ID: 1091770640

View in Genome Browser
Species Human (GRCh38)
Location 12:3148956-3148978
Sequence CTCCAGTTGCTGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091770631_1091770640 16 Left 1091770631 12:3148917-3148939 CCTGGCCGAGGTAACTTTGGCTC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 38
4: 416
1091770636_1091770640 -10 Left 1091770636 12:3148943-3148965 CCTCTAAGGAGGTCTCCAGTTGC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 38
4: 416
1091770632_1091770640 11 Left 1091770632 12:3148922-3148944 CCGAGGTAACTTTGGCTCCTGCC 0: 1
1: 0
2: 1
3: 17
4: 153
Right 1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 38
4: 416
1091770635_1091770640 -6 Left 1091770635 12:3148939-3148961 CCTGCCTCTAAGGAGGTCTCCAG 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 38
4: 416
1091770628_1091770640 29 Left 1091770628 12:3148904-3148926 CCTCTCGGGCGTGCCTGGCCGAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 38
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091770640 Original CRISPR CTCCAGTTGCTGAGGGAAGA GGG Intronic
902534697 1:17112718-17112740 CACCAGGTGGTGAGGGAAGCTGG - Intronic
902820234 1:18938979-18939001 CTCCTGTGGCTGGGGCAAGAAGG - Intronic
904757402 1:32775715-32775737 CTCCAGCTGCCAAGGGAAGAAGG + Exonic
904887004 1:33746368-33746390 CTAAAGTTTCAGAGGGAAGATGG + Intronic
904936061 1:34130594-34130616 CTCCAGCTGCTGTGTGAAGAAGG + Intronic
905582171 1:39090525-39090547 CCCCAGTTGGTGAGGGAAGGTGG + Intronic
905955223 1:41987849-41987871 CTCCTGCTGCTTAGTGAAGAAGG - Intronic
906659912 1:47574805-47574827 CTCCAGAGGCCGGGGGAAGAAGG - Intergenic
907011259 1:50965599-50965621 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
907104228 1:51866112-51866134 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
908880692 1:68729291-68729313 TTCAAATTGCTGAGGGAAAATGG - Intergenic
910484667 1:87700169-87700191 CTTCAGAAGCTGAGGCAAGAGGG + Intergenic
910493469 1:87799167-87799189 CTCCACTTACTGAGTGAACATGG - Intergenic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
911685565 1:100773046-100773068 CACCAGGGGCTAAGGGAAGAAGG - Intergenic
912349903 1:109002024-109002046 CTCTAGTTGCTTAGGGAATAAGG + Intronic
912473356 1:109920951-109920973 CTCCAGTGGGTGTGGGAAGCCGG + Intronic
912541435 1:110419176-110419198 CTCCTGTTGATGAGGGGAAATGG - Intergenic
915152261 1:153843400-153843422 CTCTAGTGGCTGAGGTAGGAGGG - Intronic
915155329 1:153871004-153871026 CTCCAGAGGCTGAGGCAAGAGGG - Intronic
915226530 1:154415869-154415891 CTCCGGAGGCTGAGGCAAGAGGG + Intronic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
916707316 1:167364680-167364702 CTCCAGAGGCTGAGGGAGAATGG - Intronic
917176322 1:172239624-172239646 CTCCAGAAGCTGAGGATAGATGG + Intronic
918102368 1:181387494-181387516 CTCCTGTGGCTGAGGGGAGCTGG - Intergenic
918332170 1:183471607-183471629 CCCCAGTTGCTGTGGGAAGTGGG + Intergenic
919028041 1:192202564-192202586 CTCCTGCTGCTTTGGGAAGAAGG - Intergenic
919197413 1:194305035-194305057 ATTCAATTGATGAGGGAAGATGG - Intergenic
919332038 1:196184341-196184363 CTCCAGAGGCTGAGTGAAGCAGG - Intergenic
920228272 1:204453663-204453685 CTACAGGAACTGAGGGAAGAAGG + Intronic
920341273 1:205276526-205276548 CTCCAGATGCAGATGGAAGGAGG + Intergenic
921346900 1:214195654-214195676 TTCCAGTTTCTGTGGGAAGGTGG + Intergenic
922939700 1:229451289-229451311 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923207347 1:231771910-231771932 CTCCAGATGCTGAGGCAGAAAGG - Intronic
923935165 1:238751785-238751807 ATGCAGTCACTGAGGGAAGAGGG - Intergenic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1064085635 10:12344351-12344373 ATGCAGTTGCTCAGGGAAGACGG - Intergenic
1064245931 10:13667585-13667607 CACCAGCTGCTGAGGGATGGGGG + Intronic
1065209494 10:23389079-23389101 CTCCTGTTGCCGTGTGAAGAAGG - Intergenic
1069380360 10:67838030-67838052 CTCTTGTTTCCGAGGGAAGAAGG - Exonic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070783264 10:79149469-79149491 CTCCAGTTCCTGAGGCCACAGGG + Intronic
1070916181 10:80156419-80156441 CTCAAGTTGCTTAGGGTGGAAGG - Intronic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1073541838 10:104321381-104321403 CAACAGGGGCTGAGGGAAGATGG + Intronic
1074114283 10:110443952-110443974 CTCCAGCTTCAGAGGGAAAATGG - Intergenic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075371966 10:121944961-121944983 CTCCTGTTGGTGAGCCAAGATGG - Intergenic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076242176 10:128916828-128916850 CTCCACTGGCAGAGGGAAAAGGG + Intergenic
1076616584 10:131759151-131759173 AGCCAGCTGCTGAGGGAAGCTGG - Intergenic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077613313 11:3658534-3658556 CCCCGGGTGCTGGGGGAAGAGGG - Intronic
1078357736 11:10644994-10645016 CTCCAGGTCCTGATGGGAGAAGG + Intronic
1079763176 11:24356533-24356555 CTCCTGCTCCTAAGGGAAGATGG - Intergenic
1081648684 11:44808289-44808311 CTCAAGATGCTGGAGGAAGATGG - Intronic
1083533349 11:63445826-63445848 CTCTAGCTGCTGTTGGAAGAAGG + Intergenic
1084062294 11:66684232-66684254 CTCCAGATGTTGATGGAAGTGGG - Intergenic
1084464831 11:69316429-69316451 GTCCAGTTGCTGAGGTGAAACGG - Intronic
1085461111 11:76693977-76693999 ATCCAGTTTCTGTGGGAAGCAGG - Intergenic
1088690453 11:112322202-112322224 ACCCAGATGCTGAGGCAAGAAGG - Intergenic
1088713258 11:112527027-112527049 CTCCAGATGTCTAGGGAAGAAGG + Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1088915641 11:114225789-114225811 ATCCAGTGGCTGGGTGAAGAAGG - Intronic
1089059818 11:115617280-115617302 CTCCAGCTGCAGACAGAAGAAGG - Intergenic
1089413920 11:118271005-118271027 CGCCAGGGGCTGGGGGAAGAGGG + Intergenic
1089683436 11:120132281-120132303 AACCACTTTCTGAGGGAAGAGGG - Intronic
1089691937 11:120192357-120192379 TCCCAGTTGCTGAGGCAAGGGGG + Intergenic
1091236348 11:134024816-134024838 CTCATGTTGCTGAGAGCAGATGG - Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1094243858 12:28263357-28263379 CGCCAGAGGCTGAGGGAAGGGGG - Intronic
1094713185 12:32985900-32985922 CTCCTGTAGCTGAAGGAACAAGG + Intergenic
1096194656 12:49642221-49642243 CTCCAGCAGCTGAGGAAAGAAGG - Exonic
1096627461 12:52904412-52904434 CTCCAGTTTAAAAGGGAAGAAGG + Intronic
1099464829 12:82970827-82970849 CTGCAGTTACTGAGAGAAAAAGG - Intronic
1099618911 12:84976007-84976029 CTTCACTGGCAGAGGGAAGAGGG - Intergenic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1101331531 12:103761502-103761524 CTCCAGTCTCTGGAGGAAGAGGG - Intronic
1101980829 12:109405718-109405740 CTTCAGGTGCTAAGGGAAGAGGG - Intronic
1102260138 12:111438394-111438416 CTCCAGCTGGCCAGGGAAGAGGG - Intronic
1102445994 12:113003195-113003217 CTCAAGTTTCTGAAGGTAGATGG - Intronic
1103094726 12:118123607-118123629 CTCCAGAGGCTGAGGTAAGAGGG - Intronic
1103820141 12:123691307-123691329 TGCCAGGAGCTGAGGGAAGAGGG - Intronic
1104311816 12:127660176-127660198 CTGAAATTGCTGAGGGGAGAAGG - Intergenic
1104655804 12:130572999-130573021 CAGCAGTGGCTGTGGGAAGAAGG - Intronic
1104753336 12:131253699-131253721 CCCCATTTGATGAGGGAGGATGG + Intergenic
1106692773 13:32136246-32136268 CTCAAGTTGCTGCGGGAAGCTGG + Intronic
1107527237 13:41245346-41245368 CTCCAGTGGCTGAGGTGGGATGG - Intronic
1107959868 13:45548181-45548203 TTCCATTTCCTCAGGGAAGATGG - Intronic
1108911950 13:55565127-55565149 CTCCAGTTGTTGAGGTAAGTGGG - Intergenic
1109406190 13:61903334-61903356 CTCCACTGGCAGAGGGCAGAGGG - Intergenic
1109521877 13:63524068-63524090 CTTCATTTGCTGAGTGAAGTAGG - Intergenic
1111985373 13:95060905-95060927 CACCAGGGGCTGAGGGAAGGTGG - Intronic
1112264384 13:97909553-97909575 CTCCAGCTTATGGGGGAAGAAGG - Intergenic
1113126824 13:106988401-106988423 CTCCAGTGGCCATGGGAAGATGG + Intergenic
1113475332 13:110576475-110576497 CTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1113633049 13:111900968-111900990 CCCCAGTAGCTGAGGAAAGCCGG + Intergenic
1114302926 14:21394280-21394302 CTCCAGCTGCTGGGGGAAGGCGG + Exonic
1114549383 14:23524332-23524354 CTCTAGCTGCTCAGGCAAGATGG + Exonic
1115545930 14:34464724-34464746 CACCAGATGCTGAGGGTAGTTGG - Intergenic
1116393805 14:44423804-44423826 CTCCAGTTGCCATGTGAAGAAGG - Intergenic
1117483916 14:56174659-56174681 CTCCTGTTGCCGTGAGAAGAAGG + Intronic
1117499690 14:56339527-56339549 CCCTAGTTGCTGAAGGAAGATGG - Intergenic
1117962299 14:61175410-61175432 TGCCATTTGCTGATGGAAGAGGG + Intergenic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1121225484 14:92318847-92318869 CTCCAGATGCTGGGTGAAGAAGG + Intergenic
1121451315 14:94010061-94010083 CTCCAGGTGCTGCTGGGAGAGGG + Intergenic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1122145835 14:99688409-99688431 CTCCCTTTGCTCAGGGAAGTAGG - Intronic
1122177440 14:99931491-99931513 GTCCAGGTGCTCAGGGCAGAAGG - Intronic
1122378680 14:101286310-101286332 CTCCAGTAGCTGAGTGACCAGGG - Intergenic
1123625947 15:22226865-22226887 GACCAATTGCTGAGGGAAGAAGG + Intergenic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124997327 15:34736483-34736505 CTCCAGTTGCTGGAGGAAAGTGG + Intergenic
1125819916 15:42620371-42620393 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1125824171 15:42661550-42661572 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1125850209 15:42895929-42895951 TTCCAGGGGCTGAGAGAAGAAGG - Intronic
1126232637 15:46344743-46344765 CTCCTGTTGCTTTGGGAAAAGGG + Intergenic
1126366211 15:47897294-47897316 CTCCAATTGCTAAGAGCAGATGG + Intergenic
1127286380 15:57537274-57537296 CTGCAGTTGCCGAGGCAACAAGG - Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1128511321 15:68315671-68315693 CTCCAGGTGGTGTAGGAAGATGG + Exonic
1128521583 15:68378533-68378555 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1129115829 15:73364842-73364864 CTCCCATTGCTGGGGGAGGAAGG - Intronic
1129317629 15:74754955-74754977 CTCCAGTTGCTGTAGCAGGATGG - Exonic
1129762293 15:78136877-78136899 GTCCTGTTGTTGAGGGAGGAGGG + Intronic
1129920466 15:79315175-79315197 CTCCAACTGCTTAGGGAAGGTGG - Intronic
1132273807 15:100548914-100548936 CTCCAGCTACTGAGTGAACAGGG - Intergenic
1134138216 16:11694479-11694501 CTCCAGTTGCACAGGCTAGAGGG + Intronic
1134189661 16:12111445-12111467 CTCAAGTCTCTGAGGTAAGAAGG - Intronic
1134770678 16:16806344-16806366 ATCCAGTTGTTGAGGGATGGGGG + Intergenic
1134901570 16:17942829-17942851 CTCCTGGTCCTGTGGGAAGAAGG - Intergenic
1135015769 16:18923988-18924010 CTCCTGTTGTAGAGGGAACAGGG - Intronic
1135149520 16:19993332-19993354 CACTAGGTACTGAGGGAAGATGG + Intergenic
1135321385 16:21499803-21499825 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1135374218 16:21931298-21931320 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1135380376 16:21991341-21991363 CTCCAGGGGCTGAGGCAGGAGGG - Intronic
1135437568 16:22439416-22439438 CTCCTGTTGTAGAGGGAACAGGG + Intergenic
1136447560 16:30333008-30333030 CTCCTGTTGTAGAGGGAACAGGG - Intergenic
1137706099 16:50536889-50536911 CTCCAGAGGCTAAGGCAAGAGGG + Intergenic
1138171462 16:54853649-54853671 CTACAGTTGCTAAAAGAAGAGGG - Intergenic
1138605179 16:58083987-58084009 CTGCAGTGGCTAAGGGAAGGCGG + Intergenic
1139717035 16:68822004-68822026 CTCCAGTTGCTACTGGAACAGGG + Exonic
1140138773 16:72233741-72233763 TTCCAGGGGCTGAGGGAAGGAGG - Intergenic
1140194320 16:72844366-72844388 CTCCAATGGCTGAGGTCAGAGGG + Intronic
1140945955 16:79768676-79768698 CTCCTGCTGCGAAGGGAAGAAGG + Intergenic
1142176406 16:88647429-88647451 CTCCAGAGGCTGAGGTAAGAGGG + Intronic
1142423960 16:89990904-89990926 CTGCAGTTGCTTTGGCAAGAAGG - Intergenic
1144328055 17:14200531-14200553 CTCCATTTTCTGAGGAAGGAGGG + Intronic
1145784762 17:27586639-27586661 CTCCAATTGCTGTGGTAACACGG + Intronic
1145888064 17:28396447-28396469 CTCCAGATACTGAGGAAAGTGGG - Exonic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1149623078 17:58060594-58060616 CTCATGTTGCTGAGGACAGATGG - Intergenic
1149808192 17:59639249-59639271 CTCTAATTGCTTAGGGGAGAAGG + Intronic
1149914681 17:60598319-60598341 CTTGAGTTTCTGAGGGAGGAAGG + Intergenic
1150952082 17:69814824-69814846 TGCCAGCTGCTGAGGGGAGAAGG - Intergenic
1151167453 17:72217720-72217742 CTCCAGTTTCTCCCGGAAGAAGG + Intergenic
1151733589 17:75925194-75925216 CTGCAGGTGCTGAAGGAAGCGGG - Intronic
1203166930 17_GL000205v2_random:106025-106047 GTTCAGGGGCTGAGGGAAGAAGG + Intergenic
1153682989 18:7518035-7518057 CTTCAGTTGCTGAGGACAGATGG - Intergenic
1154163146 18:11994888-11994910 CTCCAGCTTCTGCGGGCAGAGGG - Intronic
1155499518 18:26472844-26472866 CTGCAGCTGCTGTGGGAAGCTGG + Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1156549899 18:38004482-38004504 CTCCAGTTGCTGACAGTGGAAGG - Intergenic
1157531387 18:48423734-48423756 TTCCAGGGGCTGAGGAAAGAAGG + Intergenic
1158052196 18:53235782-53235804 TACCAGTTTCTTAGGGAAGAGGG - Intronic
1159890152 18:73945307-73945329 CTCCAGTTACTGAGGCCAAATGG - Intergenic
1160066794 18:75583147-75583169 CTCCACTTGCTTAGGGAGGCTGG + Intergenic
1160347943 18:78150409-78150431 CTCCTGTTGCTTTGTGAAGAAGG + Intergenic
1160799757 19:962327-962349 CTGCTGCTGCTGAGGGGAGAGGG - Intronic
1163135079 19:15304642-15304664 GTCCACATGCTTAGGGAAGAAGG + Intronic
1163482485 19:17565905-17565927 CTTCAGTTGCAGAGGGGAGGTGG - Intronic
1163819988 19:19490935-19490957 CTCCATTTGCTGACGGCACAAGG - Intronic
1163943702 19:20517188-20517210 CTCCACCTGCTGAGGGAAGCCGG - Intergenic
1165103326 19:33453204-33453226 CTCCAGAGGCTGAGGGGGGAAGG + Intronic
1166142291 19:40811567-40811589 TTCCAGGTCCTAAGGGAAGAAGG - Intronic
1166297248 19:41895181-41895203 CTCCTGTGTCTGAGGGAGGAGGG + Intronic
1166525347 19:43507098-43507120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166531556 19:43546318-43546340 CTCCTGTGTCTGAGGGAGGAAGG - Intronic
1166569491 19:43784766-43784788 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166569532 19:43784891-43784913 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166662148 19:44654170-44654192 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166683499 19:44781797-44781819 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166683582 19:44782017-44782039 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166683606 19:44782091-44782113 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166685463 19:44793728-44793750 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166695831 19:44851098-44851120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167065632 19:47183768-47183790 CCCCTCTTGCCGAGGGAAGATGG - Intronic
1167248708 19:48389971-48389993 CTCCAGGGTCTGAGGGAGGAGGG - Intronic
1167265799 19:48482732-48482754 CTCCTGGGTCTGAGGGAAGAAGG - Intergenic
1167298285 19:48664397-48664419 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167298328 19:48664507-48664529 CTCCTGGGGCTGAGGGAGGAGGG - Intronic
1167322961 19:48807576-48807598 CTCCAGGGTCTGAGGGAGGAGGG - Intronic
1167327632 19:48835456-48835478 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167430121 19:49449373-49449395 CTCCAGGAGCTGAGGGAGGAGGG + Intronic
1167497672 19:49829098-49829120 CTCCAGGGTCTGAGGGACGAGGG + Intronic
1167738246 19:51310527-51310549 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738261 19:51310564-51310586 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738372 19:51310860-51310882 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738418 19:51310971-51310993 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738464 19:51311082-51311104 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738566 19:51311338-51311360 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167743382 19:51337717-51337739 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167795398 19:51704964-51704986 CTCCTGGTTCTGAGGGAGGAGGG - Intergenic
1167798752 19:51727012-51727034 CTCCAGGGTCTGAGGGAGGAGGG - Intergenic
1168097148 19:54122398-54122420 CTTCAGTTACTAAAGGAAGAAGG + Intronic
1168147844 19:54429742-54429764 CTCCTGAGTCTGAGGGAAGAGGG + Intronic
1168253665 19:55155255-55155277 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253691 19:55155327-55155349 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253729 19:55155435-55155457 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253743 19:55155471-55155493 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253834 19:55155724-55155746 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253849 19:55155761-55155783 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253863 19:55155797-55155819 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253877 19:55155833-55155855 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253917 19:55155941-55155963 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168277317 19:55285011-55285033 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
925441906 2:3895319-3895341 CTGCAGCTGCTGTGGGAAGATGG + Intergenic
925448153 2:3945656-3945678 CTCCTGTAGCTGAGAGAACAGGG - Intergenic
926219001 2:10922777-10922799 CTGCACTTTCTGAGGAAAGAGGG + Intergenic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927364151 2:22274709-22274731 CTCCAGTTTCAGAGGAAATAAGG + Intergenic
928395411 2:30939811-30939833 CTCCAGCTGCGAAGGGGAGATGG - Intronic
929121840 2:38489957-38489979 GTCCAGCAGCTGTGGGAAGATGG - Intergenic
929346482 2:40890421-40890443 GTCCCGATGCTGGGGGAAGAGGG - Intergenic
931473300 2:62562237-62562259 TTCCAGAGGCTGAGGGCAGAAGG - Intergenic
931643106 2:64398674-64398696 TTCCAGGAGCTGAGGGAAGGAGG + Intergenic
931726560 2:65117171-65117193 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
931847539 2:66220105-66220127 GTCCAGGTGTTGAGGGATGATGG - Intergenic
932068096 2:68588244-68588266 AACCAGTTGCTGAGGTCAGAAGG - Intronic
932507582 2:72250943-72250965 CTCCAGAGGCTGAGGTAAGAGGG - Intronic
936398168 2:112145377-112145399 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
936600351 2:113889630-113889652 CTCCAGTGCCTGAGAGAAAACGG - Intergenic
937390550 2:121482251-121482273 GTCCAGGTGCAGAGGGAAGCTGG - Intronic
937844972 2:126569658-126569680 CTCCGGAGGCTGAGGCAAGAGGG + Intergenic
937856024 2:126672536-126672558 CTGCAGGTGCTGAGGGGACAGGG - Intronic
937860358 2:126703402-126703424 CTCCAGATGAAGAGGGAAGGTGG - Intergenic
938772419 2:134511666-134511688 TTCCAGCTGCTGAGGGAATAAGG + Intronic
942125036 2:172815742-172815764 CTCAAATTGCTGAGAGAGGATGG + Intronic
944550673 2:200841828-200841850 CTCCAGAGGCTGAGGCAGGAAGG + Intergenic
947254597 2:228148208-228148230 CTACTCTTGCTGAGAGAAGAGGG + Intronic
947711833 2:232320991-232321013 CACGAGTTGCTGAGTGGAGAAGG + Intronic
948187655 2:236034402-236034424 CTCCACCTGCTGTGGAAAGAGGG - Intronic
948379389 2:237542138-237542160 CCCCAGCTGCTGTGGGAGGAGGG + Intronic
948914572 2:241026907-241026929 TTCCAGGTGTTGAAGGAAGAGGG - Intronic
1169076695 20:2764401-2764423 CTCAAGTGGCTGAGGCAGGAGGG - Intergenic
1170462095 20:16586993-16587015 ATCAAGTCACTGAGGGAAGATGG - Intergenic
1172106812 20:32521990-32522012 CTGCAGTTGCTGTGGGAAGGCGG - Intronic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172202466 20:33136149-33136171 CTCAGGTTGCTGAGGGATGGAGG - Intergenic
1173297447 20:41772145-41772167 TCCCAGTAGCTGAGGGATGATGG - Intergenic
1173722347 20:45270371-45270393 CTCCAGAGGCTGAGGTGAGAGGG + Intergenic
1174244240 20:49164406-49164428 CTCCAGAGGCTGAGGCAGGAGGG - Intronic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1175770687 20:61622306-61622328 CTCCCCTTTCTGAGGGAAGGAGG - Intronic
1176222812 20:63978173-63978195 ATGCAGTTACTGTGGGAAGAGGG - Intronic
1176404825 21:6353072-6353094 GTTCAGGGGCTGAGGGAAGAAGG - Intergenic
1176432332 21:6636032-6636054 GTTCAGGGGCTGAGGGAAGAAGG + Intergenic
1177355275 21:19998832-19998854 CTCCACCTGCTGAGGGAGGTCGG - Intergenic
1177765384 21:25451278-25451300 CTCCAGTTGCCTTGTGAAGAAGG - Intergenic
1178496484 21:33090539-33090561 ATGCAGTGCCTGAGGGAAGAAGG - Intergenic
1179051239 21:37890203-37890225 CTCCTGTTGCCGTGTGAAGAAGG - Intronic
1179239108 21:39573223-39573245 CTCCAGGTGCTGTGGGTATAAGG - Intronic
1180357567 22:11855190-11855212 CTCCAGCCGCTGGGGGAAAAAGG + Intergenic
1180380698 22:12137143-12137165 CTCCAGCCGCTGGGGGAAAAAGG - Intergenic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181168116 22:20994090-20994112 CTCCAGCTTCTGTGGGGAGAAGG - Exonic
1181347674 22:22231882-22231904 TTCCAGGGGCTGAGGGGAGAGGG + Intergenic
1181892671 22:26077565-26077587 CTCCAGGTGCTGTGGAAAGGTGG - Intergenic
1181906781 22:26203936-26203958 CTACATTTGATGAGGCAAGAGGG + Intronic
1182711056 22:32323619-32323641 GCCCAGGGGCTGAGGGAAGAGGG + Intergenic
1182994325 22:34798856-34798878 CTGCAGTAGCTGGGGGAGGAGGG + Intergenic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
1183422395 22:37719457-37719479 CTTCAGATGCTCAGGGAAGCAGG + Intronic
1184003313 22:41690869-41690891 ATCATGGTGCTGAGGGAAGAAGG - Intronic
1184398588 22:44260493-44260515 GCCCAGGGGCTGAGGGAAGAGGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1185063441 22:48619004-48619026 GACCCATTGCTGAGGGAAGAAGG + Intronic
950348107 3:12318079-12318101 CTCCGGTGGCTGAGGCAAGAGGG - Intronic
950491684 3:13309122-13309144 CTCCAGCTGCTGTGGCCAGATGG - Intergenic
952927241 3:38329097-38329119 CTCCAGCTGCAGAGGGCAGGTGG + Intergenic
953167802 3:40481164-40481186 CTCCAGCTTCTCAGGGAAGAAGG - Intronic
953435622 3:42875020-42875042 CTTCAGTTTCTGAGGGAGCAGGG - Exonic
953937918 3:47062338-47062360 GTTCAGTTGCTAAGGGAAAAGGG + Exonic
955322812 3:57986364-57986386 CTCCACTTGGAGAGGGGAGATGG + Intergenic
955364532 3:58299821-58299843 CTCCAGTAGCTGCTGGCAGAGGG + Intergenic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
956288204 3:67632720-67632742 CTCCAATTGCAGATGGAAAACGG + Intronic
956963402 3:74430498-74430520 CTCCAGAGGCTGAGGTAGGAGGG + Intronic
957128860 3:76198146-76198168 CACCATGTCCTGAGGGAAGAGGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957991382 3:87631616-87631638 CTCGAGTTGCCAAGGCAAGATGG - Intergenic
958956022 3:100466645-100466667 CTCCCCTTGCTGAGCCAAGAAGG + Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959810316 3:110611396-110611418 CTACACTTGCTGAGGAATGATGG + Intergenic
960048964 3:113222801-113222823 CTCAGGTTGCTAAGGGAGGAGGG - Intronic
960147678 3:114220242-114220264 CTCCAGTTTGTCAGTGAAGAAGG + Intergenic
960148750 3:114230892-114230914 CTCCCTCAGCTGAGGGAAGAGGG - Intergenic
960707364 3:120493920-120493942 CTCCTGTAGCTAAAGGAAGAAGG - Intergenic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
961785801 3:129345934-129345956 CTCCAGTGGGAGAGGGAAGGTGG - Intergenic
962371778 3:134826757-134826779 GTCCCGTTCCCGAGGGAAGAGGG + Intronic
963379070 3:144506013-144506035 CTCCAGTTGCTTCAGGATGATGG + Intergenic
964470240 3:157045466-157045488 CTGCCCTTGCTGAGGGAACACGG - Intronic
965595668 3:170408570-170408592 CTCGAGAGGCTGAGGCAAGAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967649940 3:191973744-191973766 CTGCAGCTGCTAAGGAAAGAGGG + Intergenic
968468620 4:765850-765872 CAGAAGTTGCTGGGGGAAGACGG - Intronic
968578300 4:1378044-1378066 CTCCACTTGGTGAGGGAATGTGG - Intronic
968699689 4:2048680-2048702 CCCCAGGTGGTCAGGGAAGAGGG - Intergenic
969328928 4:6461767-6461789 CAGCACTTTCTGAGGGAAGAGGG - Intronic
969588326 4:8107313-8107335 CTGCAGATGCTTTGGGAAGATGG - Intronic
969935612 4:10677524-10677546 CCCCAGGTGCTGAGGGAGGGAGG + Intronic
970729672 4:19088302-19088324 CTCCAGTTGCTTCAGGATGATGG - Intergenic
971119792 4:23690426-23690448 CTCCTGCTGCTGTGTGAAGAAGG + Intergenic
971362164 4:25948147-25948169 CACCAGGGGCTGAGGGGAGAGGG - Intergenic
973729003 4:53805110-53805132 CTCCAGTTGCTGAAGGACAAGGG + Intronic
974818127 4:67032408-67032430 CACCACTTGCTGGAGGAAGATGG + Intergenic
975555208 4:75656337-75656359 CTCCAGTTTTTGAGAGAACAGGG - Intronic
977555743 4:98485889-98485911 CTTCATTTGCTGAGGAAGGATGG - Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978934666 4:114359889-114359911 CTCCACTTGAGGAGAGAAGAGGG - Intergenic
980292972 4:130869526-130869548 CCCCACGTGCTGAGGGAGGAAGG + Intergenic
980613490 4:135188060-135188082 CTACAGTTGATGTAGGAAGATGG - Intergenic
980881481 4:138714245-138714267 CTCCAGTTAATTAGGGTAGAGGG + Intergenic
981073448 4:140568726-140568748 CTCCAGTCTCTGAGTGAAGATGG - Exonic
981561436 4:146052715-146052737 CCCCAGTTGCTTAGGAAAAATGG - Intergenic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
984813257 4:183814314-183814336 AACCAGATGCTTAGGGAAGATGG + Intergenic
984928277 4:184825715-184825737 CTCCGGCTGCCGAGGGAAGCGGG + Intronic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
986312459 5:6562715-6562737 CCCCAGGGGCTGGGGGAAGAGGG + Intergenic
987372614 5:17207262-17207284 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
988179648 5:27773317-27773339 CTCCAGATGCTGAGAGAAAGTGG + Intergenic
989812901 5:45698075-45698097 TACCAGGTGCTGAGGGCAGAAGG + Intergenic
990245408 5:53859226-53859248 CTCCTGTGGCTGAAGGAACAAGG + Intergenic
998367154 5:141638941-141638963 CAGCATTGGCTGAGGGAAGAAGG - Exonic
1001085470 5:168697181-168697203 CTCCAGCTTCTGGGGGATGAAGG + Intronic
1001331994 5:170768949-170768971 CTCCAGTTGCTCTGGCAACAGGG - Intronic
1002436773 5:179236290-179236312 CTTCAGGTGCTTGGGGAAGAGGG + Intronic
1002712167 5:181201925-181201947 CTCCAGTGGAGGAGGGATGAAGG + Intronic
1002782000 6:374122-374144 CTCCTTCTGCTGAGGGATGAGGG + Intergenic
1002905078 6:1441651-1441673 CTCCAGTTGCTGATAGACAATGG + Intergenic
1003162146 6:3645286-3645308 ATCCAGGTGCTGAGGCAATAAGG - Intergenic
1003241141 6:4346835-4346857 CTCCAGCCTCTGTGGGAAGAAGG - Intergenic
1003563310 6:7201871-7201893 CTCCAGTTTCTGTTGGTAGATGG + Intronic
1005426335 6:25706630-25706652 CTCCAGATTCTGAGGCAAGAAGG + Intergenic
1005945562 6:30592830-30592852 ATCCAGTTCCAGAGGGAATAGGG + Intronic
1006135862 6:31896474-31896496 CCCCCCTTGCTGGGGGAAGAGGG + Exonic
1006316077 6:33292595-33292617 GTTCAGTGGCTGAGGGTAGAAGG - Intronic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1008480159 6:51977807-51977829 GCCCAGTGGCAGAGGGAAGAGGG + Intronic
1009554895 6:65149948-65149970 CTCCTGCTGCTTTGGGAAGAAGG - Intronic
1011704266 6:89985424-89985446 CTCCAGATGCTGTGGGGAGGTGG + Intronic
1013408800 6:109866108-109866130 CTTCAGTAGCTGCGGGAGGAAGG + Intergenic
1014153109 6:118081525-118081547 CTCAAGAGGCTGAGGCAAGAGGG + Intronic
1015543057 6:134335124-134335146 CTCCAGAGGCTGAGGAGAGAGGG - Intergenic
1015610081 6:135007768-135007790 TTCCAGTTGTTTGGGGAAGATGG - Intronic
1016630553 6:146225015-146225037 ATCCAGATGCTCAGGGATGATGG - Intronic
1018165565 6:161090919-161090941 CTCCAGACGCTGAGGGGAGGGGG + Intronic
1018381200 6:163259858-163259880 CCCCAGAGGCTGAGGGATGAGGG + Intronic
1021285291 7:18773503-18773525 CTGCAGTTGCTGAAGGTAAATGG + Intronic
1023849592 7:44142798-44142820 CTCCAGAGGCTGAGGCAGGAAGG - Intergenic
1023911562 7:44560251-44560273 CTGCAGGTTCTGATGGAAGAGGG + Intergenic
1024322937 7:48088338-48088360 CTCCAGTTCCTGAGAAAACATGG - Intergenic
1024353909 7:48395229-48395251 CTCCAGTTGCAGGTGGAGGATGG + Intronic
1025149722 7:56539059-56539081 CTCCGGTTGGAGAGGGCAGAGGG - Intergenic
1026940153 7:74283085-74283107 CTCCTGTTGCTGGGAGGAGATGG + Intergenic
1027466472 7:78521539-78521561 CTCCAAGTGCTGAAGGAAAACGG - Exonic
1028913773 7:96236721-96236743 TTCCAACTGCTGTGGGAAGATGG + Intronic
1029086191 7:98013570-98013592 TTCCAGCTGCTGCGGGAGGAGGG - Intergenic
1029682296 7:102119909-102119931 CTCCATTTGCTAAGAGAAGCGGG - Intronic
1029695866 7:102212813-102212835 CTCCATGTGCTGATGGAGGAAGG - Intronic
1030622951 7:111812041-111812063 CTCCAGATGCTTACTGAAGAAGG - Intronic
1030993917 7:116335036-116335058 CTCCACTAGCTGAAGTAAGAGGG - Intronic
1031192403 7:118570735-118570757 TGCCAGGGGCTGAGGGAAGAAGG + Intergenic
1031323479 7:120363186-120363208 CTCGGGTGGCTGAGGAAAGAGGG + Intronic
1032390705 7:131553757-131553779 TTTCAGTAGCTGAGGGAACACGG + Intronic
1032584714 7:133135535-133135557 CTCCAGTTGCTGCAAGTAGAAGG + Intergenic
1032890172 7:136185935-136185957 TGCCAGATGCTGAGGGAAGAGGG - Intergenic
1032891668 7:136201199-136201221 CTCCAGGGGCTGAGGAAAGGTGG + Intergenic
1033933007 7:146547494-146547516 TTCCAGGAGCTGAGGGAAGAGGG - Intronic
1034032604 7:147784900-147784922 ATGCAGTGGCTGTGGGAAGAGGG + Intronic
1034255953 7:149724782-149724804 CTCCAGTGGCTGAGGGACTGAGG - Exonic
1034409371 7:150931685-150931707 TGCCAGGAGCTGAGGGAAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034578921 7:152025911-152025933 CTCGAGGTGCTGAGGGACGCCGG - Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035288005 7:157818602-157818624 CTCCTGTGGCTGAGTGATGAGGG + Intronic
1035778690 8:2209695-2209717 CTGCAGGTGCTGAGGACAGAGGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036985396 8:13523008-13523030 CTCAAGTTGTTAAGGAAAGAAGG + Intergenic
1037493755 8:19419720-19419742 TCCCAGTTGCAGACGGAAGAGGG + Intronic
1037531594 8:19780683-19780705 CTCCAGGTGATGAAGTAAGAAGG - Intergenic
1037572266 8:20168257-20168279 CTCAAGAAGCTGAGGCAAGAGGG + Intronic
1037574304 8:20186591-20186613 TTCCAGGGTCTGAGGGAAGAGGG + Intergenic
1038315038 8:26477038-26477060 CACCAGTTAGTGAGGGAAGAAGG + Intronic
1038599297 8:28923190-28923212 CTGCAGTTGCTAGGGGATGAGGG - Intronic
1042428129 8:68672867-68672889 CTCCACTTGAGGAGAGAAGAGGG + Intronic
1042600387 8:70493748-70493770 CACAAGTTGCTCAGGGCAGAAGG + Intergenic
1044857242 8:96489138-96489160 CTCGGGTGGCTGAGGTAAGAGGG - Intergenic
1045260782 8:100571552-100571574 CTGCAGGTGCTGGGAGAAGATGG - Intergenic
1045964419 8:108007830-108007852 CTCCAGAGGCTGAGGCAGGAGGG + Intronic
1047611235 8:126522831-126522853 CCCCAGCTGCTGTGGGAAGGTGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049046816 8:140158947-140158969 TTCCAGTAGCTGATGGATGATGG - Intronic
1049450663 8:142659819-142659841 GTGAAGTTGCTGAGGGCAGAGGG - Intronic
1049619928 8:143593501-143593523 CTCCCGTTGGTGAAGGAAGACGG - Intronic
1050105059 9:2156872-2156894 TACCAGCGGCTGAGGGAAGACGG - Intronic
1050508163 9:6368819-6368841 CTCCATTTGAGGAGAGAAGAGGG + Intergenic
1050783181 9:9365042-9365064 TTCCAGTTTCTCAGGTAAGATGG - Intronic
1051870956 9:21736957-21736979 CTGAAGTTGCTGATGTAAGAAGG + Intergenic
1053269142 9:36738352-36738374 ATCCACTTGCTGAGTGAAAAGGG + Intergenic
1053426639 9:38014492-38014514 CTCCAGTGGCTCAGGGAAGCAGG - Intronic
1054996790 9:71400468-71400490 ACCCAGTTGATGAGAGAAGAGGG - Intronic
1055214733 9:73845376-73845398 CTCAGGAGGCTGAGGGAAGAAGG + Intergenic
1055991647 9:82112630-82112652 CTCCAGTTGCTATGGGAGGTTGG - Intergenic
1056807412 9:89739710-89739732 CTGCAGTTGCTGAGGTCAGCTGG - Intergenic
1057176597 9:93004748-93004770 CTCCTGATGCAGAGGGAAGCCGG - Intronic
1058091613 9:100812340-100812362 ATCCAGGGGCTGAGCGAAGAGGG + Intergenic
1059698940 9:116756662-116756684 TTCCAGCTGCTGATAGAAGAAGG - Intronic
1060145108 9:121245858-121245880 CTCAAGAGGCTGAGGCAAGAGGG - Intronic
1060405596 9:123371475-123371497 ATCCAGTGGCAGAGGAAAGAAGG - Exonic
1061205446 9:129160470-129160492 CTCCAGGTGCTGGGGACAGAGGG + Intergenic
1061826375 9:133260831-133260853 CTCCAGCTGCTGTGAGAAGAAGG + Intronic
1062512621 9:136915606-136915628 CTCGAGTCCCTGATGGAAGATGG - Intronic
1062722293 9:138050750-138050772 CTCCGCCAGCTGAGGGAAGAGGG - Intronic
1203439206 Un_GL000195v1:172680-172702 GTTCAGGGGCTGAGGGAAGAAGG - Intergenic
1185837544 X:3359451-3359473 GTCCACATGCTAAGGGAAGAAGG - Intergenic
1185863891 X:3605381-3605403 CTCCAGCTACTGAGTGAACAGGG - Exonic
1186046144 X:5538442-5538464 CTGCAGATTCTGAGAGAAGAGGG - Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186276095 X:7939665-7939687 CTCCACCTGCTGAGTGAGGAAGG + Intergenic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186896594 X:14009983-14010005 CAACACTTGCTGAAGGAAGAAGG + Intronic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1188807986 X:34614875-34614897 CTCCAGGTGTTGAGGGAGGGTGG - Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190219107 X:48499541-48499563 GCCACGTTGCTGAGGGAAGAGGG + Intergenic
1192167950 X:68837714-68837736 CTCCAGCTCCTGAGAGGAGATGG - Intronic
1192286420 X:69742896-69742918 TTCCAGTTGTTTAAGGAAGAAGG + Intronic
1194477567 X:94378010-94378032 CTCCAGTTCCAAAGTGAAGATGG + Intergenic
1197131915 X:123015086-123015108 CTCCAGAAGCTGAGGCCAGAGGG + Intergenic
1197170252 X:123426052-123426074 CTCCAGGCTCTGTGGGAAGAGGG - Intronic
1198378436 X:136061867-136061889 CTCCAGCTGCTAAGGTAAAAAGG - Intergenic
1199592841 X:149483814-149483836 TTCCAGTTGCTGGGTGAGGATGG - Intronic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1200081957 X:153581638-153581660 ATCCAGGTGCTGAGGGGACAGGG - Exonic
1200925124 Y:8647484-8647506 CTCCACCTGATGAGGGAAGTTGG + Intergenic
1201553236 Y:15240559-15240581 CTCCAGAGGCTGAGGGGGGAGGG + Intergenic