ID: 1091779973

View in Genome Browser
Species Human (GRCh38)
Location 12:3207663-3207685
Sequence AGGGCTTCTCCAGTTCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091779973_1091779980 -10 Left 1091779973 12:3207663-3207685 CCCGGGAGAACTGGAGAAGCCCT 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1091779980 12:3207676-3207698 GAGAAGCCCTTGGGCAGGGGAGG 0: 1
1: 1
2: 4
3: 71
4: 1162
1091779973_1091779983 -3 Left 1091779973 12:3207663-3207685 CCCGGGAGAACTGGAGAAGCCCT 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1091779983 12:3207683-3207705 CCTTGGGCAGGGGAGGCTGCAGG 0: 1
1: 1
2: 3
3: 86
4: 865
1091779973_1091779984 20 Left 1091779973 12:3207663-3207685 CCCGGGAGAACTGGAGAAGCCCT 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1091779984 12:3207706-3207728 ATTTCAAATCTCCCTTGCAGTGG 0: 1
1: 0
2: 2
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091779973 Original CRISPR AGGGCTTCTCCAGTTCTCCC GGG (reversed) Intronic
900321433 1:2086250-2086272 AGGGTTTCTCCATTTTGCCCAGG + Intronic
900959240 1:5908890-5908912 GGGGCGTCTCCACATCTCCCTGG - Intronic
900970384 1:5989398-5989420 AGGGCTTCCCAGGTGCTCCCAGG + Intronic
901390655 1:8943755-8943777 TGGGCTCATCCAGTCCTCCCAGG + Intergenic
901878885 1:12182368-12182390 AGGGCATCTCCCTGTCTCCCCGG + Intronic
902096900 1:13953141-13953163 AGAGCTTCCGCAGTTCTTCCAGG + Intergenic
903258334 1:22117567-22117589 AGGGCTGTGCCAGTTCCCCCTGG + Exonic
904772307 1:32886956-32886978 AGAGCTCCTCCAGTGCCCCCTGG - Intronic
904899936 1:33849032-33849054 AGGGCTTCTCCTGATCTCACAGG - Intronic
905051196 1:35052581-35052603 AGGGCTTCTCCATTTCCTCTTGG + Intergenic
905168452 1:36097135-36097157 GGGGCTCCTCCAGCTCCCCCTGG - Exonic
905311559 1:37052468-37052490 AGGGCATATCCAGGTCTCCATGG + Intergenic
907018326 1:51039812-51039834 AGGGCTTCTCCATGTTGCCCAGG - Intergenic
907922689 1:58928379-58928401 AGTGCTTCTCCAGCTTTCCACGG + Intergenic
908524740 1:64976804-64976826 TGGGCTTCTCCACTTTACCCAGG + Intergenic
910247282 1:85153170-85153192 AGGCCTTCTCCCTTGCTCCCTGG - Intergenic
912712937 1:111962416-111962438 AGGCCTTCTGCAGCTCCCCCGGG - Intronic
912716612 1:111988212-111988234 AGGGCTTCTCCTGTGTTCACAGG + Intronic
914005078 1:143725549-143725571 AGGGTTTCACCATTTTTCCCAGG - Intergenic
915092235 1:153434651-153434673 ATTGCTTCTCCAGTTCTAGCTGG - Intergenic
915131484 1:153698232-153698254 ATGGCTTTCCCAGTTCTTCCTGG - Intergenic
915277260 1:154797939-154797961 AGGCCTTCTCCAGCACTCTCTGG + Intronic
915534254 1:156525318-156525340 AAGGATTCCCCAGTTCTCTCAGG + Intergenic
916494613 1:165334812-165334834 AGGGCTTCTGCCCTTCTCTCAGG - Intronic
916716521 1:167451373-167451395 GGGGCATCTCCAGTTAGCCCAGG - Intronic
919808888 1:201396996-201397018 AGGCCTTGTCCTTTTCTCCCCGG - Intronic
920508709 1:206535037-206535059 AGGGTTTCACCATTTTTCCCAGG - Intronic
922173726 1:223178646-223178668 AGGGCTTCTGCTTTCCTCCCGGG - Intergenic
922255491 1:223889780-223889802 AGGCCTTCTGCAGTGCACCCTGG + Intergenic
923714180 1:236411054-236411076 TGTGACTCTCCAGTTCTCCCTGG + Intronic
924881177 1:248164500-248164522 AGGGCTGCTCCAGTCCTCAGGGG + Intergenic
1064582772 10:16810828-16810850 GGGGTTTCGCCATTTCTCCCAGG - Intronic
1065026435 10:21543310-21543332 AGGGCTTCTCCATTTTGGCCAGG + Intronic
1065735183 10:28745111-28745133 TGGGCTTCTCCAGATCTTCCAGG - Intergenic
1066404269 10:35104253-35104275 AGGGTTTCTCCATGTCACCCAGG - Intergenic
1066478951 10:35776771-35776793 AGTGCTTCTCCAGTGCACACAGG - Intergenic
1067405928 10:46023443-46023465 ACGGCAACTCCAGTTCGCCCGGG + Intronic
1067572266 10:47380207-47380229 AGGGCTCCTCTTGTTCTCCTTGG + Intronic
1068602247 10:58968305-58968327 ATGGCTCCTCCACTTCTCTCAGG - Intergenic
1069232221 10:66025179-66025201 AGAGCTTCTCCAGTTCACTCTGG - Intronic
1069707828 10:70469743-70469765 AGGGCTGCTCCAGGTCTGGCAGG + Intergenic
1070834204 10:79437779-79437801 AGGCTGACTCCAGTTCTCCCCGG + Intronic
1070918269 10:80168726-80168748 AGGGTTTCACCATTTCGCCCAGG + Intronic
1071553364 10:86584380-86584402 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1071553369 10:86584400-86584422 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1071553724 10:86586503-86586525 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1075444008 10:122501190-122501212 AGAGCTTCTCCCGCTCTGCCAGG - Intronic
1075557782 10:123445759-123445781 AGGGCCTCTCCATTCCTCCTAGG - Intergenic
1077638550 11:3860554-3860576 AGGCCTCCCCCAGCTCTCCCAGG - Intronic
1081615096 11:44586127-44586149 AGGGTTTCTTCAGTTCTCCAGGG - Intronic
1084495957 11:69503623-69503645 AGGGTCTTTCCACTTCTCCCTGG + Intergenic
1084647253 11:70465683-70465705 AGGGCTGCCCCAGTTCTGACTGG + Intergenic
1087012158 11:93524523-93524545 AAGTCTTGTCCAGTGCTCCCAGG - Intronic
1090826259 11:130388689-130388711 AAGCTTTCTCCAGCTCTCCCAGG - Intergenic
1091382440 12:70747-70769 AGGGCTTGTCCATGTCTCCAAGG + Intronic
1091779973 12:3207663-3207685 AGGGCTTCTCCAGTTCTCCCGGG - Intronic
1092693895 12:11147377-11147399 AGGGTTTCACCAGGTTTCCCAGG + Intronic
1093862096 12:24178476-24178498 AGAGCTTCCCCAGTTCTGCTTGG - Intergenic
1094530712 12:31272151-31272173 AGGGCTTAGCTAGTTCTTCCTGG + Intergenic
1100478248 12:94953666-94953688 ATGGGTTCTCCAGTCCTCACAGG + Intronic
1100993866 12:100281218-100281240 AGGGTTTCTCCATGTTTCCCAGG + Intronic
1101016358 12:100504927-100504949 AGGTCTGCCCCAGTTCCCCCAGG - Intronic
1102136807 12:110582723-110582745 GGGGCTTCCCCAGTTCCTCCCGG - Intronic
1102591053 12:113957087-113957109 GGGGCTGCTCCAGTTTGCCCGGG + Intronic
1103569652 12:121836363-121836385 AGGGTTTCTCCATGTTTCCCAGG - Intergenic
1103785997 12:123433601-123433623 AGGGTTTCACCAGTTTGCCCAGG + Intronic
1103889086 12:124225030-124225052 GCGGCTTCTCCAGGTCTGCCAGG + Intronic
1108357643 13:49642014-49642036 AGGGCTCATCCAGTTGTCCTAGG - Intergenic
1108417807 13:50217962-50217984 AGGGTTTCACCATTTTTCCCAGG + Intronic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1109439444 13:62349964-62349986 AGGGCTGCTGCAGTTCTCTGGGG - Intergenic
1110005547 13:70262425-70262447 AGGGTTTCACCATTTTTCCCAGG - Intergenic
1110967320 13:81715761-81715783 ACAGCTTTTCCAGATCTCCCTGG - Intergenic
1112926795 13:104686072-104686094 ATGGCTTATCCAGTTCTCACTGG + Intergenic
1113339673 13:109409765-109409787 AGAGCTGCTCCAATCCTCCCTGG - Intergenic
1113397856 13:109965398-109965420 GGGGTTTCTCCATTTTTCCCAGG - Intergenic
1113656460 13:112070987-112071009 AGGGCCTCCCCAGTCCTCTCCGG + Intergenic
1116144338 14:41044183-41044205 AGGGCTTCTCCATTTTGGCCAGG - Intergenic
1116174945 14:41456592-41456614 AAAGCTTCTTGAGTTCTCCCTGG + Intergenic
1118960741 14:70528536-70528558 AAGGATTCTCCAATTCTACCTGG - Intronic
1120507013 14:85365365-85365387 AGGTCTTCTCTGATTCTCCCAGG + Intergenic
1120946754 14:90005067-90005089 AGAGCTTTTCAAGGTCTCCCAGG + Intronic
1121157905 14:91704054-91704076 AGTGATTCTCCAGTTCTCTGTGG - Intronic
1122020039 14:98830193-98830215 TGAGCTGCTCCAGTCCTCCCAGG - Intergenic
1123062089 14:105599011-105599033 AGGGCCTCTCCATTTCTCTCTGG + Intergenic
1123086832 14:105720739-105720761 AGGGCCTCTCCATTTCTCTCTGG + Intergenic
1123677912 15:22730326-22730348 AGGGCTTATCCAGTTTTTCTGGG + Intergenic
1123884567 15:24712724-24712746 TGAGCTACTCCAGTTTTCCCAGG + Intergenic
1124330112 15:28804593-28804615 AGGGCTTATCCAGTTTTTCTGGG + Intergenic
1125380973 15:39086264-39086286 AGGGCTGCTCCAGGTCACCCAGG - Intergenic
1125911501 15:43443667-43443689 AGGGCTTCTCCCTGTCACCCAGG - Intronic
1127970471 15:63955757-63955779 AGGGCTTCTCCATGTTGCCCAGG + Intronic
1128891483 15:71335797-71335819 AGGGCTTCTCCACATCTGCAGGG + Intronic
1128935408 15:71742156-71742178 AACCCTTCTCCAGTCCTCCCTGG + Intronic
1129178036 15:73854221-73854243 AGGGCTTCTCCAGCTTGCCTGGG - Intergenic
1130918570 15:88325012-88325034 AAGGCTATTCCATTTCTCCCAGG + Intergenic
1132302428 15:100784307-100784329 AGGCCTCCTCCAGTTCTCCAGGG - Intergenic
1132415768 15:101617794-101617816 AGAGCTGATTCAGTTCTCCCTGG + Intergenic
1132566334 16:625264-625286 AGGGCTGCACCAGCTCTGCCTGG + Intronic
1132718550 16:1304368-1304390 AGGGCTCCTCCCGAGCTCCCTGG - Intergenic
1133405573 16:5521673-5521695 AGGTCTGCTGCAGATCTCCCTGG + Intergenic
1134042865 16:11081468-11081490 AGGGCTCCTCCAGGTAGCCCTGG + Intronic
1135382916 16:22008681-22008703 AGGGCTGCTCCCCTCCTCCCCGG - Intronic
1135415930 16:22267907-22267929 AGGGCTTCTCAACTTCTCCTGGG - Intronic
1136923080 16:34347033-34347055 AGGGCCTCTGCTGTGCTCCCAGG + Intergenic
1136981493 16:35064773-35064795 AGGGCCTCTGCTGTGCTCCCAGG - Intergenic
1138717466 16:59040369-59040391 ATGGCTAATCCAGTTATCCCAGG - Intergenic
1139837440 16:69850547-69850569 AGGTCTTCCCCAAATCTCCCAGG - Intronic
1140306493 16:73807660-73807682 AGGGCTTCTCCATGTTGCCCAGG + Intergenic
1140681113 16:77385735-77385757 AGGACTTCCCAAGCTCTCCCAGG + Intronic
1141128848 16:81420748-81420770 GAGGCCTCTCCAGTTCTCACCGG + Intergenic
1141635901 16:85313597-85313619 AGGGCCTCTCCAGCTGTCCCAGG - Intergenic
1141955114 16:87365570-87365592 AGGGCTCCTCCAGCCATCCCGGG - Intronic
1142007974 16:87699119-87699141 GGGTCTTCTCCAGCTCTTCCAGG - Intronic
1142720067 17:1770075-1770097 GGGGCCTCTCCAGGTCTGCCTGG - Intronic
1142738215 17:1915100-1915122 AGGGGTTCTGCTGTTCTCCTAGG - Intergenic
1143652178 17:8270067-8270089 AGGGTTTCACCATGTCTCCCAGG + Exonic
1144764874 17:17727143-17727165 ACGGCTTCTCTAGTTTTCCTTGG + Intronic
1145799263 17:27672701-27672723 AGGCCTCCTCCAGTGCACCCTGG - Intergenic
1146062585 17:29614882-29614904 AGTGCATCGCCAGGTCTCCCAGG + Exonic
1147418289 17:40309227-40309249 AGGGCTTCCCCGGTTCTCCTGGG + Exonic
1147538780 17:41339066-41339088 AGGGTTTTTCCAGTTCTCAGAGG - Intergenic
1150133397 17:62681049-62681071 CTGGCTTCTCCAGTTCTCCCGGG + Exonic
1150886292 17:69090198-69090220 AAGGCTTTTCCAGTTCGCCAAGG + Intronic
1151328635 17:73393980-73394002 AGGGCTGCTCCATCTCTCCCGGG - Intronic
1152121231 17:78419962-78419984 AGGGCTTCTTCAGGACCCCCTGG - Intronic
1152898971 17:82929242-82929264 ACAGCTTTTCCAGTTCTCCTCGG - Exonic
1153966106 18:10183563-10183585 ATGTCTTCCCCAGTTATCCCAGG + Intergenic
1155025328 18:21935519-21935541 AGGATTTCTCCATTTCGCCCAGG - Intergenic
1155106997 18:22676981-22677003 AGGGCTTGTTCAGATCTCTCAGG - Intergenic
1155228929 18:23755288-23755310 AGAACTCCTCCAGTTCTCCAGGG - Intronic
1159193656 18:65083290-65083312 GGGGCTTCTTGAGTTCTCTCTGG + Intergenic
1161975721 19:7606947-7606969 AGGGGTTCTCCCTGTCTCCCAGG - Intronic
1163057243 19:14729542-14729564 AGGGTTTCTCCATTTTGCCCAGG + Intronic
1163212657 19:15852549-15852571 TGGGCTTCTCCCCTTCTCCAAGG + Intergenic
1164479110 19:28597965-28597987 AAGGCTTCTCCATCTCTACCTGG + Intergenic
1165075476 19:33277860-33277882 TGGGCCTCCCCAGTTCTCCAAGG + Intergenic
1165090566 19:33386055-33386077 TCTGCTTGTCCAGTTCTCCCAGG - Intergenic
1165128595 19:33618266-33618288 AGGTCTGCTTCAGCTCTCCCAGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
1168347374 19:55657139-55657161 GGTGCTTCACCGGTTCTCCCGGG + Intronic
925130857 2:1493107-1493129 AGGGATTCACCAGGGCTCCCAGG + Intronic
926018361 2:9474182-9474204 AGGGCTGCTCCAGGCCCCCCTGG - Intronic
926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG + Intergenic
926822341 2:16866197-16866219 AGGGTTTCACCATTTCTGCCAGG - Intergenic
927864947 2:26582318-26582340 TGGCCATCTCCAGATCTCCCTGG - Intronic
927904090 2:26845062-26845084 AGGGGCTCTCCAGTATTCCCAGG - Intergenic
928084088 2:28334838-28334860 AGGGCTTCTCCTGCCCTGCCCGG + Intronic
928195725 2:29215320-29215342 AGGGCCTCCCCAGGACTCCCTGG + Intronic
929664433 2:43822771-43822793 AGGGGTTGTTCAGTTCACCCAGG - Intronic
933159363 2:79007341-79007363 AGGCCTCCTCCAGTCCACCCAGG + Intergenic
934107334 2:88707560-88707582 AAGGCTTCTCACATTCTCCCTGG + Intronic
935608257 2:104992686-104992708 AGTGCTACTCCAGTGATCCCAGG + Intergenic
935761845 2:106327928-106327950 AGGGCTTCTCCATGTTTTCCAGG - Intergenic
936038567 2:109130712-109130734 AGGTCTTCTCCTGGGCTCCCAGG + Intronic
938110902 2:128564280-128564302 GGGCCTTCTCAAGTTCTCTCGGG - Intergenic
938259378 2:129884347-129884369 AGGGCTTCACCAGGAGTCCCAGG - Intergenic
938314930 2:130318784-130318806 AGGGCTTGTCCTGTTCTCTGAGG - Intergenic
940002190 2:148977368-148977390 AGTGCTTGTCCATTTGTCCCAGG + Intronic
941221450 2:162787077-162787099 AGGCCTTCTCCAGTTAACCCTGG + Intronic
941499978 2:166262060-166262082 AAGACTTATCCAGCTCTCCCTGG - Intronic
943364297 2:186954704-186954726 GGGGCTTCACCAGTTTTGCCAGG - Intergenic
946546509 2:220749740-220749762 AGGGCTCCTGCAGTTTTCCAGGG - Intergenic
947405137 2:229768064-229768086 AGGGTTTCTCCATGTTTCCCAGG - Intronic
947674090 2:231961753-231961775 AGGGCCTCACCGTTTCTCCCCGG - Exonic
947716495 2:232341850-232341872 AGGGCTTCTCCAGAGCTGCTTGG - Intronic
948285362 2:236780339-236780361 AGTGCTTTTCCATTTCTGCCTGG - Intergenic
948763178 2:240205061-240205083 AGGGCATCTCCTGACCTCCCTGG + Intergenic
1169598560 20:7229377-7229399 AGGGCTTCTCCATGTTACCCAGG + Intergenic
1169661459 20:7982790-7982812 AGGGCTTCTCCACCTGTCTCTGG + Intronic
1170584908 20:17727411-17727433 ACGGCTGCTCCAGTTCACCTGGG - Intronic
1170687168 20:18579880-18579902 AGGGCTTCACCATTTTTCCCAGG - Intronic
1171353111 20:24520499-24520521 AGGGTTTCTCCATGTTTCCCAGG - Intronic
1172816700 20:37692895-37692917 AGGGCTTCTTCAACTCACCCTGG - Intergenic
1174970050 20:55264765-55264787 TTGGCTGCTCCAGATCTCCCAGG - Intergenic
1175250279 20:57605023-57605045 AGGGCTCTCCCAGTCCTCCCAGG + Intronic
1175715004 20:61249526-61249548 AGGGTTTCTCCAGCTACCCCAGG + Intergenic
1175755067 20:61524299-61524321 AGGTCTTCTCCAGCTTTCCCCGG - Intronic
1175755198 20:61525278-61525300 GGGGCTTCTCTAAATCTCCCAGG - Intronic
1178603074 21:34011914-34011936 ATGGCTTATCCAGGGCTCCCTGG - Intergenic
1179732255 21:43374433-43374455 AGGGATGCTCCAGTACTCCAGGG + Intergenic
1180109340 21:45640780-45640802 TGGGCTTCTCCAGGGCTCCTGGG + Intergenic
1180570684 22:16715666-16715688 AGGGCATTTCAAGTTCTCTCTGG + Intergenic
1181097267 22:20514055-20514077 AGGGTTTCACCATGTCTCCCAGG + Intronic
1183290372 22:36998403-36998425 AGGCCCTCTCCAGTGCTCCCAGG - Intronic
1184715551 22:46279885-46279907 AGAGCTTCTCCAAATGTCCCAGG - Intronic
949530782 3:4953200-4953222 AGGCCTCCTCGAGTTCTGCCAGG + Intergenic
949951909 3:9236256-9236278 AGAGTTTCTCCAGCTCTCCCTGG + Intronic
950279455 3:11694031-11694053 AGGGCTTCTGTAGTTTGCCCAGG - Intronic
950569993 3:13793807-13793829 GAGGCTTCTCCAGGTCCCCCAGG - Intergenic
950570534 3:13797087-13797109 AGGGTTGCTCTAGTTCCCCCAGG + Intergenic
950773425 3:15330548-15330570 TTAACTTCTCCAGTTCTCCCTGG + Exonic
952488571 3:33841759-33841781 AGGGCTTATCCAGTTTTTCTGGG + Intronic
952765557 3:36950764-36950786 AGGGTTTCTCCATGTTTCCCAGG - Intergenic
954057256 3:48037584-48037606 AGGGCTTCTCCATGTTGCCCAGG + Intronic
954881777 3:53841213-53841235 AGTGCTTCTCAAGCTCTCCATGG - Intronic
956783498 3:72623320-72623342 AGGGCTTCCCCAGTACTGGCTGG - Intergenic
957107885 3:75914035-75914057 AGGGCATTTCAAGTTCTCTCTGG - Intronic
957142989 3:76385184-76385206 AGGGCTTCTCCATGTTGCCCAGG + Intronic
960881841 3:122353390-122353412 AGGGCTTATTCTGTTCTCTCTGG + Intergenic
961368016 3:126413636-126413658 CAGGCCTCTCCAGTCCTCCCAGG - Intronic
961612453 3:128152035-128152057 AAGGGCTCTCCAGGTCTCCCAGG + Intronic
962187532 3:133275673-133275695 AGTGCTGCTCCAGATCCCCCTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962704744 3:138032226-138032248 AGGGCTTCTCCATGTTGCCCAGG - Exonic
962712386 3:138098952-138098974 AGGGTTTCTCCAGGTTGCCCGGG - Intronic
962826045 3:139101728-139101750 ATGACATCTCCAGTTTTCCCAGG - Intronic
963042894 3:141082250-141082272 TGGGCTTTGCCAGGTCTCCCAGG + Intronic
963208796 3:142665393-142665415 TGGGCTCTTCCATTTCTCCCTGG + Intronic
963289628 3:143474566-143474588 TGGGCTTCCCCAATTCTTCCAGG - Intronic
964327004 3:155557860-155557882 ATGACTTCTCCAGTTATCTCTGG - Intronic
965048933 3:163618778-163618800 GGGGTTTCTCCAGTTTGCCCAGG + Intergenic
968054869 3:195683787-195683809 AGGGCTTCTTCTGTTGCCCCTGG - Intergenic
968101041 3:195965485-195965507 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
969660274 4:8523340-8523362 AGGACTTCTCCAGATGGCCCGGG - Intergenic
970836834 4:20419458-20419480 TGGGCTTCTCCAGTTGTTCTTGG + Intronic
974493374 4:62595555-62595577 AGGGCATCTCCCTTTCCCCCGGG + Intergenic
975820710 4:78267754-78267776 ATGGCCTGCCCAGTTCTCCCCGG + Intronic
976808426 4:89073899-89073921 AGGCATTCCCCAGTTGTCCCAGG - Intronic
982068165 4:151672794-151672816 AGAGCTGCTCCAGTGCCCCCTGG + Exonic
982427160 4:155278125-155278147 AAGGCCTCCCCACTTCTCCCAGG - Intergenic
984756687 4:183331396-183331418 AGGGATTTCCCACTTCTCCCTGG - Intergenic
985502041 5:254428-254450 AGGGCTTCTTCTGTTGCCCCTGG - Exonic
985734977 5:1574238-1574260 AGGGCTTCTTCTGTTGCCCCTGG + Intergenic
986826098 5:11524465-11524487 AGAGACTCTCCAGTCCTCCCTGG + Intronic
986862680 5:11946501-11946523 AGGGCTTCTTCAGTCATCACAGG - Intergenic
988010699 5:25479077-25479099 TGGCCTTCCCCAATTCTCCCTGG - Intergenic
989706370 5:44336512-44336534 AGTTCTTCTCCACCTCTCCCCGG - Intronic
990329412 5:54711286-54711308 AGGGCTTCTTCAGTACTTTCTGG + Intergenic
997848976 5:137313843-137313865 AGGGGTTCTTCATTTCCCCCAGG - Intronic
999282905 5:150376492-150376514 GGGACTGCTCCAGTACTCCCTGG + Exonic
1000093107 5:157947280-157947302 AGGGTTTCTCCATGTCACCCAGG + Intergenic
1001429372 5:171647326-171647348 AGGGCTGCTGAAGTCCTCCCAGG + Intergenic
1001739027 5:174034842-174034864 AGGGCTGCTGCAGTTTTCCGGGG + Intergenic
1001885469 5:175286506-175286528 AGGGCTTCACCAGTTTGGCCAGG - Intergenic
1004701982 6:18087886-18087908 ATGGCTTTTCCAGTCATCCCTGG - Intergenic
1005223304 6:23613244-23613266 AGGACTTCCCAAGTTCCCCCTGG - Intergenic
1005665160 6:28045111-28045133 AGAGCTTCTCCAGTCCACCATGG - Intergenic
1006276060 6:33006524-33006546 AGGCCTTGGCCAGTTCTTCCAGG - Exonic
1007166590 6:39832749-39832771 AGGGTTTCTGCAGTTCTCCACGG + Intronic
1007422459 6:41727969-41727991 AGGGCTACTCTACTGCTCCCTGG - Intronic
1007961102 6:45960444-45960466 AGTGCCCCTCTAGTTCTCCCTGG - Intronic
1011350871 6:86422298-86422320 AGGTCTTCTCCACTTCTCCCTGG - Intergenic
1013423354 6:109986982-109987004 TTGGCTTCTCAAGCTCTCCCTGG - Intergenic
1015966214 6:138697162-138697184 AGGGCTCCTCCAGGCCTCGCAGG - Intergenic
1018962208 6:168457068-168457090 AGGGCTTTGCCATCTCTCCCAGG - Intronic
1019191752 6:170255266-170255288 AGGTCTTCTCCATTTCTCAGAGG - Intergenic
1019337362 7:491715-491737 GAGGCTGCTCCCGTTCTCCCTGG - Intergenic
1019420077 7:946620-946642 AGGCCATCCCCAGTCCTCCCTGG + Intronic
1023196386 7:37644120-37644142 AGCCCTTCTCCTCTTCTCCCAGG + Intergenic
1026600308 7:71772192-71772214 AGGGTTTCCCCATTTTTCCCAGG + Intergenic
1030396093 7:108988574-108988596 AGAGTTTCTCCAATTCCCCCAGG - Intergenic
1030928862 7:115497071-115497093 AGTTTTTCTCCAGTTCTCTCAGG - Intergenic
1032521832 7:132551264-132551286 AGGGCTTCTCAATTTCCCACTGG - Intronic
1032591940 7:133199883-133199905 AGACCTCCTCAAGTTCTCCCTGG + Intergenic
1032616742 7:133480860-133480882 AGGGCTTCGCCATGTCGCCCAGG - Intronic
1032792777 7:135254628-135254650 AGGGCTTCTCCCCTTGTCCCAGG + Intronic
1033012496 7:137637115-137637137 AGGGCTCTTCCAGTTCCCCATGG + Intronic
1033215479 7:139490377-139490399 GGCTCTTCTCCAATTCTCCCGGG - Intergenic
1033755941 7:144398492-144398514 AGGACCCTTCCAGTTCTCCCAGG - Exonic
1034959033 7:155352803-155352825 CAGGCTTCCCCTGTTCTCCCAGG - Intergenic
1036184760 8:6613581-6613603 AGGGATTCTGCAGTTCCCCGGGG + Intronic
1037101781 8:15055698-15055720 ATTGCTTCTCAAGGTCTCCCTGG - Intronic
1038359554 8:26864171-26864193 GAGGCTCCTCAAGTTCTCCCGGG - Exonic
1039412795 8:37369527-37369549 AGGGCTCCTCTGTTTCTCCCAGG + Intergenic
1041735440 8:61106136-61106158 AGGGCTCCTCCACCTCTTCCAGG - Intronic
1042832593 8:73048351-73048373 AGGGCTTCTCCATGTTTCCCAGG + Intergenic
1044153005 8:88804761-88804783 AGGGCTTCTCCATGTTGCCCAGG - Intergenic
1044161167 8:88916685-88916707 AGGGCTTCTCCAGTGATTGCAGG + Intergenic
1046592577 8:116224026-116224048 AGGGCTTCTCCACGTTGCCCAGG + Intergenic
1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG + Intergenic
1048541377 8:135344978-135345000 AGGGTGTCTCCAGTTCTCAGGGG + Intergenic
1049135739 8:140897475-140897497 AGGCCTTCTTCAGCTCTCTCCGG + Intronic
1051164492 9:14247456-14247478 AGGACTACTCCATTTCTCACAGG + Intronic
1051279115 9:15423348-15423370 AGGACTTCTCCTGGTGTCCCAGG - Intronic
1051705548 9:19875905-19875927 AAGGCTTCTCCAGTTGTGCATGG + Intergenic
1052375940 9:27717591-27717613 AAGTCTTCTCCAGTTCTCTTGGG + Intergenic
1056170696 9:83981169-83981191 AGAAGTTCTCCAGTACTCCCAGG - Intronic
1056332559 9:85533529-85533551 AGGGCTTCTCCACCTCAGCCAGG + Intergenic
1056383583 9:86077489-86077511 GCTGCTTCTCCAGCTCTCCCTGG + Exonic
1056766283 9:89446607-89446629 AGGACTTCTCCAGGGCTCCGAGG + Intronic
1059214837 9:112551705-112551727 TTGGCTTCTCTAGTTTTCCCAGG + Intronic
1059418382 9:114175791-114175813 AGGGCTTGTCCAGGACTCCGGGG - Intronic
1059508696 9:114823661-114823683 TGGGCTTTTCCAGATGTCCCAGG + Intergenic
1059676193 9:116542729-116542751 AGGGCTTCTCCATGTTGCCCAGG - Intronic
1060069845 9:120536490-120536512 AGGCCTTTTCCAGTTCTGCCTGG + Exonic
1060374172 9:123103706-123103728 AGTGCTTCTCCATGTCTACCTGG - Exonic
1061058486 9:128237964-128237986 AGGGTTTCTCCATGTTTCCCAGG + Intronic
1061487837 9:130929253-130929275 GGGGCTTCCCCAGTGCTCCAGGG - Intronic
1062725205 9:138069098-138069120 AGGTCATCTCCTGTTCTGCCTGG + Intronic
1188314412 X:28656188-28656210 ATTGCTTTTCCATTTCTCCCTGG + Intronic
1189141886 X:38615834-38615856 AGGTCTTCTACATTTCTCACGGG - Intronic
1189719426 X:43899975-43899997 AGAGCTTCTGCATGTCTCCCAGG + Intergenic
1190133157 X:47769211-47769233 AGGGCTGCTGCAGTTTTCCGGGG - Intergenic
1190278633 X:48914995-48915017 AAGGCTTCTCTAAATCTCCCTGG - Intronic
1190332869 X:49246829-49246851 AGGCCTGCAGCAGTTCTCCCAGG - Exonic
1191682619 X:63856769-63856791 ACTGCTGCTCCAGTTCTACCAGG - Intergenic
1193946898 X:87749054-87749076 AAGGCTTTTCTACTTCTCCCTGG + Intergenic
1194021955 X:88702135-88702157 AGGGCTTCTGCAGTTTTCTGGGG + Intergenic
1195696769 X:107673246-107673268 AGGGATTCCCCAGGACTCCCTGG - Intergenic
1196423842 X:115549872-115549894 AGGGTTTCACCATGTCTCCCAGG - Intergenic
1198536520 X:137591798-137591820 AGGCCTTCACAAGTTCTCCCAGG - Intergenic
1200796556 Y:7346205-7346227 GGGGCTCCTCCTGTTCTCCTGGG + Intergenic
1200872305 Y:8115227-8115249 AGGGTTTCACCATTTTTCCCAGG + Intergenic