ID: 1091770054

View in Genome Browser
Species Human (GRCh38)
Location 12:3145700-3145722
Sequence CTGTCCAGATGGCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 389}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091770047_1091770054 -3 Left 1091770047 12:3145680-3145702 CCTGCTCATTCCTCATTTTTCTG 0: 1
1: 1
2: 4
3: 41
4: 584
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389
1091770042_1091770054 29 Left 1091770042 12:3145648-3145670 CCCAGCAGTCCTCTCTGCCAGGA 0: 1
1: 0
2: 3
3: 33
4: 303
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389
1091770043_1091770054 28 Left 1091770043 12:3145649-3145671 CCAGCAGTCCTCTCTGCCAGGAT 0: 1
1: 0
2: 4
3: 30
4: 287
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389
1091770044_1091770054 20 Left 1091770044 12:3145657-3145679 CCTCTCTGCCAGGATCATCCTGT 0: 1
1: 0
2: 2
3: 18
4: 240
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389
1091770046_1091770054 2 Left 1091770046 12:3145675-3145697 CCTGTCCTGCTCATTCCTCATTT 0: 1
1: 1
2: 2
3: 28
4: 363
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389
1091770045_1091770054 12 Left 1091770045 12:3145665-3145687 CCAGGATCATCCTGTCCTGCTCA 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091770054 Original CRISPR CTGTCCAGATGGCTGGGGGA AGG Intronic
900208661 1:1442396-1442418 GTGTTCAGAAGGCTGGGGGCGGG + Exonic
900345335 1:2207799-2207821 CATTCCAGCAGGCTGGGGGAGGG - Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
900490897 1:2948656-2948678 CTCTCCAGAAAGCTGGGGCAAGG + Intergenic
900709683 1:4105706-4105728 CTGCCCAGAAGGCCTGGGGATGG + Intergenic
901529728 1:9845345-9845367 ATGTCCACATAGCTGGGGGCTGG - Intergenic
903472719 1:23598623-23598645 GTGCCCAGGTGGGTGGGGGAGGG - Intronic
903646728 1:24900683-24900705 CTGTCCAGGAGGCTGGGCGGAGG - Exonic
903916868 1:26771256-26771278 CTGCAAAGATGTCTGGGGGAGGG - Exonic
904054764 1:27662812-27662834 TTAAGCAGATGGCTGGGGGAGGG - Intergenic
904247629 1:29198965-29198987 CTGTCTAGGTGGTTGTGGGAAGG + Intronic
904676406 1:32201609-32201631 CTGTCACGGTGGCTGGGGGGCGG - Intronic
905515466 1:38558954-38558976 CTGTCCAGGCGGCTGGGAGGGGG - Intergenic
906000620 1:42421372-42421394 GAGTGCAGAAGGCTGGGGGAAGG + Exonic
906142265 1:43540764-43540786 CTGGCCAACTGGCTGGAGGAGGG + Intronic
907407938 1:54265179-54265201 CTGACCAGATGGGGGGAGGAAGG + Intronic
911286633 1:96002411-96002433 CTTTCCAGATGGCTGTAGGTTGG + Intergenic
911885903 1:103299284-103299306 CTATCCTTATAGCTGGGGGAGGG - Intergenic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912774040 1:112492559-112492581 CTGTGCTTCTGGCTGGGGGAAGG + Intronic
914748017 1:150513509-150513531 GTGTTCAGATGGGTGGGGCAGGG - Exonic
914848090 1:151293811-151293833 AAGTCCAGAAGGCTGGGGAAGGG - Intronic
915109592 1:153554556-153554578 CTTTGGAGATGGCTGTGGGAAGG + Intergenic
915564980 1:156708061-156708083 ATGGCCAGTTGGCTGGTGGAGGG - Intergenic
916923179 1:169490278-169490300 TTGTCAAAATGGCGGGGGGACGG + Intergenic
917505797 1:175625813-175625835 ATGTGCAGATGGCTGGGGGTAGG - Intronic
918111357 1:181457884-181457906 CTCTCCAGGATGCTGGGGGAAGG + Intronic
920180259 1:204128043-204128065 CTGGCCACATGGCTGGGGTTGGG + Intergenic
920366323 1:205450080-205450102 CCGTCCTCAGGGCTGGGGGAGGG - Intronic
922719629 1:227893614-227893636 CAGCCCATGTGGCTGGGGGAAGG + Intergenic
922725187 1:227919570-227919592 GTGTCCTGATGGCTGTGGGCTGG - Exonic
922778672 1:228232074-228232096 GTGGCCAGATGGTGGGGGGAAGG - Intronic
922864560 1:228848506-228848528 GTGCCCAGTTGGCTGGGGGGGGG - Intergenic
923532363 1:234821606-234821628 TAGTCCAGATGGCTCAGGGAAGG - Intergenic
924665300 1:246064757-246064779 CGGTCTAGAAGGCCGGGGGATGG - Intronic
1063379589 10:5575961-5575983 CTGGCCAGCTGGGTGGGGGCCGG + Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1063866064 10:10366918-10366940 CTGTCCCCATGGCCAGGGGATGG + Intergenic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1067142861 10:43670817-43670839 ATGTCCAGAAGCCTGGGGGCGGG + Intergenic
1067272119 10:44801612-44801634 ATGTCCAGTTGGCTGGTGGTGGG - Intergenic
1067450271 10:46377773-46377795 CTGCCCAGAGGCCTGGGAGATGG - Intronic
1067451524 10:46384863-46384885 GAGTCCAGATGGCAGGGGGTGGG - Intronic
1067585715 10:47474893-47474915 GAGTCCAGATGGCAGGGGGTGGG + Intronic
1067586974 10:47481990-47482012 CTGCCCAGAGGCCTGGGAGATGG + Intronic
1067634031 10:47989757-47989779 CTGCCCAGAGGCCTGGGAGATGG + Intergenic
1067785141 10:49240296-49240318 GTGTGCAGATGCCTTGGGGAAGG - Intergenic
1070801819 10:79248358-79248380 CCCTCCAGATGGCAGGGGGGAGG + Intronic
1071266239 10:83967379-83967401 ATATCCAGATGGCTGGGGCCTGG - Intergenic
1071415744 10:85439621-85439643 CAGTCCAGATTTCTGGGGCAGGG + Intergenic
1071798156 10:89027990-89028012 GTCTCCAGATGGCTGAGGAAAGG + Intergenic
1073110555 10:101061114-101061136 CAGTCCAGCTCGCGGGGGGATGG - Intergenic
1073121476 10:101124836-101124858 CTTTCCAGCTGGGTGGGTGACGG - Intronic
1073469667 10:103714799-103714821 CTGGCCAGATGGGTGGTGGCAGG + Intronic
1074719196 10:116250035-116250057 CATTCCAGATGACGGGGGGAAGG + Intronic
1075725561 10:124609031-124609053 CTGTCCAGAGCCCTGGGGGACGG + Intronic
1075851814 10:125595207-125595229 CTGTCAAGATGACTGGGTCAGGG - Intronic
1076446662 10:130518894-130518916 CTGTACAGGTGGCTGGCAGAAGG - Intergenic
1076629911 10:131846353-131846375 CTGGCCACATGGGTGGGGCACGG - Intergenic
1077088396 11:766200-766222 GTGGCCAGATGGCTGGTGTAAGG - Intergenic
1077146802 11:1050127-1050149 CTCCCCAGATCCCTGGGGGAAGG + Intergenic
1078101633 11:8333716-8333738 CTGGCCCGGAGGCTGGGGGAAGG + Intergenic
1078153075 11:8775516-8775538 CCTTCCAGATGGCTGGGGTGGGG + Intronic
1078464643 11:11541297-11541319 GTGTCCAGTTGGCTATGGGAGGG - Intronic
1078856282 11:15208503-15208525 CTGTCTTGATGGCTGGGGTGGGG + Intronic
1079281905 11:19095191-19095213 CTTTCCAGATGGAAGGGAGAAGG + Intergenic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1080460307 11:32449128-32449150 CTGCCCAGATGGCTCTGGGGGGG + Intergenic
1080928008 11:36778275-36778297 CTTTCCAGCTGGCTGAGGCAGGG - Intergenic
1081794773 11:45811754-45811776 CTCTCCAGGTGGCTGTGGTAGGG - Exonic
1083278296 11:61609973-61609995 CAGTGCAGAGGGATGGGGGAGGG + Intergenic
1083318024 11:61828222-61828244 CAGGCGAGAAGGCTGGGGGAGGG + Exonic
1083427208 11:62594393-62594415 TTTTCCAGATGGCAGGGGCAGGG - Exonic
1083540001 11:63505989-63506011 CTGTCCAGGGAGCTGGGGGTGGG + Intergenic
1084759977 11:71264421-71264443 CTGTCCACTTGACTGGGTGAAGG + Intergenic
1084936125 11:72587626-72587648 CTGACCAGATGGCCTTGGGAAGG - Intronic
1085235063 11:75008327-75008349 CTGTCAAGTTGGCAGGTGGAGGG + Exonic
1087118270 11:94545662-94545684 CTGTACAGAGGGCTGGGGACCGG + Exonic
1089288014 11:117420071-117420093 CTGTAGAAATGCCTGGGGGAGGG + Intergenic
1089652842 11:119925918-119925940 CTGTCCAGGTGGTGGGGGCAGGG + Intergenic
1089678720 11:120107749-120107771 CTGTCCAGAGGGGCGGGGGCTGG - Intergenic
1090225658 11:125070772-125070794 CTGTCACGAGGGGTGGGGGATGG - Intronic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090743793 11:129691339-129691361 CTGAGCAGGAGGCTGGGGGAGGG - Intergenic
1091124797 11:133084257-133084279 CTGTGCAGGTGTCTGGGGGGTGG - Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091993772 12:4977051-4977073 CTGCCCTGAAGGCTGGGGAAGGG + Intergenic
1092127444 12:6084862-6084884 CTGTAATGATGGGTGGGGGAGGG + Intronic
1092936278 12:13367102-13367124 CTGTCCATTGGACTGGGGGAAGG + Intergenic
1094639041 12:32255383-32255405 CTGTCCAGATGACTGGCACATGG - Intronic
1095738865 12:45586250-45586272 CTTCCCAGATGGTTGGGGGCCGG + Intergenic
1095738895 12:45586369-45586391 CTTCCCAGATGGTTGGGGGCCGG + Intergenic
1095938943 12:47713118-47713140 CTGCCCATATGGCAGGGGGGCGG - Intronic
1096195197 12:49645166-49645188 CTCTGCAGATGGCTGGAGAAAGG - Exonic
1098912648 12:76225533-76225555 CTGGCCAGATGACTGGAGGCTGG - Intergenic
1100136278 12:91557078-91557100 CTGTCCAGCTTGCTGGGAGGAGG + Intergenic
1100407621 12:94285126-94285148 CTGTGCAGATGCCTGGAGGCAGG + Intronic
1101316357 12:103632576-103632598 ATGTCGAGAGGGCTGTGGGAAGG + Intronic
1102399361 12:112615304-112615326 TTCACCAGATGGCTGGGGGCAGG - Intronic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104910867 12:132240373-132240395 CTGGCCAGGTGGCTGGTGAAAGG + Intronic
1104945976 12:132415047-132415069 CCGTCCTGGTGGCTGGAGGACGG + Intergenic
1106187108 13:27419252-27419274 CTTTCCACATGGCTGGGGGGTGG + Intergenic
1108707985 13:53007169-53007191 GTTTCCACATGGCTTGGGGAAGG + Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113364253 13:109661674-109661696 CGGTCCACATGGCTGGGTCATGG + Intergenic
1113724416 13:112587778-112587800 CCGGGCAGAGGGCTGGGGGACGG - Intronic
1114527839 14:23377472-23377494 GTGTCCAGAGGGCTTGGGGAAGG - Intronic
1114623672 14:24114742-24114764 CTGTCCAGTTGGCTGGCCAAGGG + Exonic
1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG + Intergenic
1117805972 14:59491096-59491118 CAGTCCAGATAGATGGGGGCTGG + Intronic
1117916926 14:60687611-60687633 CTGACCAGATGGCTAGTGCAAGG - Intergenic
1120027200 14:79599882-79599904 CTGTCCAGAAGGCTGAGGCAGGG + Intronic
1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG + Intergenic
1122055766 14:99097271-99097293 CTGTCTAGAAGGTTGAGGGAGGG + Intergenic
1122117947 14:99536951-99536973 CAGGGCAGAGGGCTGGGGGAAGG + Intronic
1122832283 14:104404928-104404950 ATGGTCACATGGCTGGGGGAAGG - Intergenic
1124794741 15:32766700-32766722 CTGTCCAAACGGCTGAGGAACGG + Exonic
1125889003 15:43251914-43251936 CTGGCCAGAGGGTTAGGGGAAGG - Intronic
1126173727 15:45716147-45716169 CTGCCCAGATGCCAGAGGGAAGG + Intergenic
1127171484 15:56307356-56307378 CTGTCCAGATTGGTGGGCTAGGG - Intronic
1127360776 15:58243253-58243275 GAGGACAGATGGCTGGGGGAAGG - Intronic
1128095060 15:64947741-64947763 CTGTGCAGAGGCCTGGAGGAGGG - Intronic
1128369494 15:67030053-67030075 CTGAGCAGATGGCTGGGTGTGGG + Intergenic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1129254543 15:74326765-74326787 CTTTCCAGTCTGCTGGGGGAGGG - Intronic
1129467649 15:75732876-75732898 CTGGCGAGTTGGCGGGGGGACGG + Intergenic
1130993468 15:88890719-88890741 GTTTCCAGAAGGTTGGGGGAAGG - Intronic
1131035945 15:89222030-89222052 AGGTCCTGCTGGCTGGGGGAGGG - Intergenic
1131058502 15:89390451-89390473 CTGGCCATCTGGCTCGGGGACGG - Intergenic
1131154136 15:90064455-90064477 CTGCCCAGATCTCTGGGAGAAGG - Intronic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1132705769 16:1242485-1242507 CTGCCCAGATAGCTGGTGGTGGG + Exonic
1132786583 16:1660189-1660211 CTATCCAGATGACAGGGTGAAGG + Intronic
1132996604 16:2826883-2826905 AGGTCCTGCTGGCTGGGGGAGGG - Intergenic
1133950516 16:10387831-10387853 GTGTCCGGGTGGCGGGGGGAGGG - Intronic
1133965405 16:10527503-10527525 TTGTCCATATGGCTGGGGGATGG - Intergenic
1134229072 16:12415261-12415283 CTGTCCTGAAGGCTGGGGAGTGG + Intronic
1134609068 16:15593400-15593422 CTGTCCCCATTGCTGGGGGGGGG - Intronic
1135132154 16:19861962-19861984 CTGTTCGGAGAGCTGGGGGAGGG + Exonic
1135703258 16:24651688-24651710 TTGTTAAGATGGCGGGGGGAGGG - Intergenic
1138027198 16:53531407-53531429 GAGGCCAGAAGGCTGGGGGAGGG - Intergenic
1138211375 16:55166057-55166079 CTATGCAGACAGCTGGGGGAAGG - Intergenic
1138278029 16:55750434-55750456 CAGTCCAGAGGGCTGGGTCATGG + Intergenic
1138436455 16:57003402-57003424 CTGGCAAGATGGTTGTGGGATGG - Intronic
1138861177 16:60759457-60759479 AGTTCCACATGGCTGGGGGAGGG + Intergenic
1139272607 16:65698103-65698125 CTGTCCCTATTGCTGGGGAATGG - Intergenic
1139326240 16:66154699-66154721 CTTTCAAGGTGGCTGGGGCAGGG - Intergenic
1139922510 16:70468961-70468983 CTGTCCAGGTGACTGGGGGAGGG + Exonic
1140126086 16:72120078-72120100 CTGTGGAGGTGGCTGTGGGAAGG + Exonic
1142068199 16:88074645-88074667 CTTTCCAGCTGTCTGGGGGAAGG + Intronic
1143413541 17:6728046-6728068 CTGTCCAGAAGGCAGCAGGAGGG - Intergenic
1144523324 17:15968874-15968896 GTGTCCGGACAGCTGGGGGAGGG + Intronic
1144886613 17:18467357-18467379 CTGCCCAGATGGGTGGGGAGGGG + Intergenic
1145145599 17:20476951-20476973 CTGCCCAGATGGGTGGGGAGGGG - Intergenic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147141829 17:38464714-38464736 CTCTCCAGTTGGCAGGGGCAAGG + Intronic
1147418464 17:40310053-40310075 CAGTCCAGATGGCTAGGGAAGGG + Intronic
1148187646 17:45656148-45656170 CTGTCCAGGTAGCATGGGGATGG - Intergenic
1148281676 17:46353076-46353098 CTGTCCTGATGAATGGGCGAGGG - Intronic
1148303901 17:46571015-46571037 CTGTCCTGATGAATGGGCGAGGG - Intronic
1149278512 17:55073251-55073273 TTATCCAGATGGCTTTGGGATGG + Intronic
1151662552 17:75526262-75526284 CAGCCCAGATGGCAGGGGCAGGG - Intronic
1152566594 17:81103128-81103150 CGCCCCAGATGGCCGGGGGAGGG - Intronic
1152713664 17:81887759-81887781 CTGTCCAGCTGGGAGGGGGTGGG - Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1152941377 17:83174443-83174465 CCGTCTTGATGACTGGGGGATGG + Intergenic
1153029878 18:703699-703721 CTGTCCAAAAGGCTCAGGGAAGG - Intronic
1153572366 18:6486128-6486150 CAGTACAGAGGGCTGGGGGTGGG - Intergenic
1154114406 18:11598642-11598664 CTATTCAGATGGCTGGGGTGGGG - Intergenic
1157125930 18:44955828-44955850 CTGTGCAGATGCCTTAGGGAAGG - Intronic
1157364995 18:47056456-47056478 TTGAACAGATGGCTGGTGGAGGG + Intronic
1157487623 18:48099781-48099803 CTGTCCTGGTGGGTGGGGAAAGG - Intronic
1157772195 18:50358936-50358958 GTGTCCTGATGGCAGAGGGAGGG + Intergenic
1158442897 18:57492945-57492967 CTCCCCAGTTGGCTGGGGGCTGG + Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160662672 19:308389-308411 CTGTACACCTGGCTGGGAGAGGG - Intronic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1160802708 19:977591-977613 GCGTCCTGGTGGCTGGGGGAGGG + Intergenic
1160836073 19:1124950-1124972 CGGGACGGATGGCTGGGGGATGG + Intronic
1161658308 19:5529686-5529708 CTGGCCAGCTGGCTGTGGGTGGG - Intergenic
1161851185 19:6738948-6738970 TGGCCCAGATGTCTGGGGGAGGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162519731 19:11172760-11172782 CTGTCCAGCAGGATGTGGGATGG + Intronic
1163263704 19:16206050-16206072 CTGTCCCGGCGGCTGGGTGAAGG - Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163599048 19:18237127-18237149 CAGTCCAGGTGTCTGGGTGAGGG - Intronic
1163628682 19:18405250-18405272 CTGTGCAGGTGGCTGGGGAAGGG - Intergenic
1164840073 19:31386673-31386695 CTGGCCACTTGGCTGGTGGATGG - Intergenic
1164846836 19:31439626-31439648 CTGTCCAGATTGAAAGGGGAGGG + Intergenic
1165092995 19:33396383-33396405 ATGACCAGGTGGCTGGGAGAGGG - Intronic
1166971938 19:46574700-46574722 ATCTCCACATGCCTGGGGGAGGG + Intronic
1167631831 19:50630265-50630287 GTGGCCACCTGGCTGGGGGATGG - Intronic
1167758072 19:51425912-51425934 CTCTGCAGATGGCTGGAGCAAGG - Intergenic
1168358160 19:55715241-55715263 CTGTTCAGCAGGCTGGGAGACGG - Intronic
924962133 2:45413-45435 GTGCCCAGAAGGCTGGGGGCGGG - Intronic
925085048 2:1101223-1101245 CAGGCAAGCTGGCTGGGGGAGGG - Intronic
925410675 2:3638252-3638274 CTGACCAGATGGCGGGGGGCGGG - Intronic
925965422 2:9061057-9061079 CTTTGCAGCTGGGTGGGGGATGG + Intergenic
927429683 2:23016971-23016993 CTATTCAGAGGGCTGGGGGTGGG - Intergenic
928106889 2:28476399-28476421 CTGACCTCATGGCTGGGGCAGGG - Intronic
928790604 2:34947785-34947807 CAGACCAGAGGGCTGTGGGATGG + Intergenic
929565984 2:42985178-42985200 CTGTCCTGATGGCTGGAAGGTGG + Intergenic
929775224 2:44926640-44926662 CTGCCCAGTTGGGTGGGGGGGGG + Intergenic
932338336 2:70943647-70943669 CAGTCCTGTAGGCTGGGGGAGGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933271768 2:80240425-80240447 CTGTGGAGATGGCTGGAGGCAGG - Intronic
933780184 2:85795785-85795807 CTCTCCAGATGGCTTTGGGCTGG - Intergenic
934574259 2:95390561-95390583 AGGGCCAGAGGGCTGGGGGAGGG - Intergenic
935141108 2:100353861-100353883 CTCTCCAGCTGGCTGGAGGGTGG + Intergenic
936581951 2:113708236-113708258 CAGTCTAGATGGCTGGGGAAAGG + Intronic
937127301 2:119482743-119482765 CTACCCAGATGCCTGTGGGATGG + Intronic
938252834 2:129828858-129828880 CTGCCCAGCTGGCTGGCTGATGG - Intergenic
938405164 2:131028445-131028467 CTGCCCAGATGGCTGGTTGGGGG - Intronic
939549736 2:143599524-143599546 CTGTGTAGATGGCGGGGGTAGGG - Intronic
940693981 2:156956077-156956099 CTCTGCAGAGGGATGGGGGATGG + Intergenic
940769144 2:157821736-157821758 CTGTGCAGGTGGTTGGAGGATGG + Intronic
941426628 2:165354277-165354299 ATCTCCAGATTGCTGTGGGAAGG + Exonic
944323715 2:198378460-198378482 CTATCCAGATGGCTGAGGTGGGG - Intronic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
945768961 2:214015777-214015799 CCATTCAGTTGGCTGGGGGAGGG + Intronic
945825119 2:214712156-214712178 CAGTCCAGATGGGAGTGGGAAGG + Intergenic
946335788 2:219035665-219035687 CTGTTCAGGTGGCAGGGAGAAGG + Intronic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
946765692 2:223037946-223037968 CCGTAAACATGGCTGGGGGAGGG - Intergenic
948560150 2:238847027-238847049 CCGTCCAGATGGCCCGGGGCCGG + Intergenic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
948860378 2:240750017-240750039 CTCTGCAGCAGGCTGGGGGAGGG + Intronic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1168875548 20:1169707-1169729 GTGTCCAGATGGCAGTGTGAAGG - Intronic
1170315381 20:15035541-15035563 CAGTGCAGATGGGTGGGGAAAGG - Intronic
1173202058 20:40961493-40961515 TGCTCCAGATGGCAGGGGGAAGG - Intergenic
1173561833 20:44011612-44011634 TTTACCAGATGGCTGAGGGATGG + Intronic
1174444318 20:50580235-50580257 CTGTCCGGAAACCTGGGGGAGGG - Intronic
1175276509 20:57774433-57774455 CTGACCTGTTGGCTGGGAGACGG + Intergenic
1175570241 20:60012611-60012633 CTGGCCAGAGAGCTGAGGGATGG - Exonic
1175876365 20:62232148-62232170 CTGGGCAGATGGCTGGGAGTTGG - Intronic
1175903151 20:62367720-62367742 CCGTCCTGCTGGCTGCGGGAAGG + Intergenic
1176082838 20:63282514-63282536 CTGTCCTGAAGTCTGGAGGATGG + Intronic
1177908147 21:26997401-26997423 CTGCCCAGAAGCCAGGGGGATGG + Intergenic
1180017309 21:45095786-45095808 TTGCCCAGATGCCTGGGGCAGGG + Intronic
1180106051 21:45618843-45618865 GTGACCAGATGGCTGGGAGTGGG + Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1181085708 22:20438413-20438435 CGGACCAGAGGCCTGGGGGAAGG + Intronic
1181102263 22:20549449-20549471 CTGTCCATCTGGATGGGGGTGGG + Intronic
1181546566 22:23605667-23605689 CTATCCAGAGGACTGGGGGGAGG + Intergenic
1181673934 22:24439880-24439902 CTCTCCAGAGGGCTGTGGGTGGG + Intronic
1181712277 22:24697971-24697993 CTCCCCAGGTGGCTGGGGGAAGG - Intergenic
1182150012 22:28021239-28021261 CTGACCAGATGGCTGGGAGGAGG + Intronic
1182350045 22:29694299-29694321 CTGGCAACATGGCTGGGGTAAGG - Intronic
1182369673 22:29802006-29802028 CGGTCCAGCTGGCTGAGGGTGGG + Exonic
1182393780 22:30020687-30020709 TCGTCCAGGTGGCTGCGGGAAGG - Exonic
1182427994 22:30285000-30285022 CTGTGTAGCTGGCTGGGGGCTGG - Intergenic
1182560426 22:31154913-31154935 CTCTCCAGAGGGCAGAGGGAAGG - Intergenic
1183060360 22:35333083-35333105 CTGTCCAGTTTACTAGGGGAGGG - Intronic
1183089224 22:35509880-35509902 CTGAAAAGATGGCAGGGGGAGGG - Intergenic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
1183210264 22:36446989-36447011 ATCACCAGATGGATGGGGGAGGG - Intergenic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184120139 22:42444671-42444693 CTGTCAGGAAGGCTGGGGGAGGG - Intergenic
1184271976 22:43389512-43389534 TTTTCCAGATGGTTAGGGGAAGG + Intergenic
1184439489 22:44500190-44500212 CTGTTCAGTTGGTTGGGGGGGGG - Intergenic
1184522317 22:45002447-45002469 CTCTGCTGAAGGCTGGGGGAGGG + Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
950454874 3:13086699-13086721 CTGTGCAGAGAGCTGAGGGAGGG - Intergenic
950466974 3:13161463-13161485 CTGTCCAGAGGGTGGGGGCAGGG + Intergenic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950918578 3:16669759-16669781 CTGTCAATATGGCAGGGGAAAGG + Intronic
952884939 3:38006467-38006489 CTATCCAGATGGCCGGGCAATGG + Exonic
953390046 3:42528571-42528593 CACTCCAGATGGCACGGGGACGG - Intronic
954290687 3:49648410-49648432 CTGACCATAGGGCTGGGGAAGGG + Intronic
954361686 3:50125641-50125663 CCGGTCAGGTGGCTGGGGGAGGG + Intergenic
954413484 3:50381414-50381436 CTGCCCAGGTGGCTGGGTGCTGG + Intronic
957673744 3:83339835-83339857 CTGGCCAGATGACTGGAGGCTGG + Intergenic
957827050 3:85461231-85461253 GTGTTGAGATGGCTGGGGGAGGG - Intronic
960650379 3:119941788-119941810 CTGTGCAGATGGCGGGGAGGAGG + Intronic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
961577770 3:127852130-127852152 CTGGCCATATGGCAGGTGGAGGG - Intergenic
961650915 3:128416268-128416290 CTGCCCAGATGCCTTGGGGAGGG - Intergenic
962583742 3:136820205-136820227 GGGTCCAGAGGGCTGGGGGTAGG + Intronic
962865796 3:139447266-139447288 CTCTGGAGATTGCTGGGGGAAGG + Intergenic
964763649 3:160157832-160157854 GGGTGCAGATGGCTGGGGGCTGG + Intergenic
965672321 3:171159291-171159313 CTGTCTTGGTGGCTGGGTGACGG + Intronic
965755344 3:172020979-172021001 CTTTCAAGATGCCTGGGGGTGGG - Intergenic
967990100 3:195124326-195124348 CTGACCAGATGGTTGGGGGCTGG + Intronic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
968620883 4:1602991-1603013 GTGTCCGGACGGCTGGGAGATGG - Intergenic
974439577 4:61898977-61898999 CTGTACACATGGCTGGGAAAGGG + Intronic
975544746 4:75549245-75549267 ATGTAGAGATGGCTGGGGGCAGG - Intronic
976483646 4:85574374-85574396 CTGTCTAGAGGGCTTGGGAAGGG + Intronic
978048689 4:104167652-104167674 CAGACCAGTTGTCTGGGGGATGG - Intergenic
978728838 4:112001165-112001187 CTAAACATATGGCTGGGGGAAGG + Intergenic
983635128 4:169890211-169890233 CTGGGCAGGTGGCTGGGGGCGGG - Intergenic
984715631 4:182922166-182922188 CTTTCCAGTTAGCTGAGGGAAGG - Intergenic
985960539 5:3299689-3299711 CTCTCCAGACGGCTGTGGGGAGG + Intergenic
986233211 5:5885597-5885619 GTGTCCAGAGAGCTGGGGAATGG + Intergenic
988317173 5:29644970-29644992 AATTCCACATGGCTGGGGGAGGG - Intergenic
988489221 5:31692547-31692569 CTGTCCAGAAGGCAAGGGAAGGG - Intronic
988517400 5:31916788-31916810 GTGTCCAGATGCCTGGGGAAGGG + Intronic
989344519 5:40414754-40414776 TTGTCAAGGTGGGTGGGGGAAGG + Intergenic
990794231 5:59521725-59521747 CTGTAGAGATGGGTTGGGGAGGG - Intronic
991317638 5:65327363-65327385 CTGCCCAGTTGTCTGGGGAAGGG + Intronic
991658269 5:68924787-68924809 AGGTCCAGGTGGCTGGAGGAAGG + Intergenic
992676934 5:79114413-79114435 CTGTCCAAATGGCATGGGAAGGG + Intronic
997213829 5:132094477-132094499 CAGTTCAGGTGGCTGGGGGCTGG + Intergenic
1000009600 5:157218884-157218906 GTGTCCAAAACGCTGGGGGAGGG + Intronic
1002536782 5:179880163-179880185 CTGCACAGAGGGCTGGGTGATGG + Intronic
1003014339 6:2455983-2456005 CTCTCCAGCAGGGTGGGGGATGG - Intergenic
1005246459 6:23891349-23891371 CTGTCCAGAAGCCTGGTGGGGGG - Intergenic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006406500 6:33848753-33848775 ATGGCCAGATGGCAGAGGGAAGG - Intergenic
1006429716 6:33988219-33988241 CTGTCCAGGTGGCCCAGGGAGGG - Intergenic
1006625056 6:35392060-35392082 CAGTCCAGATGGATGAAGGAAGG - Intronic
1006625152 6:35392522-35392544 CAGTCCAGATGGATGAAGGAAGG + Intronic
1006892483 6:37440987-37441009 ATGTCCAGATTGCTGGTGAAAGG + Intronic
1008434100 6:51454989-51455011 TTTCCCAGATGGCTTGGGGAGGG + Intergenic
1012797821 6:103785673-103785695 AGTTCCACATGGCTGGGGGAGGG + Intergenic
1012977195 6:105793268-105793290 CTGTCAGAATGCCTGGGGGAGGG - Intergenic
1014826872 6:126056803-126056825 CTGGCCTGATAGCTGGGGGCTGG + Intergenic
1015144478 6:129970410-129970432 CCATGCAGATGTCTGGGGGAGGG + Intergenic
1016601525 6:145866886-145866908 CTGTGCTGATTGATGGGGGAAGG + Intronic
1017015465 6:150096048-150096070 GTGTACAGATGGCTGGGGCAGGG + Intergenic
1018149849 6:160927273-160927295 TGGGCCAGATGACTGGGGGAGGG + Intergenic
1018457456 6:163964573-163964595 CTGTCCAGATGTCCGAGGTAGGG - Intergenic
1018682389 6:166275257-166275279 CTGTCCTGTTGGCTGGGGCTGGG + Intergenic
1018829112 6:167428978-167429000 CTGTGCAGATGCCTGGAGGATGG - Intergenic
1019715347 7:2536248-2536270 CTCTCCAGATCCCTGTGGGAGGG + Intergenic
1019741471 7:2676892-2676914 CTCTCCAGATCCCTGTGGGAGGG - Intergenic
1019866171 7:3712517-3712539 CAGACCAGAGGGTTGGGGGATGG - Intronic
1021586080 7:22210079-22210101 GTGTCTTGATGGCTTGGGGAAGG - Intronic
1021903037 7:25306500-25306522 TTCTCCAGTTGGCTGGGGAAGGG - Intergenic
1023285639 7:38616101-38616123 CTGTGTAGATGATTGGGGGAAGG - Intronic
1024056719 7:45664120-45664142 CTGATCAGATAGGTGGGGGATGG + Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026037144 7:66837861-66837883 CAGACCAGATAGCTGGGGAATGG + Intergenic
1026984169 7:74544666-74544688 CAGGCCAGATAGCTGGGGAATGG - Intronic
1028082378 7:86594387-86594409 GTGACCAGATGGCTGGGTCAAGG + Intergenic
1029199233 7:98827491-98827513 TTGTAGAGATGGGTGGGGGAGGG - Intergenic
1029284270 7:99455323-99455345 CTAACATGATGGCTGGGGGAGGG - Intronic
1030023494 7:105299010-105299032 CAGTGCATATGGATGGGGGAGGG - Intronic
1030600142 7:111583380-111583402 CTGTCCAGATGTCTATGGGGGGG + Intergenic
1030958855 7:115889446-115889468 CACTCCAGTTTGCTGGGGGAGGG + Intergenic
1032085325 7:128880655-128880677 CTGCCCCCATGGCTGGGCGAAGG - Exonic
1032987654 7:137356655-137356677 CTGTCCAGGTGGTGGGAGGAGGG - Intergenic
1033353972 7:140584657-140584679 ATGCCCAGAGGGCAGGGGGAAGG - Intronic
1035469054 7:159098151-159098173 CTGTGCTGATGGATGGGGGCCGG - Intronic
1035716037 8:1755613-1755635 CTGCCCAGAGGGCTGGGGGTTGG + Intergenic
1036601523 8:10265192-10265214 CTCTGCAGCTGGCTGGAGGAGGG + Intronic
1036645356 8:10608911-10608933 CTGTCCAGGGAGCTGAGGGAGGG - Exonic
1036685980 8:10910600-10910622 CTGAGCAGCTGGCTGGGGGCTGG + Intronic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037765804 8:21771537-21771559 ATGTCCAGAAGCCTTGGGGAAGG - Intronic
1037802943 8:22044896-22044918 CTGTCCAGATGGCTGAGGTTGGG + Intronic
1038423627 8:27450951-27450973 CTCCCCAGGTGGCTGGGGCAAGG + Intronic
1038697490 8:29819244-29819266 CTCTCCAGGTGTCTGGGGAAGGG - Intergenic
1039444543 8:37620698-37620720 GTGTCTTGATGGCTGGGGGTGGG - Intergenic
1039584773 8:38697241-38697263 TTGTCCAGAGGGCTGGGGTGGGG - Intergenic
1039599613 8:38824081-38824103 ATGGAGAGATGGCTGGGGGAGGG - Intronic
1040554521 8:48467452-48467474 CTGGCCTGGTGGCTGGGGGGCGG + Intergenic
1043356306 8:79416721-79416743 ATGTCCAGTTGGTTGGGGGGTGG + Intergenic
1045227089 8:100259293-100259315 TTGTTCAGATGACTGGGGGAAGG + Intronic
1046601277 8:116319770-116319792 CTGTCCACAGGGGCGGGGGAAGG + Intergenic
1049300663 8:141867770-141867792 CTGTCCAGATGAATGGTGGCGGG + Intergenic
1049759357 8:144325125-144325147 CTCTCCAGGAGGCAGGGGGATGG - Intronic
1049945761 9:593916-593938 GTGTTCCCATGGCTGGGGGAGGG - Intronic
1050065912 9:1759309-1759331 CTGTCAGGTTGGCTGGGGGCTGG - Intergenic
1050395327 9:5188980-5189002 TGCCCCAGATGGCTGGGGGAGGG + Intergenic
1052352266 9:27469917-27469939 TTGCAGAGATGGCTGGGGGAGGG - Intronic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1055665674 9:78550488-78550510 CTGTCCAGATGACTGATGGTGGG - Intergenic
1056457201 9:86772026-86772048 CTGTCCAGAAAGCTGTGGGATGG + Intergenic
1056675734 9:88675441-88675463 CTGCTCAGATGGCTCTGGGAAGG - Intergenic
1057147118 9:92765468-92765490 CTGTGCAGACGTCTGGGGGCGGG + Intergenic
1057598826 9:96439527-96439549 GTGTTCAGATGTCTGTGGGAAGG + Intergenic
1057630227 9:96713988-96714010 GTGTCCAGAAGTCTGAGGGAAGG - Intergenic
1057842058 9:98494403-98494425 CTGTGCAGGTGTCTGGGTGAGGG + Intronic
1061163918 9:128911589-128911611 CTGTCCTCCTGGTTGGGGGAGGG + Intronic
1061201006 9:129138547-129138569 CTCTCCAGATAGCTGAGCGAGGG - Intronic
1062009276 9:134258538-134258560 CTGCCCAGATGGCTGTGGAATGG - Intergenic
1062628338 9:137452941-137452963 TTCTCCAGCTGCCTGGGGGAGGG - Intronic
1203785907 EBV:127459-127481 CTGTCCCGATGGCAGGTGCACGG - Intergenic
1185539998 X:895694-895716 CTGTCCAGATGGTTTGGGATGGG - Intergenic
1186873278 X:13792936-13792958 CTATTCAGATGGTTGGGGGTGGG - Intronic
1187168883 X:16831355-16831377 CTGTACTCATGGCTGGGTGATGG + Intronic
1187581576 X:20612817-20612839 CTCTCCATGTGGCTGGGTGAGGG + Intergenic
1187757901 X:22546672-22546694 TTCCCCAGGTGGCTGGGGGAAGG - Intergenic
1188683428 X:33040335-33040357 CTGTTCAGAGGGGTTGGGGAAGG + Intronic
1189207840 X:39257037-39257059 GTGTCCAGGTGGCTGGGGGAGGG - Intergenic
1189330427 X:40141421-40141443 CAGGCCAGATGGCTTGAGGAAGG + Intronic
1190175471 X:48145566-48145588 CTATTCAGATGGTTGGGGGCAGG - Intergenic
1190182769 X:48207489-48207511 CTTTTCAGATGGTTGGGGGCAGG - Intronic
1190304609 X:49074901-49074923 CTACGCAGATGGCTGGGGGAGGG + Exonic
1190460412 X:50667900-50667922 CTATCCAGAGGACTGGGAGAGGG + Intronic
1190464158 X:50709038-50709060 CCTTCCAGAGGGGTGGGGGACGG + Intronic
1190662342 X:52666449-52666471 CTATTCAGATGGTTGGGGGCAGG - Intronic
1191932016 X:66383970-66383992 ATGTCTACATGGCTGGGGAAAGG - Intergenic
1192230252 X:69259754-69259776 TGGACCAGATGGCTGGTGGAGGG - Intergenic
1195168675 X:102245235-102245257 CTTCACAGATGGCTGGGGGTGGG - Intergenic
1195190182 X:102441852-102441874 CTTCACAGATGGCTGGGGGTGGG + Intronic
1196745073 X:119064374-119064396 TTGGCTAGATGACTGGGGGAAGG + Intergenic
1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG + Intergenic
1198079597 X:133226826-133226848 CTGTCCGGAAGGTTGGGGGAGGG - Intergenic
1198979683 X:142380901-142380923 CTGTCCTGATGGCTGGATGCTGG - Intergenic
1199550163 X:149052175-149052197 CTGTCCTGAGGGTGGGGGGAGGG + Intergenic
1200686517 Y:6264309-6264331 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200775522 Y:7167020-7167042 CTCTCTGGATGGCTGGGGAATGG - Intergenic
1200989387 Y:9335225-9335247 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200992062 Y:9355558-9355580 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200994715 Y:9375836-9375858 CTGGCCAAATGTCTGGGAGATGG - Intronic
1200997378 Y:9396182-9396204 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1200999892 Y:9464719-9464741 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201002551 Y:9485028-9485050 CTGGCCAAATGTCTGGGAGATGG - Intronic
1201005208 Y:9505313-9505335 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201007869 Y:9525642-9525664 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201010485 Y:9545832-9545854 CTGGCCAAATGTCTGGGAGATGG - Intergenic
1201725412 Y:17144830-17144852 CCATTCAGATGGTTGGGGGAGGG + Intergenic
1202168922 Y:22020347-22020369 CTGTCCAGGTGGCTGAGCCATGG - Intergenic
1202222439 Y:22566021-22566043 CTGTCCAGGTGGCTGAGCCATGG + Intergenic
1202320676 Y:23629639-23629661 CTGTCCAGGTGGCTGAGCCATGG - Intergenic
1202550091 Y:26040417-26040439 CTGTCCAGGTGGCTGAGCCATGG + Intergenic