ID: 1091770249

View in Genome Browser
Species Human (GRCh38)
Location 12:3146736-3146758
Sequence CCTGGGATTCTGTGCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 307}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091770243_1091770249 -3 Left 1091770243 12:3146716-3146738 CCACCCAGTGCTGAGATCTTCCT 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770245_1091770249 -6 Left 1091770245 12:3146719-3146741 CCCAGTGCTGAGATCTTCCTGGG 0: 1
1: 0
2: 7
3: 40
4: 354
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770239_1091770249 26 Left 1091770239 12:3146687-3146709 CCTGCTTTGTGTCTATGGCCTTT 0: 1
1: 0
2: 2
3: 17
4: 217
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770240_1091770249 8 Left 1091770240 12:3146705-3146727 CCTTTCTCCACCCACCCAGTGCT 0: 1
1: 0
2: 3
3: 55
4: 462
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770238_1091770249 29 Left 1091770238 12:3146684-3146706 CCACCTGCTTTGTGTCTATGGCC 0: 1
1: 0
2: 1
3: 22
4: 243
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770241_1091770249 1 Left 1091770241 12:3146712-3146734 CCACCCACCCAGTGCTGAGATCT 0: 1
1: 1
2: 2
3: 34
4: 294
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770242_1091770249 -2 Left 1091770242 12:3146715-3146737 CCCACCCAGTGCTGAGATCTTCC 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307
1091770247_1091770249 -7 Left 1091770247 12:3146720-3146742 CCAGTGCTGAGATCTTCCTGGGA 0: 1
1: 0
2: 4
3: 26
4: 219
Right 1091770249 12:3146736-3146758 CCTGGGATTCTGTGCTCTCTAGG 0: 1
1: 0
2: 1
3: 40
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091770249 Original CRISPR CCTGGGATTCTGTGCTCTCT AGG Intronic