232049 CTGTGTCCTCACATGGTAGATGG - Intergenic
1115030085 14:28784770-28784792 CTGTATGTTCCCAAAGGAGTGGG - Intronic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115929735 14:38477883-38477905 CTGTGTGCTGCCTAGGGACTTGG + Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118460054 14:65979446-65979468 CTGTGTGCTACCTAGGGACTTGG + Intronic
1119474512 14:74919437-74919459 GTGTGTGCACACAAGGGTGTCGG + Intronic
1119537262 14:75412628-75412650 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1119620700 14:76130004-76130026 CTGTGCCCTCACAAGGTAGAAGG + Intergenic
1119643138 14:76329656-76329678 GTGTGTGCCCACAAGGGTGGTGG - Intronic
1119894714 14:78210259-78210281 ATGTGTGCTCACATGGCAGAAGG + Intergenic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120671463 14:87367058-87367080 CTGTGTCCTCACAAGGTAGAAGG + Intergenic
1120924567 14:89784762-89784784 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1121428517 14:93870915-93870937 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1121464499 14:94106113-94106135 CTGTGTCCTCACATGGTAGTGGG + Intronic
1122281560 14:100625832-100625854 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122419998 14:101569929-101569951 CTCTGTGTACACAGGGGAGTGGG - Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1123574757 15:21655911-21655933 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1123611372 15:22098407-22098429 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1123744738 15:23311164-23311186 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1124670399 15:31633828-31633850 CTGTGTGCTCGCTAGCGGGTGGG - Intronic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1126777740 15:52113603-52113625 CTGTGTCCTCACATTGCAGTAGG + Intergenic
1127161026 15:56186259-56186281 CTGTGCCCTCACAAAGTAGTTGG - Intronic
1127726311 15:61753504-61753526 CTGTGTTCTCACAATGGGGCTGG + Intergenic
1127795233 15:62432384-62432406 CTGTGTCCTCACATGGTAGAAGG + Intronic
1127955173 15:63847077-63847099 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
1128301624 15:66569748-66569770 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1128495321 15:68194987-68195009 CTGTGAGCTCTCAACAGAGTTGG - Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129685290 15:77682676-77682698 CTTTGTGCCCAGAAGGGGGTGGG - Intronic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1130025930 15:80270449-80270471 CTCTGTGCTCACCAGGGTGGTGG - Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130679269 15:85981967-85981989 CTGTGTGTCCACAACGGAGGAGG + Intergenic
1131539952 15:93267656-93267678 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1131975289 15:97939759-97939781 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1202983624 15_KI270727v1_random:390163-390185 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1132744000 16:1429189-1429211 CTGTGAGCTCACCGGGGCGTCGG + Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133915374 16:10104842-10104864 CTCTGCGCTCACAAGGGACATGG - Intronic
1134310229 16:13069848-13069870 CTGTGTCCTCACAGGGCAGAAGG - Intronic
1134660615 16:15981587-15981609 CTGTGTGCTGCCTAGGGAGTTGG - Intronic
1135279682 16:21143376-21143398 CTGCATGCTCACATGGGAGAAGG - Intronic
1135815010 16:25624448-25624470 TTGTATGCTCACCAAGGAGTGGG + Intergenic
1135871881 16:26158760-26158782 CAGTGTGGTCAGAAGGGACTGGG - Intergenic
1136705052 16:32180373-32180395 TTCTGTGCTGACAAGGAAGTCGG + Intergenic
1136762859 16:32749032-32749054 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1136805241 16:33121354-33121376 TTCTGTGCTGACAAGGAAGTCGG + Intergenic
1137266307 16:46871699-46871721 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1137431963 16:48425883-48425905 CTGGGTCCTGACCAGGGAGTGGG - Intronic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139113432 16:63919891-63919913 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1139850780 16:69950749-69950771 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139879764 16:70173661-70173683 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1140372760 16:74421887-74421909 CTGTGGGCTCAAAGGGGGGTGGG + Intronic
1140644417 16:77013821-77013843 CTGTTTGATCACAAGGGAACAGG + Intergenic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1203065013 16_KI270728v1_random:1009352-1009374 TTCTGTGCTGACAAGGAAGTCGG - Intergenic
1142507276 17:372534-372556 CTGTGTCCTCACATGGCAGGAGG - Intronic
1143454339 17:7056416-7056438 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
1144382490 17:14716478-14716500 CTGTGTTCTCACATGGTAGACGG + Intergenic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1144834302 17:18148898-18148920 CTCTGTGCCCACAATGAAGTAGG - Exonic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1145881348 17:28354946-28354968 CTGTGTGCCTACAATGGACTAGG - Intronic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1147479149 17:40742434-40742456 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1149902342 17:60492019-60492041 CTGTGTGCAGACTAGGGACTTGG + Intronic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150943057 17:69714233-69714255 CTGTGTTCTTCCAAGAGAGTTGG - Intergenic
1151532797 17:74717867-74717889 CTGTGTCCTCACATGGTAGAAGG - Intronic
1151907515 17:77058328-77058350 CTGTGTGTTCACAATGGTGTAGG + Intergenic
1151972102 17:77463302-77463324 CTGTGTGCTCTGATGGGGGTGGG - Intronic
1152521517 17:80859366-80859388 GTGTGTGCTGAGAATGGAGTTGG + Intronic
1153011970 18:547503-547525 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1155199996 18:23508754-23508776 CTGTCTGCCCTCAAGCGAGTCGG + Intronic
1155343947 18:24840104-24840126 CTGTGTCCTCACACGGTAGGAGG - Intergenic
1155740744 18:29284902-29284924 CTGTGTCCTCACAAGGGTGAAGG - Intergenic
1156081395 18:33340606-33340628 CTGTGTGCAGCCTAGGGAGTTGG + Intronic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1156950687 18:42893421-42893443 CTGTGTCCTCAAAAGGCAGAAGG + Intronic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157436885 18:47677890-47677912 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158094509 18:53755524-53755546 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158638182 18:59179607-59179629 CTGTGTCCTCACAGGGTAGAAGG + Intergenic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1159106346 18:64005518-64005540 CTGTGTACTCACATGGCAGAGGG - Intronic
1159240307 18:65734114-65734136 CTGAGTGCTCACAAAATAGTAGG + Intergenic
1159536961 18:69726787-69726809 CTGTGTCCTCACATGGTAGATGG + Intronic
1160132655 18:76242151-76242173 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1160340713 18:78086732-78086754 CTGGGTGTTCACAAGGGAGCTGG + Intergenic
1160348480 18:78153879-78153901 CTGTGTTCTCACATGGCAGGAGG + Intergenic
1161960085 19:7518302-7518324 GTGTATGCTCAGAAGTGAGTGGG + Intronic
1162665447 19:12206692-12206714 CTGTCTGCACACTAGGTAGTAGG + Intergenic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1164883277 19:31754619-31754641 CTGTGTGTTCACATGAGAGCTGG - Intergenic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1166993691 19:46708649-46708671 CTGTGCGCTCACATGGGACACGG - Intronic
1167800147 19:51735382-51735404 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
1168269455 19:55241682-55241704 CTGTGCGCCCACACAGGAGTAGG + Intronic
1168413180 19:56152761-56152783 CTGTGTCCTCACAGGGCAGAAGG + Intronic
924980815 2:219454-219476 CTGTGTCCTCACAAGGAGGAAGG - Intronic
925179944 2:1811053-1811075 CTCTGTCCTCACATGGGAGAAGG - Intronic
925353857 2:3223449-3223471 CTGTGTGCTGACGAAGGAGGAGG + Intronic
925556054 2:5132677-5132699 CTGTGTCCTCACATGGGGGAAGG - Intergenic
925827302 2:7862142-7862164 CTGAGTTCTCACAAGAGTGTTGG + Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926378455 2:12259711-12259733 CTGTGAAATCACCAGGGAGTTGG + Intergenic
926498078 2:13616587-13616609 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
926870202 2:17407821-17407843 CTGTGTGCACCCTAGGGACTTGG + Intergenic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929446295 2:42003957-42003979 CTGTGTGCTCACATGGGAAGGGG + Intergenic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
930250490 2:49029232-49029254 ATGTGTGCTCACAAGAGGGAAGG - Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930866166 2:56123948-56123970 CTGTGTCCTCACAAGGCACAGGG + Intergenic
931027127 2:58123212-58123234 TTGGATGCCCACAAGGGAGTAGG + Exonic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
932516777 2:72359356-72359378 CTGTGATCTCACAAGGTAGAAGG - Intronic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933980946 2:87550286-87550308 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
934539349 2:95161057-95161079 CTGTGTCCTCACATGGCAGGAGG - Intronic
934546739 2:95224016-95224038 TTGTGTCCTCACAAGGGAGAAGG - Intronic
935196840 2:100820939-100820961 CTGTCTGCGCACACGGGGGTTGG - Intronic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935689837 2:105721033-105721055 CTGTGTGCTCACAGGGCAGAAGG + Intergenic
935707519 2:105869953-105869975 CTGCCTGCTCACAAAGGAATGGG + Intronic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935948931 2:108311696-108311718 CTGTGTGCACCCTAGGGACTTGG + Intergenic
936311444 2:111388383-111388405 CTGTGTCCTCACATGGTAGAGGG - Intergenic
936312884 2:111400499-111400521 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937594501 2:123657633-123657655 CCATGTGCTCACATGGCAGTAGG + Intergenic
937610329 2:123853390-123853412 CTTTGTGGTCAGAAGGCAGTGGG + Intergenic
937782881 2:125859482-125859504 CTGTGTCCTCACATGGTAGAAGG + Intergenic
938318716 2:130347666-130347688 CTGTGTCCTCACATGGCAGGAGG - Intronic
938340143 2:130530423-130530445 CTGAGTGCTGCCAAGTGAGTGGG + Intergenic
938349693 2:130590325-130590347 CTGAGTGCTGCCAAGTGAGTGGG - Intergenic
938775422 2:134537408-134537430 CTGTGTCCTTACAAGGCAGGGGG + Intronic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939271073 2:139940415-139940437 CTGGGTGCTCACAAGGCAGATGG + Intergenic
939740684 2:145902176-145902198 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
939839515 2:147170121-147170143 CTGTGTTCTCACATGGCAGAAGG - Intergenic
939903394 2:147879305-147879327 CTGTGTCCTCACAGGGCAGAGGG + Intronic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940613173 2:156016328-156016350 CTGTGTCCTCACAAGGTAGGGGG + Intergenic
940669655 2:156651230-156651252 CTGTGTTCTCACATGGCAGAAGG + Intergenic
940734079 2:157429255-157429277 CTGAGTGCTCACAATGGGCTTGG - Intronic
942458262 2:176152243-176152265 CTGTGGGCGCAAAAGGGGGTGGG + Intronic
942855653 2:180543965-180543987 CTGTGTTCTCACATGGTAGAAGG - Intergenic
943101954 2:183497662-183497684 CTGTGAGCTCACATGGTAGAAGG - Intergenic
943491337 2:188559203-188559225 CTGTGTGTACCCTAGGGAGTTGG + Intronic
943659397 2:190542181-190542203 ATGTGTGTTCAAGAGGGAGTTGG - Intergenic
943818899 2:192293158-192293180 CTGTGTCCTCACATGGTAGAAGG + Intergenic
944384336 2:199147884-199147906 CTGTGTCCTCACATGGTAGAAGG - Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
944638773 2:201700720-201700742 CTGTATGCTCACCACGGTGTAGG + Exonic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
945971502 2:216235657-216235679 GTGTGTTCACACAAGGGAGGAGG + Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946866738 2:224047657-224047679 CTGTGTCCTCACATGGCAGGAGG - Intergenic
947054450 2:226084765-226084787 CTGTGTGCCCCCTAGGGACTTGG - Intergenic
947471367 2:230404102-230404124 GGGTTTGCTCAGAAGGGAGTGGG - Intergenic
947570162 2:231227670-231227692 CTGTTTGCTCACCAGGGAGTTGG + Intronic
947845134 2:233237701-233237723 CTGTGTCCTCACATGGTAGGAGG + Intronic
948003221 2:234585672-234585694 CTGAGTGCTCACCGGGGAGATGG - Intergenic
948035349 2:234853891-234853913 CTGTGTGCTCACGTGGTAGAGGG + Intergenic
948417091 2:237816660-237816682 CTGTGTCCTCACATGAGAGAAGG + Intronic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
948978523 2:241479754-241479776 CTGTGGGCTCACGGGGGAGCTGG + Intronic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169331398 20:4719302-4719324 CTGTGTGCCCACATGGCAGAAGG + Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1170313542 20:15017854-15017876 CTGTGTGCACCCTAGGGACTTGG - Intronic
1170435932 20:16328797-16328819 CTGTGTTCTCACATGGCAGGAGG + Intronic
1171031311 20:21679288-21679310 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1171487919 20:25497227-25497249 CTGTGTGCTCACTAGCGTGCTGG - Intronic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1171950862 20:31420530-31420552 CTGTGTCCTCACATGGGGGAAGG + Intergenic
1172380179 20:34483072-34483094 CTGTGTGCACTCTAGGGACTTGG - Intronic
1172602712 20:36194996-36195018 CCCTGTGCTCACAAGGTAGACGG - Intronic
1173295424 20:41751140-41751162 CTATGTGCTCACATAGGAGAAGG - Intergenic
1173844381 20:46178725-46178747 CTGGGTCCTCAGAAGGGACTGGG + Intronic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1174059631 20:47823543-47823565 CTGACTGTTCACAAGGGAGGAGG - Intergenic
1174420865 20:50398559-50398581 CTCTGTTGTCATAAGGGAGTCGG - Intergenic
1175008462 20:55710687-55710709 CTGTGTGCAGCCTAGGGAGTTGG + Intergenic
1175167402 20:57054551-57054573 CTTTGTGCTCACAACAGACTGGG - Intergenic
1175195404 20:57239869-57239891 CTGTGTGCACCCTAGGGACTTGG - Intronic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176132300 20:63501359-63501381 CTGTGTCCTCACATGGGAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177118179 21:17110229-17110251 CTGTGTGCCGCCTAGGGAGTTGG - Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177285188 21:19040490-19040512 CTGTGTGCTGCCTAGGGACTTGG - Intergenic
1177394847 21:20520445-20520467 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1177802355 21:25840372-25840394 TTGTGTGCTCACATGGTAGAAGG + Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178328337 21:31663586-31663608 CTGTGTCCTCAAAAGGGAGATGG - Intronic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1178494454 21:33075285-33075307 CTTTCTGCTCACACGGGATTAGG + Intergenic
1178905733 21:36634524-36634546 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179316451 21:40248086-40248108 CTGTGTGCAGCCTAGGGAGTTGG - Intronic
1179503279 21:41823085-41823107 CTGTGTCCTCACATGGTAGAAGG - Intronic
1182551265 22:31102020-31102042 CTGTGTGGGCACTGGGGAGTTGG + Intronic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1183047017 22:35228422-35228444 CTGTGTCCTCACAAGACAGAGGG - Intergenic
1183112488 22:35660721-35660743 CTGTGTTCTCACATGGCAGAAGG + Exonic
1183758252 22:39790821-39790843 CTGCTTCCCCACAAGGGAGTTGG + Intronic
1184311903 22:43651231-43651253 CTGTGTGCAGACTAGGGACTTGG + Intronic
1184456689 22:44614905-44614927 CTGGGTCCTCACAAGGGAGAGGG - Intergenic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1184832280 22:46996369-46996391 CTGTGTGCTCACTAAAGAGTTGG + Intronic
950531742 3:13556299-13556321 CTGTGTCCTCACAAGGTGGGGGG + Intronic
950635599 3:14312187-14312209 GTGGGGGCACACAAGGGAGTAGG + Intergenic
950832463 3:15888208-15888230 CTGTGTTCTCACATGGTAGAAGG - Intergenic
951480231 3:23153106-23153128 CTGTGTCCTCACATGGTAGAAGG + Intergenic
951626317 3:24667652-24667674 CTGTGTTCTCACATGGCAGAAGG - Intergenic
951889985 3:27559507-27559529 CTGTGTTCTCACATGGCAGGGGG + Intergenic
952004036 3:28821845-28821867 CTGTGTCCTCACATGGCAATAGG + Intergenic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
952029083 3:29119745-29119767 CTGTGTGCACCCTAGGGATTTGG + Intergenic
952127629 3:30320534-30320556 ATGCGTGTACACAAGGGAGTGGG - Intergenic
953145372 3:40270077-40270099 CTGTGTCCTCACACGGCAGAAGG + Intergenic
953156788 3:40382760-40382782 CTGTGTGCCCCCATGGCAGTGGG - Intergenic
953274153 3:41478438-41478460 CTGTGGGCTCAGAAGGGAGCTGG - Intronic
953747784 3:45588167-45588189 CTGTGTCCTCACATGGTAGAAGG - Intronic
954591539 3:51787763-51787785 CTGTGTGCACCCTAGGGACTTGG + Intergenic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
955307166 3:57845334-57845356 ATGGGTGCTCAGAAGGGAGGTGG + Intronic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956474928 3:69609870-69609892 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
956474934 3:69609901-69609923 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
956564970 3:70625994-70626016 CTGTGTCCTCACATGGTAGAAGG - Intergenic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
958060567 3:88474416-88474438 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958189395 3:90165586-90165608 CTGTGTCCTCACATGGTAGAAGG + Intergenic
958550614 3:95607423-95607445 CTGTGTGCACCCCAGGGACTTGG - Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
958888804 3:99760179-99760201 CACTGTGCTCATGAGGGAGTTGG + Intronic
959104582 3:102051571-102051593 CTGTGTACTCCCTAGGGACTTGG + Intergenic
959383311 3:105669335-105669357 CTGTGTCCTCACAAGGGCAAGGG - Intronic
959424795 3:106173760-106173782 TTGTGTGCTTACAAAGGAATTGG + Intergenic
960241115 3:115343198-115343220 CTGTGTCCTCACACGGCAGAAGG - Intergenic
960356429 3:116659209-116659231 CTGTGTCCTCACATGGGAGGTGG - Intronic
960812455 3:121637585-121637607 CTATGTGCTTATATGGGAGTAGG - Intronic
962374100 3:134846173-134846195 CTGTGTGTTCACCAGGCACTAGG + Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
963071067 3:141305733-141305755 CTGTGTCCACACATGGGGGTGGG - Intergenic
963261575 3:143197129-143197151 CTGTGTCCTCACACGGCAGAAGG - Intergenic
963422115 3:145073510-145073532 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
963847379 3:150172859-150172881 CTGTGTCCTCACAGGGCAGAAGG - Intergenic
963896783 3:150694968-150694990 CTGTGTCCTCACATGGTAGAAGG + Intronic
963908427 3:150793774-150793796 CTGTGTCCTCACATGGTAGAAGG - Intergenic
964414203 3:156430578-156430600 CTGTTTTCTCACAATGGAGCTGG - Intronic
964855250 3:161139410-161139432 CTGTCTGGTCCCAAGGGATTTGG + Intronic
964873844 3:161343319-161343341 TTGTGTGGTCACAAGGTAGAAGG + Intergenic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
965688253 3:171328189-171328211 CTGTGTCCTCACAAGGGTAATGG - Intronic
966226698 3:177605515-177605537 CTGTGTCCTCACATGGTAGAAGG - Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
967959754 3:194911067-194911089 CTGTGTCCTCACATGGCAGGAGG + Intergenic
968497259 4:925713-925735 CTGTGTCCTCACAGGGCAGAAGG - Intronic
969081367 4:4621173-4621195 CTGTGTTCTCACATGGCAGAAGG + Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
970871282 4:20819775-20819797 CTGTGTCCTCACATGGTAGAAGG - Intronic
970918662 4:21367035-21367057 CTGTGTCCTCACATGGCAGGAGG - Intronic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971046322 4:22809053-22809075 CTGAGTGCCCACAAATGAGTTGG - Intergenic
971476844 4:27080582-27080604 GGGTGTGCTCACAAGAGAGTGGG - Intergenic
971815022 4:31476512-31476534 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
972142307 4:35976089-35976111 CTGTGTTCTCACATGGCAGAAGG + Intronic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972263601 4:37437309-37437331 CTGTGTCCTCACAGGGCAGGAGG + Intronic
972803758 4:42506310-42506332 CTGTGTTCTCACATGGTAGAAGG - Intronic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973576400 4:52294165-52294187 CTGTGTCCTCACAAGGTGGAAGG + Intergenic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974610598 4:64210401-64210423 CTGTGTGCTCACATGGTGGAAGG - Intergenic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
975626016 4:76348077-76348099 ATGTGTCCTCACATGGGAGAAGG + Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976074682 4:81284411-81284433 CTGTGTCCTCACACGGCAGAAGG + Intergenic
977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG + Intergenic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
978153392 4:105463668-105463690 CTGTGTGCAGCCTAGGGAGTTGG + Intronic
978964446 4:114724604-114724626 CTGTGTTCTCACATGGCAGAAGG - Intergenic
978997227 4:115171848-115171870 CCATGTGCTCACAAGTGAGTTGG + Intergenic
979071220 4:116209140-116209162 CTGTGTTCTCACATGGTAGAAGG - Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979390144 4:120118148-120118170 CTGTGTGCAGACTAGGGACTTGG - Intergenic
979824011 4:125210619-125210641 CTGTGTCATCACATGGGAGACGG + Intergenic
980257005 4:130394630-130394652 CTGTCTAGTCACAAGGGAGAAGG + Intergenic
980535194 4:134111166-134111188 CTGTGTCTTCACAAGGCAGAAGG + Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981244006 4:142513363-142513385 CTGTGTCCTCACATGGTAGGAGG + Intronic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981466136 4:145075032-145075054 GGATGTGCTCAGAAGGGAGTAGG - Intronic
981605806 4:146538862-146538884 CTGTGTTCTCACGTGGGAGAAGG + Intergenic
982019626 4:151190494-151190516 CTGTGTGCACTCTAGGGACTTGG + Intronic
982430312 4:155315083-155315105 CTGTGTGCTACCTAGGGACTTGG + Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983337531 4:166415988-166416010 CTGTGTGCTGCCTAGGGAGTTGG - Intergenic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
984232124 4:177112209-177112231 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
984305414 4:177983193-177983215 CTGTGTCCTCACAGGGCAGAAGG - Intronic
984327137 4:178269025-178269047 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
984399516 4:179243900-179243922 CTGTGTCCTCACATGGTAGGAGG + Intergenic
984523760 4:180831680-180831702 CTGTGTCCTCACATGGGGGAAGG + Intergenic
984678369 4:182577236-182577258 CTGTATGCTCAAAAGCGAGGAGG + Intronic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
985231407 4:187821864-187821886 CTGTGTACTCACAAGGCAAAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985382829 4:189413648-189413670 CTGTGTGCTCCCCTGGGATTAGG + Intergenic
985382844 4:189413737-189413759 CTGTGTGCTCCCCTGGGATTAGG + Intergenic
985382859 4:189413826-189413848 CTGTGTGTTCCCCAGGGATTAGG + Intergenic
985394280 4:189525524-189525546 CTGTGTGCACCCTAGGGACTTGG + Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
986575921 5:9213049-9213071 CTGTGTCCTCACAAGGTGGGAGG + Intronic
986729577 5:10625340-10625362 CTGAGTGCTGATAAGGGAGCTGG - Intronic
987582979 5:19820155-19820177 TTGTGTGCTGGCATGGGAGTTGG + Intronic
987824319 5:23008707-23008729 ATGTGTTCTCACATGGGAGAAGG - Intergenic
988103136 5:26708175-26708197 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988426877 5:31074475-31074497 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
988649393 5:33131696-33131718 CTGTGTGCAGACTAGGGACTTGG + Intergenic
989287079 5:39713635-39713657 TTGTGGCCTCACAAGAGAGTTGG + Intergenic
989503952 5:42203506-42203528 CTGTGTCCTCACATGGTAGAAGG - Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990428014 5:55707915-55707937 CTGTGTCCTCACATGGGGGAAGG - Intronic
990697283 5:58434316-58434338 CTGTGTCCTCACATGGTAGAAGG - Intergenic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992673673 5:79084211-79084233 CTGTGTCCTCACATGGTAGATGG + Intronic
992810439 5:80382409-80382431 CTGTGTTCTCACATGGCAGAAGG + Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993342240 5:86738905-86738927 CTCAGTGCTCACAAGGGTCTAGG + Intergenic
994252917 5:97557811-97557833 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994810229 5:104507871-104507893 CTGTGTCCTCACATGGTAGAAGG - Intergenic
995490302 5:112684101-112684123 CTGTGTGGACACCAGGGAGATGG - Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
996214351 5:120848961-120848983 CTGTGTGCTGTCTAGGGACTTGG - Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
997092940 5:130878392-130878414 CTGTGTGCAACCAAGGGACTTGG + Intergenic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997492050 5:134285507-134285529 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
997849258 5:137316160-137316182 CTGTGTGCTCACATGGTGGAAGG + Intronic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
999939510 5:156526418-156526440 CAGTGTGTTCACTTGGGAGTTGG - Intronic
1000284083 5:159811528-159811550 CTGTGTGCTCACATGGTGGAAGG - Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001648334 5:173298339-173298361 CTGTGGGCTCGCAAGAGAGCAGG - Intergenic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1001923091 5:175616193-175616215 CTGTGTGCTGATGAGGGTGTGGG - Intergenic
1002050077 5:176565593-176565615 GTGTGTGCTCCCAGGGGAGCAGG + Intronic
1002055459 5:176595882-176595904 CTGAGTGGTCACAAGGGACTTGG + Exonic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1003094821 6:3133739-3133761 CTGTGTGCTCACACGGGCAGTGG - Intronic
1003183467 6:3811140-3811162 GTGTGTCCTCACATGGGAGAAGG - Intergenic
1003610114 6:7605571-7605593 CTGTGTGCTATCAAGGGTTTTGG - Intronic
1003735029 6:8868626-8868648 CTGAGTGCTTACAAAGTAGTAGG + Intergenic
1003981609 6:11395389-11395411 CTCTGTGCTTACTAGGGAGCGGG - Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1004564914 6:16787294-16787316 CTGTGTTCTCACATGGCAGGAGG - Intergenic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1006330478 6:33386757-33386779 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1006869023 6:37233473-37233495 CTGCATGCTCACATGGGAGAAGG + Intronic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1009747580 6:67838508-67838530 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1009878707 6:69538570-69538592 CTGTGTCCTCACAAAGCAGAAGG + Intergenic
1009882816 6:69590605-69590627 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1010751568 6:79621401-79621423 CTGTGTCCTCACAGGGTAGAAGG - Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011950635 6:92959623-92959645 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012599619 6:101079070-101079092 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1012830780 6:104201435-104201457 CTGTGTGCAGCCAAGGGACTTGG + Intergenic
1013630016 6:111977254-111977276 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013786708 6:113789441-113789463 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1013927894 6:115494667-115494689 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1013935346 6:115587277-115587299 CTGTGTGCTGCCTAGGGATTTGG + Intergenic
1013975627 6:116074984-116075006 CTGAGCACTCACAAGGGAGGGGG - Intergenic
1014576687 6:123082353-123082375 CTGTGTGCAAACTAGGGATTTGG - Intergenic
1014790600 6:125667733-125667755 TTGTCTGCTCACTAGTGAGTGGG - Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015091882 6:129368253-129368275 CTGTGTCCTCACACGGCAGAAGG - Intronic
1015187088 6:130430212-130430234 CTGTGTCCTCACATGGTAGAAGG + Intronic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015389407 6:132664307-132664329 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1015899239 6:138047524-138047546 CTGTGTGCTGCCTAGGGACTTGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1017421264 6:154275295-154275317 CTGTGTCCTCATTAGGGAGCTGG - Intronic
1017620544 6:156292170-156292192 CTGTCTGCTCACAAGGGTGCAGG - Intergenic
1018564151 6:165133794-165133816 CTGTGTCCTCCCAGTGGAGTGGG - Intergenic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019181884 6:170192530-170192552 CTGTGTGGTCCCAAGAGAGCAGG - Intergenic
1019780942 7:2939323-2939345 CTCTGTGCCCACAAGTGACTCGG + Intronic
1020676080 7:11186446-11186468 CTGTGTCCTCACAAGGTAGAAGG - Intergenic
1020882664 7:13781937-13781959 CTGTGTTCTCACACGGTAGTAGG + Intergenic
1021496212 7:21277069-21277091 TTGTGTCCTCACATGGCAGTAGG - Intergenic
1021808951 7:24384015-24384037 CTGTGTCCTCACAAGGTGGAAGG - Intergenic
1021863658 7:24932598-24932620 CTGTGTGCTCACAGGGTGGAAGG - Intronic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022224198 7:28346351-28346373 CTGTATCCTCACATGGGAGAAGG + Intronic
1022666426 7:32415737-32415759 TTGTGTGCTCCCGAGGGAGAAGG - Intergenic
1023539586 7:41251222-41251244 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024210475 7:47199008-47199030 CTGTGTCCTCACATGGCAGGGGG + Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025300616 7:57817236-57817258 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1027422823 7:78033864-78033886 CTGTGTGCCAACCAAGGAGTGGG + Intronic
1027569650 7:79847994-79848016 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1027654722 7:80916402-80916424 CTGTGTACTCACAGAGGAGATGG - Intronic
1027673749 7:81133763-81133785 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1028077582 7:86534755-86534777 CTTTGGGCTCTCAAGGGTGTGGG - Intergenic
1028331480 7:89600092-89600114 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1029147611 7:98457996-98458018 CTGTGGGCTCACAAGGTTGGGGG + Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030559126 7:111063324-111063346 CTGTGTGCTGTCTAGGGACTTGG - Intronic
1031009025 7:116504622-116504644 CTGGGTGGGCATAAGGGAGTAGG - Intronic
1031147048 7:118008113-118008135 CTGTGTGCTCACATGGCTGGGGG + Intergenic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1032099214 7:128959230-128959252 GTGTGTTATCACAAGGGACTAGG + Intronic
1032876857 7:136047104-136047126 CTGTGTCCTCACAGGGCAGAAGG + Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034328028 7:150255519-150255541 CTCTGTACTCTGAAGGGAGTGGG - Intronic
1034496174 7:151424058-151424080 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1034558999 7:151867718-151867740 CTGTGTGCTTTCCAGGGACTGGG - Intronic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036122144 8:6030196-6030218 CTGTGTCCTCACATGGTAGGAGG - Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036566869 8:9945342-9945364 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1037999826 8:23382069-23382091 CTGAGAGCTCACAAAGGAGCTGG + Intronic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038291312 8:26252226-26252248 CTGTGTGCTCACGTGGCAGAAGG + Intergenic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1038917314 8:32038129-32038151 GTGTGGGCTCACAAGGGCGTGGG + Intronic
1038924665 8:32125111-32125133 CTGTGTTCTCACATGGTAGAAGG - Intronic
1039766799 8:40637117-40637139 CTGTGTGCCCACATGGGAATGGG - Intronic
1039850185 8:41358226-41358248 CTGGGGGCTCTCAAGGGACTCGG - Intergenic
1040350361 8:46560598-46560620 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1040397225 8:47011390-47011412 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1040772703 8:50998198-50998220 CTGTGTCCTCACATGGGTGGAGG - Intergenic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041400181 8:57434506-57434528 CTGTGTGCTTCCCAAGGAGTAGG + Intergenic
1041640872 8:60200130-60200152 CTGTGTCCTCACATGGTAGAAGG - Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1041756611 8:61320677-61320699 CTGTGTCCTCACATGGTAGTAGG + Intronic
1041971000 8:63742627-63742649 CTGTGTACTCAGAAGAGAGGAGG + Intergenic
1042096384 8:65220367-65220389 CTGTGTCCTCACACGGCAGAAGG - Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042780864 8:72489765-72489787 CTGTGTGCTCACATGTGGGAAGG - Intergenic
1043320197 8:78975157-78975179 CTGTGTCCTGACAAGGCAGAAGG + Intergenic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043357423 8:79429303-79429325 CTGTGTCATCACAAGGCAGAAGG - Intergenic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1044282642 8:90374798-90374820 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1044348157 8:91130879-91130901 CTGTGTCCTCACATGGTAGAAGG + Intronic
1044510639 8:93074351-93074373 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1045734285 8:105276913-105276935 GTGTGGACTTACAAGGGAGTAGG - Intronic
1047014642 8:120710660-120710682 CTGTGTTCTCACATGGCAGAAGG - Intronic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047838794 8:128724357-128724379 ATTTGTGCTCAGAAGTGAGTTGG + Intergenic
1048142817 8:131811289-131811311 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1048618349 8:136104146-136104168 CTATGTGCTCACAATAGGGTAGG - Intergenic
1048619183 8:136113125-136113147 CTGTGTCCTCACATGGTAATGGG - Intergenic
1048737103 8:137514110-137514132 GTGTGTGCACACAAATGAGTAGG + Intergenic
1048807982 8:138258536-138258558 ATGCGTGCTCAGAAGGTAGTTGG - Intronic
1050103936 9:2146187-2146209 CTGTGTCCTCACATGGTAGAAGG + Intronic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1051573133 9:18583223-18583245 CTGTGTGCACCCTAGGGACTTGG + Intronic
1051662684 9:19440501-19440523 CTGTGTCCTCACATGGTAGAAGG - Intronic
1051963955 9:22803194-22803216 CTGTTTGCTCACAAGGCAGAAGG + Intergenic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052399192 9:27979196-27979218 GTGTGGGCTCACAAGGAAGGAGG + Intronic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053233010 9:36427555-36427577 CTGTGTCCTCACAAGGCAAAAGG - Intronic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1055411385 9:76033770-76033792 CTGTGTCCTCACATGGTAGAAGG + Intronic
1055723749 9:79204908-79204930 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1055779902 9:79809227-79809249 CTGTGTGCTTAGAAGTGTGTTGG + Intergenic
1056080432 9:83087449-83087471 CTGTGTTCTCACATGGCAGTAGG - Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056423472 9:86453167-86453189 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1056604929 9:88077816-88077838 CTGTGTCCTCTCATGGGAGAGGG + Intergenic
1056690517 9:88804429-88804451 TTCTGTGCTCACCAGGAAGTAGG - Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057722715 9:97545855-97545877 CTCTGTGCTCAGACTGGAGTCGG + Intronic
1057871094 9:98718383-98718405 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1058636301 9:107041688-107041710 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1059599643 9:115762872-115762894 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1060220986 9:121764004-121764026 CTGAGAGCTCAAAAGGGACTAGG - Intronic
1060431676 9:123556188-123556210 CTGTGTGCTCACATAGCAGAAGG - Intronic
1060768114 9:126310012-126310034 CTGTGTGCTTACATGGCAGAAGG - Intergenic
1061619225 9:131800355-131800377 CTGAGAGCTCACAACTGAGTGGG - Intergenic
1062556516 9:137115379-137115401 CTGGGTGCTCCCCAGGGAGGAGG - Intergenic
1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG + Intergenic
1185949823 X:4420665-4420687 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1186276998 X:7949858-7949880 CTGTGTCCTCACATGGTAGATGG + Intergenic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187152963 X:16698057-16698079 CTTTGTGGTCACAAGTGAGTGGG - Intronic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187697540 X:21937172-21937194 CTGTCTGCTCAGAAGCAAGTGGG + Intergenic
1188785122 X:34336303-34336325 CTGTGTGCAGCCAAGGGACTTGG - Intergenic
1189068374 X:37836360-37836382 CTGTGTCCTCACAAGGTGGAAGG - Intronic
1189274492 X:39775501-39775523 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1189526456 X:41827445-41827467 CTGTGTCCTTACATGGTAGTGGG + Intronic
1189556263 X:42148452-42148474 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190623676 X:52314704-52314726 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1191910681 X:66146223-66146245 CTGTGTCCTCACAAGGCAGAAGG - Intergenic
1192138751 X:68630402-68630424 CTGTGTGTTCCCATGGGGGTGGG + Intergenic
1192147033 X:68688891-68688913 CTGTGTGTTCCCATGGGGGTGGG - Intronic
1192285156 X:69727475-69727497 CTGTGTTCTCACATGGCAGAAGG + Intronic
1193221251 X:78929234-78929256 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194850204 X:98859867-98859889 CTGTGTGCAGTCTAGGGAGTTGG + Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1195663377 X:107404653-107404675 CTGTGTGCTCACACAGTAGGAGG + Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196298716 X:114029949-114029971 CTGTGTCCTCACATGGGGGAAGG - Intergenic
1196327158 X:114420035-114420057 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196731560 X:118946085-118946107 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1197827890 X:130610201-130610223 CTGTGTCCTCACAAAGCAGAAGG - Intergenic
1198078819 X:133219457-133219479 CTGTGTCCTCACATGGCAGCAGG + Intergenic
1198395110 X:136212413-136212435 CTCACTGCTCCCAAGGGAGTGGG + Intergenic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198574044 X:137990599-137990621 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1199194705 X:145014424-145014446 CTGTGTCCTCACACGGCAGAAGG + Intergenic
1199695073 X:150338196-150338218 CTGTGTCCTCACACGGCAGAAGG + Intergenic
1199719378 X:150531422-150531444 CTGTGTGCACACCAGGCACTGGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199751736 X:150826107-150826129 CTGTGTTCTCACATGGCAGAAGG - Intronic
1199797458 X:151214174-151214196 CTGTGTCCTCACAAGGCAGATGG + Intergenic
1200005498 X:153082034-153082056 CTGTGTCCTCACATGGTCGTGGG + Intergenic
1200296412 X:154924903-154924925 CTGTGTGCAGCCTAGGGAGTCGG - Intronic
1201446690 Y:14064607-14064629 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1201495948 Y:14591546-14591568 CTGTTTGTTCACCAGGGAGGAGG + Intronic
1201502700 Y:14662554-14662576 CTGTGTCCTCACATGGTAGAAGG + Intronic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1201688193 Y:16731433-16731455 CTGTGTCCTCACATGGTAGAAGG + Intergenic