ID: 1091777938

View in Genome Browser
Species Human (GRCh38)
Location 12:3196905-3196927
Sequence GCCTGGACAAAGTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091777935_1091777938 2 Left 1091777935 12:3196880-3196902 CCAGGGACAATGAGGCAACTATT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091777938 Original CRISPR GCCTGGACAAAGTGTGAGCT GGG Intronic
900011591 1:115725-115747 AGCTGGACAAACTGTGTGCTGGG - Intergenic
901514548 1:9736240-9736262 GCCTGGAGAAAGGGAGAGTTGGG + Intronic
901838802 1:11940828-11940850 GCCTGGCCTAACAGTGAGCTGGG + Intronic
901884616 1:12214297-12214319 GCCTGGAAGAATTGTGAGCAAGG - Intergenic
905973217 1:42156269-42156291 GGCTGGGAAAAGTGGGAGCTTGG - Intergenic
908329403 1:63055874-63055896 GCCTGGACTTAGACTGAGCTGGG + Intergenic
909117046 1:71550411-71550433 GCCAGGAGCAAGTGTGAGTTAGG - Intronic
910134546 1:83951844-83951866 GCCGGGACAAAGTTTGAAATTGG - Exonic
911101806 1:94101409-94101431 GCCTGGAGGCAGGGTGAGCTTGG - Intronic
912564701 1:110579349-110579371 GCCTCAGCAAAGTGAGAGCTTGG + Intergenic
912673057 1:111649276-111649298 ACCTGGACAGAGTGAGAGCCTGG - Intronic
913179131 1:116302498-116302520 GCCTGGACAATGAGTGATCAAGG - Intergenic
913509559 1:119549557-119549579 GGCTTGAGAAAGTGTGTGCTTGG - Intergenic
913517041 1:119613686-119613708 GGCTTGAGAAAGTGTGTGCTTGG - Intergenic
915269646 1:154744647-154744669 ACCTGGACAAAGGCAGAGCTGGG - Intronic
918861764 1:189836649-189836671 GCATGGAAAAATTGTGAACTGGG + Intergenic
919484234 1:198127358-198127380 GGCTGGACAGTGTGTGATCTTGG - Intergenic
923779895 1:237012844-237012866 TCCGGGACAAAGTCTGAGCTAGG - Intergenic
924442487 1:244097844-244097866 GCATGGAAAAACTGTGGGCTAGG - Intergenic
924625808 1:245695765-245695787 GCCAGGGCACCGTGTGAGCTGGG - Intronic
924625821 1:245695832-245695854 GCCAGGGCACCGTGTGAGCTGGG - Intronic
924625834 1:245695899-245695921 GCCAGGGCACCGTGTGAGCTGGG - Intronic
924919410 1:248612027-248612049 GCCTGGAGGCAGTGTGAGCAGGG - Intergenic
1063057805 10:2522643-2522665 GCCTGGATAAGGTGTGGGCGTGG - Intergenic
1063057812 10:2522671-2522693 GCCTGGATAAGGTGTGGGCGTGG - Intergenic
1063109851 10:3025915-3025937 GCCTGGTCAAAGTTTGAGGAAGG - Intergenic
1063493653 10:6487427-6487449 GCGTGGACACTGTGTGACCTTGG + Intronic
1065562801 10:26980524-26980546 ACCTGGTCAAAGGCTGAGCTAGG - Intergenic
1067077574 10:43196918-43196940 GCCTGGACAAGGAGTCAGGTGGG + Intronic
1067538905 10:47137487-47137509 GGCTGGACCAAGGGTGAGGTGGG - Intergenic
1068884462 10:62084171-62084193 GCTTGGACAAGGTATGAGCAAGG - Intronic
1069317529 10:67125740-67125762 GCCTGGACAGAGTGTGAAATGGG + Intronic
1069691060 10:70353028-70353050 GCCAGGCCAGAGTCTGAGCTAGG - Intronic
1069727838 10:70592704-70592726 CCCTGGACAGGGAGTGAGCTGGG + Intergenic
1070310887 10:75273045-75273067 GCCTGGACACAGTTTCGGCTGGG + Intergenic
1073694384 10:105848924-105848946 ACCTGGAGAAAGTGTCAGGTAGG + Intergenic
1074924534 10:118053990-118054012 GCACGGACAAAGGGTGACCTAGG + Intergenic
1076059249 10:127400675-127400697 GGCTGGACATAGAGTAAGCTGGG + Intronic
1077469043 11:2748289-2748311 GCGTGGACCCAGGGTGAGCTAGG - Intronic
1081264204 11:40999241-40999263 GGCTAGACACAGTGTGAGCGAGG - Intronic
1081832846 11:46128812-46128834 GACTGGACAAACTGCTAGCTGGG - Intergenic
1084502764 11:69544638-69544660 GCCTGGACAGAGTCTGTGCCAGG + Intergenic
1084579373 11:70013475-70013497 GCCATAACAAAGTGTCAGCTGGG + Intergenic
1085744364 11:79102011-79102033 GCTTGGGCAAAGTATGACCTTGG + Intronic
1089180805 11:116581583-116581605 GCCAGAACAAACTCTGAGCTCGG - Intergenic
1089208714 11:116786501-116786523 GCCTGCACGAAGGGTAAGCTGGG - Exonic
1089760637 11:120720493-120720515 GCCTGGACCACGTGGGAGGTAGG + Intronic
1091080306 11:132660843-132660865 TCCTGGACGAAGTGTGAAGTGGG + Intronic
1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG + Intronic
1091821554 12:3479254-3479276 GCCAGGCCCAAGTGAGAGCTGGG - Intronic
1095985271 12:47995185-47995207 GCCTGGAGAGGGTGTGTGCTTGG - Intronic
1095990413 12:48030421-48030443 GCCTGGCCATAGTGGGTGCTCGG - Intergenic
1098570178 12:71979660-71979682 TCCTGGACAATGGGTAAGCTAGG + Intronic
1101327336 12:103727575-103727597 TCCTGAACAAAGTATGAGGTTGG + Intronic
1101642200 12:106595181-106595203 GCCTGGACATATTGTTAACTAGG - Intronic
1104188565 12:126456104-126456126 GCCTGGACAGAGTCTGAGTGGGG - Intergenic
1104268853 12:127263909-127263931 GCCTGGAGCAGTTGTGAGCTAGG - Intergenic
1105257827 13:18756420-18756442 GCCTGGAAACAGTGGGAGTTGGG - Intergenic
1105857904 13:24388042-24388064 GCCTGGAGAGAGAGGGAGCTAGG + Intergenic
1106358509 13:29007926-29007948 GCCTGAACAACGTGGGAGTTAGG - Intronic
1110525992 13:76537626-76537648 GCCTGGTCAAAGTGTAATCTTGG + Intergenic
1119555069 14:75546778-75546800 GCCTGGACAAGGAGTGAACACGG + Exonic
1121775762 14:96589523-96589545 GCCTGGACACTGCGTGATCTTGG + Intergenic
1202833832 14_GL000009v2_random:63065-63087 GCCTGGAAACAGTGGGAGGTGGG + Intergenic
1125976247 15:43954459-43954481 GACAGGACAAAGTGAGAGCTGGG + Intronic
1126950316 15:53873465-53873487 GCCTTGTCAAATTGTGAGCTTGG + Intergenic
1127013973 15:54662178-54662200 GCCTGGACAAAATGTCAGTTAGG + Intergenic
1128116762 15:65112435-65112457 GCTTGGACAAACTGTAAGCCAGG + Intronic
1128812972 15:70585554-70585576 GACTGGACAACTTGGGAGCTGGG + Intergenic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1133509066 16:6440390-6440412 CCCTGGACAAATTATAAGCTTGG - Intronic
1134693488 16:16206298-16206320 GCATGGGCAAGGTGTGAGTTGGG + Intronic
1134978361 16:18588402-18588424 GCATGGGCAAGGTGTGAGTTGGG - Intergenic
1135955813 16:26955498-26955520 CCCTGGATAAAGTCTGAGTTTGG + Intergenic
1136281050 16:29211612-29211634 GCCAGGACCACGTGTGAGATGGG - Intergenic
1138500677 16:57441663-57441685 ACATGGATAAAGTGAGAGCTGGG + Intronic
1140477836 16:75247832-75247854 GCCAGCACAAGGTGGGAGCTGGG + Intronic
1141656580 16:85419927-85419949 GCAGGGGCAAAGTCTGAGCTAGG + Intergenic
1142803686 17:2360672-2360694 GACAGAACAAAGTCTGAGCTTGG - Intronic
1144760472 17:17704262-17704284 CCCTGCACAAGGTGTGACCTTGG + Intronic
1146536587 17:33657909-33657931 GCCTGGGGGAAGTGTGGGCTTGG + Intronic
1152756538 17:82089383-82089405 GCCTGGACATCGTGGGAGCCTGG + Exonic
1154428260 18:14288652-14288674 GCCTGGAAACAGTGGGAGCTGGG + Intergenic
1155984795 18:32218633-32218655 GCCTGGGCAGAGGGTGAGGTTGG + Intronic
1156617089 18:38799759-38799781 GCATGGACACAGGGTGAGGTTGG - Intergenic
1159978716 18:74749972-74749994 CACTGGACAAAGTATGAGGTTGG + Intronic
1163309418 19:16504271-16504293 GCCTGAACCAAGTGTGTGCCGGG - Intronic
1165766454 19:38354509-38354531 TCATGGACAGAGTGTGAGCAAGG + Intronic
1166040977 19:40202755-40202777 GCCGGGAAAGAGTGTGAGGTGGG - Intronic
1166085567 19:40472586-40472608 GCCTGGACATAGGGAGAGGTAGG - Exonic
1166544444 19:43625781-43625803 ACCTGGACAAACAGGGAGCTAGG - Intronic
927276135 2:21263980-21264002 GCCTGGACTTTGTATGAGCTTGG + Intergenic
928843639 2:35642000-35642022 CCCTGGTCATAGTGGGAGCTTGG + Intergenic
930167765 2:48220086-48220108 GCCTTGGCAATGTGTGATCTGGG - Intergenic
931332435 2:61301672-61301694 GGCTGAACATAGTGTGAGATAGG - Intronic
936292572 2:111237896-111237918 GCCTGGGCCAAGGGTGGGCTGGG - Intergenic
938063841 2:128270660-128270682 CCCTGGACACAGGGTCAGCTAGG - Intronic
938291953 2:130155242-130155264 TCCTGGACAAAGGGTGCCCTGGG + Exonic
947229253 2:227868747-227868769 GCTAGGAGAAAGTTTGAGCTGGG + Intergenic
947467804 2:230369445-230369467 GCCTGGGTTCAGTGTGAGCTTGG + Intronic
948886581 2:240887988-240888010 GCATTTACCAAGTGTGAGCTGGG + Intronic
1170383004 20:15782530-15782552 GCCTGGACAACATGGCAGCTGGG + Intronic
1171883628 20:30635865-30635887 GCCTGGAAACAGTGGGAGTTGGG - Intergenic
1171885443 20:30648754-30648776 GCCTGGAAACAGTGGGAGGTGGG - Intergenic
1172760149 20:37315847-37315869 GACTGGACAAAATGTGGGCGAGG - Intronic
1175173752 20:57097344-57097366 GCCTGGAGAACTTGTGAGCATGG + Intergenic
1176846496 21:13880770-13880792 GCCTGGAAACAGTGGGAGTTGGG - Intergenic
1177100552 21:16893913-16893935 ACCTGGACAGAGTGTGAGGAGGG - Intergenic
1178471994 21:32902117-32902139 GCCTGAAAAAGGTCTGAGCTGGG + Intergenic
1179680363 21:43016374-43016396 GCACGGACTAAGTGTGATCTTGG - Intronic
1180363118 22:11917262-11917284 GCCTGGAAACAGTGGGAGTTGGG + Intergenic
1180628319 22:17209412-17209434 GCCTGGAAAAAGTGCATGCTGGG + Exonic
1182668147 22:31973734-31973756 GCCTGGGCATGATGTGAGCTGGG - Intergenic
1182800711 22:33029762-33029784 GCCTGGACTCAGTCAGAGCTGGG - Intronic
1183253091 22:36744050-36744072 GCCTGGGGACAGTGTGGGCTGGG + Intergenic
950560597 3:13719362-13719384 TCCCGGCCAAAGTGTCAGCTTGG - Intergenic
960670570 3:120151948-120151970 GGCTGGACTATGTGAGAGCTGGG - Intergenic
963894788 3:150673747-150673769 GTCTCCACAAAGTGTTAGCTGGG - Intronic
966406652 3:179605034-179605056 GCCGGGACAAGTTGTGGGCTTGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970233028 4:13930332-13930354 TTCTGGGCAGAGTGTGAGCTAGG - Intergenic
971382057 4:26108069-26108091 GCCTGGAGAAAATGTCATCTGGG - Intergenic
973367283 4:49218135-49218157 GCCTGGAAACAGTGGGAGTTGGG - Intergenic
979111785 4:116767115-116767137 GGATCGACAAAGTGTGAGCAGGG + Intergenic
979882640 4:125981034-125981056 GCCTGGGCAAAGAGTGAGACTGG + Intergenic
985245505 4:187976292-187976314 GCGTGGACACAGAGTGAGGTTGG + Intergenic
1202766190 4_GL000008v2_random:150486-150508 GCCTGGAAACAGTGGGAGGTGGG - Intergenic
987294160 5:16535576-16535598 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294167 5:16535616-16535638 GCCTTCACGAAGTGGGAGCTGGG + Intronic
987294174 5:16535656-16535678 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294181 5:16535696-16535718 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294188 5:16535736-16535758 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294195 5:16535776-16535798 GCCTTCACGAAGTGGGAGCTGGG + Intronic
987294202 5:16535816-16535838 GCCTTCACGAAGTGGGAGCTGGG + Intronic
987294217 5:16535896-16535918 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294224 5:16535936-16535958 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294231 5:16535976-16535998 GCCTTCACGAAGTGGGAGCTGGG + Intronic
987320656 5:16766377-16766399 GCTTGGACGAAGTGTGGTCTGGG + Intronic
990872983 5:60454027-60454049 GCCTGGTCATTGTGTGGGCTTGG + Intronic
995487274 5:112651791-112651813 ACCTGGAGTCAGTGTGAGCTGGG - Intergenic
998012344 5:138705327-138705349 GCCAGGACAAAGAGGGAGGTGGG + Intronic
999479060 5:151928387-151928409 GCCTGGACAGAGTGAGTGCAGGG + Intergenic
1001426389 5:171625408-171625430 ACCTGGAGAAAGGGAGAGCTGGG + Intergenic
1002161282 5:177315227-177315249 TTCAGGACAAAGTTTGAGCTGGG + Intergenic
1002355295 5:178623668-178623690 GCCAGGACAAATTCTCAGCTTGG + Intronic
1002466313 5:179410596-179410618 ACCTGGACAAAGCCTGAGATGGG + Intergenic
1007496295 6:42262101-42262123 CCCTGGGCAAAGAGGGAGCTTGG + Intronic
1007702382 6:43772589-43772611 ACCAGGACAAAGTGTGTGCAAGG - Intronic
1015399076 6:132768306-132768328 GCCAGGACAGAGTGTGACCCTGG - Intergenic
1016590256 6:145735663-145735685 GCCTGGACGAAGTCTGGGCTCGG - Exonic
1017082620 6:150683805-150683827 GCCTGGACAAATCGTGTTCTGGG + Intronic
1021653544 7:22854032-22854054 GCCGGGGCAAAGTGGGAGCCGGG + Intergenic
1023165862 7:37343093-37343115 GTCTGGACAGAGAGTGAGCCTGG - Intronic
1023768712 7:43535509-43535531 GCCTGGACCCAGTGTGCACTGGG - Intronic
1023921657 7:44634770-44634792 GCCTGGGCAAGGTCTGAGCAAGG + Intronic
1024385184 7:48742993-48743015 GCCTGGCCAAAGTGGGGACTGGG - Intergenic
1024675869 7:51637581-51637603 GCCTGGGGGAAGTGGGAGCTGGG + Intergenic
1026616975 7:71913904-71913926 GCCTGTACAAGGAGTGAGTTAGG + Intronic
1029456561 7:100675013-100675035 GCCTGGGGGAAGTGGGAGCTGGG + Intronic
1029482705 7:100822796-100822818 GCCTGCAGAAAGTGTGCCCTGGG - Intronic
1030599737 7:111580228-111580250 CCCTGGACAAAATGTGAGGCAGG - Intergenic
1032932867 7:136694671-136694693 GCCTGGCACAAGTGTGGGCTTGG - Intergenic
1033546659 7:142407249-142407271 GCTTAGACAGAGTGGGAGCTGGG - Intergenic
1035388496 7:158490001-158490023 GCCTGGTCCAGGTGAGAGCTGGG - Intronic
1045906907 8:107356632-107356654 GCCTGGAAAAATTGAGGGCTAGG + Intronic
1049475374 8:142794709-142794731 GCCTGGCCAAGGTGTGAGGGAGG - Intergenic
1051816101 9:21106887-21106909 GACTGAACAGAGTGTGAGCTAGG - Intergenic
1051860041 9:21614348-21614370 TCCTGGACAAAGTGTCATCTTGG + Intergenic
1052879813 9:33594474-33594496 GCCTGGAAACAGTGGGAGTTGGG + Intergenic
1053496167 9:38549755-38549777 GCCTGGAAACAGTGGGAGTTGGG - Intronic
1053662817 9:40296215-40296237 GCCTGGAAACAGTGGGAGGTGGG + Intronic
1053664204 9:40306051-40306073 GCCTGGAAACAGTGGGAGGTGGG + Intronic
1053665171 9:40312256-40312278 GCCTGGAAACAGTGGGAGGTGGG + Intronic
1053665591 9:40315203-40315225 GCCTGGAAATAGTGGGAGTTGGG + Intronic
1053913264 9:42926390-42926412 GCCTGGAAACAGTGGGAGGTGGG + Intergenic
1053914750 9:42937303-42937325 GCCTGGAAACAGTGGGAGGTGGG + Intergenic
1053915174 9:42940250-42940272 GCCTGGAAATAGTGGGAGTTGGG + Intergenic
1054374945 9:64442439-64442461 GCCTGGAAACAGTGGGAGATGGG + Intergenic
1054376327 9:64452287-64452309 GCCTGGAAACAGTGGGAGTTGGG + Intergenic
1054376746 9:64455233-64455255 GCCTGGAAATAGTGGGAGTTGGG + Intergenic
1054519023 9:66061081-66061103 GCCTGGAAATAGTGGGAGTTGGG - Intergenic
1054519446 9:66064028-66064050 GCCTGGAAACAGTGGGAGGTGGG - Intergenic
1054520412 9:66070234-66070256 GCCTGGAAACAGTGGGAGGTGGG - Intergenic
1054521797 9:66080069-66080091 GCCTGGAAACAGTGGGAGATGGG - Intergenic
1055156205 9:73065957-73065979 GCTAGGACATAGTGTAAGCTAGG - Intronic
1056586279 9:87929569-87929591 GCCTGGAAACAGTGGGAGTTGGG - Intergenic
1056610603 9:88123374-88123396 GCCTGGAAACAGTGGGAGTTGGG + Intergenic
1057676089 9:97137293-97137315 GCCTGGAAACAGTGGGAGCTGGG - Intergenic
1057908651 9:99001782-99001804 GGCTGGTCAAATTGTGATCTGGG + Intronic
1061372012 9:130202519-130202541 GCCTGGCCACAGTGGGTGCTTGG + Intronic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1203546938 Un_KI270743v1:135375-135397 GCCTGGAAACAGTGGGAGGTGGG - Intergenic
1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG + Intergenic
1195101929 X:101563141-101563163 GCCTGGGCAATGTGTGTGTTTGG + Intergenic
1195290163 X:103424454-103424476 GCCTGGAGAATCTGTGTGCTTGG - Intergenic