ID: 1091774546

View in Genome Browser
Species Human (GRCh38)
Location 12:3175835-3175857
Sequence CCACCTCCCTGTTTGATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091774546_1091774551 18 Left 1091774546 12:3175835-3175857 CCTGGAATCAAACAGGGAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217
Right 1091774551 12:3175876-3175898 TAAAAATGAGCATTGATTTCTGG 0: 1
1: 0
2: 3
3: 53
4: 606
1091774546_1091774553 25 Left 1091774546 12:3175835-3175857 CCTGGAATCAAACAGGGAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217
Right 1091774553 12:3175883-3175905 GAGCATTGATTTCTGGGAATCGG 0: 1
1: 0
2: 0
3: 16
4: 181
1091774546_1091774552 19 Left 1091774546 12:3175835-3175857 CCTGGAATCAAACAGGGAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217
Right 1091774552 12:3175877-3175899 AAAAATGAGCATTGATTTCTGGG 0: 1
1: 0
2: 4
3: 56
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091774546 Original CRISPR CCACCTCCCTGTTTGATTCC AGG (reversed) Intronic