ID: 1091774552

View in Genome Browser
Species Human (GRCh38)
Location 12:3175877-3175899
Sequence AAAAATGAGCATTGATTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 684}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091774546_1091774552 19 Left 1091774546 12:3175835-3175857 CCTGGAATCAAACAGGGAGGTGG 0: 1
1: 0
2: 2
3: 24
4: 217
Right 1091774552 12:3175877-3175899 AAAAATGAGCATTGATTTCTGGG 0: 1
1: 0
2: 4
3: 56
4: 684
1091774545_1091774552 20 Left 1091774545 12:3175834-3175856 CCCTGGAATCAAACAGGGAGGTG 0: 1
1: 1
2: 3
3: 19
4: 197
Right 1091774552 12:3175877-3175899 AAAAATGAGCATTGATTTCTGGG 0: 1
1: 0
2: 4
3: 56
4: 684
1091774543_1091774552 24 Left 1091774543 12:3175830-3175852 CCGACCCTGGAATCAAACAGGGA 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1091774552 12:3175877-3175899 AAAAATGAGCATTGATTTCTGGG 0: 1
1: 0
2: 4
3: 56
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091774552 Original CRISPR AAAAATGAGCATTGATTTCT GGG Intronic