ID: 1091780074

View in Genome Browser
Species Human (GRCh38)
Location 12:3208206-3208228
Sequence AGGGCTCCAACCGCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091780074_1091780086 9 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780086 12:3208238-3208260 CCCAAGTGTCCCTCGGGCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 223
1091780074_1091780080 2 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780080 12:3208231-3208253 GAGGATCCCCAAGTGTCCCTCGG 0: 1
1: 0
2: 0
3: 6
4: 128
1091780074_1091780081 3 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780081 12:3208232-3208254 AGGATCCCCAAGTGTCCCTCGGG 0: 1
1: 0
2: 0
3: 26
4: 178
1091780074_1091780091 30 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780091 12:3208259-3208281 GGATTGCTCTGAATGTCTTCGGG 0: 1
1: 0
2: 0
3: 13
4: 139
1091780074_1091780084 8 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780084 12:3208237-3208259 CCCCAAGTGTCCCTCGGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 129
1091780074_1091780082 7 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780082 12:3208236-3208258 TCCCCAAGTGTCCCTCGGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 135
1091780074_1091780090 29 Left 1091780074 12:3208206-3208228 CCAGGAAGGGCGGTTGGAGCCCT 0: 1
1: 0
2: 1
3: 15
4: 126
Right 1091780090 12:3208258-3208280 GGGATTGCTCTGAATGTCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091780074 Original CRISPR AGGGCTCCAACCGCCCTTCC TGG (reversed) Intronic
900301191 1:1978323-1978345 AGGGCTCCACCACCCCTCCCAGG - Intronic
900363128 1:2299538-2299560 AGGACTCCAGCCTCCCTGCCAGG + Intronic
900413519 1:2524612-2524634 AGGGCTGCGACAGCCCTTCCTGG + Intronic
900978598 1:6033699-6033721 AGGGAGCCTACCGACCTTCCTGG + Intronic
905380452 1:37557896-37557918 AGGTCTCCCACCACCCTGCCAGG - Intronic
911070032 1:93825217-93825239 AGGGCTCCAATCTCATTTCCAGG + Intronic
919728658 1:200899537-200899559 AGGCCTCCAGCCTCGCTTCCAGG - Exonic
922958810 1:229626664-229626686 GGGCCTCCAACCGCCCTTACCGG - Intronic
924589106 1:245386488-245386510 AGGGCTCCAGCTGCCCATCTGGG + Intronic
1066362021 10:34740275-34740297 AGGGCTCCGACAGCCCTCCTGGG + Intronic
1067634614 10:47992724-47992746 AGGGATCCACCCGCTCATCCTGG + Intergenic
1068335880 10:55631376-55631398 AGGGCTCCCCCAGCGCTTCCGGG + Intergenic
1070300020 10:75196744-75196766 ACTGCTCAAACCGCCCTTCCAGG + Intergenic
1070556189 10:77529434-77529456 AGGGCTCCCACCTCACTCCCCGG + Intronic
1072765177 10:98089116-98089138 ATGGCTACAAAGGCCCTTCCTGG - Intergenic
1073760266 10:106621562-106621584 AGGGCTCTAACACCCCTTTCTGG + Intronic
1074111146 10:110423532-110423554 AGGTAACCAACAGCCCTTCCAGG - Intergenic
1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG + Intergenic
1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG + Intergenic
1077488610 11:2850324-2850346 AGGGCTGCAATGGCCCGTCCAGG - Intergenic
1081741691 11:45445372-45445394 AGGGCTCCATAAGCTCTTCCTGG + Intergenic
1081773089 11:45661756-45661778 AGGGCTCCCTCCTCCCCTCCTGG - Intronic
1085024035 11:73226226-73226248 AGGGCCCCCACCATCCTTCCAGG - Intronic
1088221885 11:107578310-107578332 AGGGCTCCAACCACCATCCCTGG - Intergenic
1091780074 12:3208206-3208228 AGGGCTCCAACCGCCCTTCCTGG - Intronic
1096778431 12:53978125-53978147 AGGTGTCCAACCCCCCTTGCAGG + Intergenic
1097496045 12:60336041-60336063 AGTCCTCCAACTGCTCTTCCTGG - Intergenic
1106568078 13:30904453-30904475 CTGGCTCCAACAGCCCTTTCTGG + Intergenic
1108279045 13:48842303-48842325 TGGGCTCCATCCTCACTTCCTGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113432236 13:110261207-110261229 GGGGCTCCATTCCCCCTTCCTGG - Intronic
1113710987 13:112465412-112465434 GTGGCTCCAAACGCCTTTCCTGG - Intergenic
1114408520 14:22478790-22478812 AGGGCTCCACCCACTCTCCCAGG - Intergenic
1114539531 14:23444472-23444494 AGGGCTCCAATTGCTCTTGCAGG + Intergenic
1116499947 14:45608340-45608362 AGTGCTCCAAGAGCCCTTTCAGG + Intergenic
1119866987 14:77982148-77982170 AGGGCTCTGCCCACCCTTCCTGG - Intergenic
1121254619 14:92522065-92522087 GGGGCCCCAACCACCTTTCCAGG - Intronic
1121500008 14:94427727-94427749 AGGGCTGGAACCACCCTTTCTGG - Intergenic
1121654979 14:95588486-95588508 AGGGCACCTGGCGCCCTTCCTGG + Intergenic
1122393546 14:101407139-101407161 AGGCCTCCAGCCTGCCTTCCCGG + Intergenic
1124055616 15:26238503-26238525 TGGGCTCCACCCCTCCTTCCTGG - Intergenic
1127666522 15:61153175-61153197 GGGGCTCCAACCTGCCTTTCCGG - Intronic
1130619272 15:85444744-85444766 AGGACTCTAGCAGCCCTTCCTGG + Intronic
1131370790 15:91879945-91879967 AGAGATCCAAGGGCCCTTCCTGG - Intronic
1131537835 15:93252378-93252400 CGGGCTCCCACCCCGCTTCCAGG + Intergenic
1132578300 16:673947-673969 AGGGCTCTACCCCCCTTTCCTGG + Exonic
1134193095 16:12137535-12137557 AGGGCTCCCAAGGCCATTCCAGG - Intronic
1136239027 16:28932980-28933002 AGGGCCCCAGCTCCCCTTCCGGG + Exonic
1140033540 16:71356718-71356740 AGGGCTCCTGCCGCCCTTCATGG - Intergenic
1142197073 16:88743920-88743942 GGGGCTGCAGCCTCCCTTCCTGG - Intronic
1142272639 16:89098589-89098611 AGGTGTCCCACCGGCCTTCCGGG + Exonic
1142602282 17:1059566-1059588 AGGGTTCCAGCCTCCCTGCCCGG + Intronic
1143162811 17:4882342-4882364 ATGGCTCCAACCAGTCTTCCTGG - Intronic
1143453932 17:7053666-7053688 AGGGCTGCAGCAGCCCTGCCTGG + Intergenic
1144515873 17:15917453-15917475 AGGGCTGCGGCCGCCCATCCTGG + Intergenic
1148821228 17:50360803-50360825 AGGGCTGCAAGTGCCCTGCCAGG + Exonic
1151477556 17:74352597-74352619 ATGGCTCCAGCTGCCCTCCCAGG + Intronic
1151657968 17:75504423-75504445 AGGACTCCACCCGCCGTCCCTGG - Exonic
1152690273 17:81714834-81714856 AGGCCTCCCACGGCCCTGCCCGG - Intronic
1153018091 18:602359-602381 AGTGATCCAGCCCCCCTTCCTGG - Intronic
1154367618 18:13726109-13726131 AGAGGTCCCCCCGCCCTTCCGGG - Intronic
1159979820 18:74764695-74764717 GGGGCTCCAACCTCCCTTGCAGG + Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1163298733 19:16429804-16429826 AGGACTCCAACAGGCCTTTCTGG + Intronic
1163989857 19:20988353-20988375 CGGGCTTCAACCCCCTTTCCAGG - Intergenic
1166956491 19:46468865-46468887 AGAGCCCAGACCGCCCTTCCAGG + Intronic
1166956626 19:46469540-46469562 AGAGCCCAGACCGCCCTTCCAGG - Intronic
1167493289 19:49803854-49803876 ATACCTCCAGCCGCCCTTCCAGG - Intronic
925221634 2:2146475-2146497 AGGGGTCCTGCCTCCCTTCCTGG + Intronic
929782285 2:44964877-44964899 AGTGCTCCAGCCTCCCTGCCTGG + Intergenic
932582301 2:72999866-72999888 AGGGGCCCAGCAGCCCTTCCTGG + Intronic
934566926 2:95346457-95346479 CCGGCTCCCTCCGCCCTTCCCGG + Intronic
934965546 2:98718804-98718826 AGGGCCCTGACAGCCCTTCCTGG + Intronic
946630040 2:221657135-221657157 AGGCCTCCAAACGCCCTTTTAGG + Intergenic
947762326 2:232611744-232611766 AGGGTTCCCACCAACCTTCCAGG + Intronic
948770273 2:240248226-240248248 AGGGCTCCTGCCTCCCTCCCAGG + Intergenic
1169198732 20:3697393-3697415 AGGGGTCCAGCCGCCCAGCCTGG + Intronic
1171304910 20:24096911-24096933 AGACCTCCAGCTGCCCTTCCAGG + Intergenic
1176050695 20:63118022-63118044 AGGGCTGCAGCAGCCCTTCAGGG - Intergenic
1176072563 20:63234737-63234759 GGGGCTGCACCCGCCCTCCCAGG - Intergenic
1180015751 21:45082079-45082101 AGAGCTCCAAGAGCCCTTCTTGG - Intronic
1180174235 21:46080009-46080031 AGGGCTCCCAACGCCCGTTCCGG + Intergenic
1182686489 22:32124231-32124253 AGTGCTCCCACCTGCCTTCCTGG - Intergenic
1184093910 22:42306315-42306337 AGGGCTGCAGCCGCCCTGCCAGG + Intronic
1185028630 22:48429899-48429921 AGGGCTTCCACTGCCCTTCCAGG + Intergenic
951579438 3:24146490-24146512 ATGGCTCCCACCTCCCTTTCAGG + Intronic
952817389 3:37457478-37457500 AGGGCTCCCACCACCATTTCTGG - Intronic
953562110 3:43999386-43999408 AGGCGTCCCACCGCCCTGCCCGG + Intergenic
954699374 3:52443395-52443417 AGGGCTCCCACCTCCAGTCCAGG + Intronic
956408267 3:68951142-68951164 AGGGCTTCACCGCCCCTTCCTGG + Intergenic
960141990 3:114159730-114159752 AGGGCTGCAATTCCCCTTCCAGG - Intronic
962366841 3:134792457-134792479 TGGGCTCCAAGCGCACTCCCAGG + Intronic
965314925 3:167179453-167179475 AGGGCTCATACCCCTCTTCCAGG - Intergenic
971419109 4:26459617-26459639 TGTGCTACAACCGCCCCTCCTGG - Intergenic
981748282 4:148071265-148071287 CTGGCTCCAGCCGCCCCTCCAGG - Intronic
984081679 4:175255121-175255143 AGGGCTCCCTCAGCCTTTCCAGG - Intergenic
984414202 4:179435962-179435984 GTAGCTCCACCCGCCCTTCCAGG + Intergenic
985631414 5:1015991-1016013 AGGGCTCCTTCCGCACCTCCAGG - Intronic
985890315 5:2710289-2710311 AGGGCTGCCAGCGCCCCTCCAGG + Intergenic
985943263 5:3155823-3155845 AGTGCCCCATCCACCCTTCCTGG - Intergenic
987754553 5:22084123-22084145 AGTGCTCCAACAGCCCATCAAGG + Intronic
993903102 5:93597293-93597315 AGGGCTGCCACCGCCCCTGCAGG - Intergenic
997629771 5:135358275-135358297 AGGGTTCCAACTGCCCTTTCTGG - Intronic
998446944 5:142205865-142205887 AGTGCTCCCACCTCCCCTCCTGG + Intergenic
1000854368 5:166379875-166379897 AGAGCCCCACCCCCCCTTCCTGG - Intergenic
1001208580 5:169788622-169788644 TGAGCTCCAACTGCCCTTACTGG - Intronic
1001570228 5:172725924-172725946 AGGGGTCCAGCAGCCCTGCCTGG + Intergenic
1007936296 6:45735707-45735729 AGGGCTCCAATGGCTCTTCATGG + Intergenic
1011370763 6:86634280-86634302 AGGCCTCCAGCCACCCTTGCTGG - Intergenic
1017898811 6:158703373-158703395 AGGGCCCCCACCACCCTGCCCGG - Intronic
1017983591 6:159423372-159423394 AGGGCTCCAGCAGCCCTCCCCGG + Intergenic
1018862738 6:167722829-167722851 AGGGCTCCAATTGCTCCTCCTGG + Intergenic
1019054614 6:169214064-169214086 AGGGCTCCTTCCGTCATTCCTGG - Intergenic
1019319500 7:409191-409213 AGGGCTCCCACAACCCTGCCAGG - Intergenic
1019532535 7:1510967-1510989 GGGGCTCCAGCCTCCCTTCCTGG + Intergenic
1020408510 7:7864999-7865021 GGGGCTCCCACACCCCTTCCGGG - Intronic
1022109844 7:27222017-27222039 AAAGGTCCAACCTCCCTTCCTGG + Intergenic
1024841809 7:53595751-53595773 AGGGAAGCAACTGCCCTTCCTGG + Intergenic
1025106537 7:56175420-56175442 AGGGCTGCTGCGGCCCTTCCCGG + Intergenic
1028298094 7:89161039-89161061 GGGACTCCAACCACCTTTCCTGG + Intronic
1032718638 7:134532189-134532211 ATGGCCTCAACCTCCCTTCCAGG - Intronic
1034329332 7:150269288-150269310 AGGGCTCCGAACGCCCTGTCAGG - Intronic
1034668722 7:152840572-152840594 AGGGCTCCGAACGCCCTGTCAGG + Intronic
1035083670 7:156238226-156238248 AGGGCTCCAAGGGCCCAACCTGG - Intergenic
1035911566 8:3572190-3572212 GGGGCTCCCACCGCCCTTCCTGG - Intronic
1036654888 8:10671677-10671699 AGGGCCCTCACTGCCCTTCCTGG - Intronic
1037735939 8:21566241-21566263 AGGGCTCCAGCAGGCCTCCCTGG + Intergenic
1037842408 8:22254718-22254740 AGTGCTCCAACCCCCAGTCCTGG + Intergenic
1042144886 8:65717493-65717515 AGGACTCCAACAGCCCTAACTGG + Exonic
1049785008 8:144446360-144446382 AGGGCTCCAGCAGCCTTTACTGG - Intergenic
1050074011 9:1845335-1845357 AGTACTCCCACCTCCCTTCCAGG - Intergenic
1050583439 9:7085165-7085187 AGGGCTCCAATGCCCCTTCCTGG - Intergenic
1056235830 9:84593052-84593074 AGGGATCCTACAGTCCTTCCTGG - Intergenic
1057785993 9:98087713-98087735 TGGGCTGCAACCGCCAGTCCTGG - Exonic
1059723742 9:116986218-116986240 TGGGCTGCAGCTGCCCTTCCAGG + Intronic
1061327875 9:129875113-129875135 AAGGCTCCAAGCTGCCTTCCTGG - Intronic
1062468642 9:136692461-136692483 TGGGCTCCGACGGCCCTTCCTGG - Intergenic
1187710221 X:22045804-22045826 ATGGCCCCAAGCTCCCTTCCAGG + Intronic
1188791490 X:34412716-34412738 AGGGCTGCAACCACCCCTGCAGG + Intergenic
1190775472 X:53549139-53549161 AGAGCTCCAACCAGCTTTCCTGG - Exonic
1195907446 X:109858937-109858959 AGGGCTCCAAAAGCCCTTGAGGG - Intergenic
1199983182 X:152932296-152932318 ATGGCTCCAACTTCCCGTCCTGG - Intronic
1201362856 Y:13172200-13172222 AGGGCTCAAACACCTCTTCCAGG - Intergenic