ID: 1091784033

View in Genome Browser
Species Human (GRCh38)
Location 12:3231564-3231586
Sequence CCCTAAAGAGGTCAACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784024_1091784033 -3 Left 1091784024 12:3231544-3231566 CCATGCCCCATGCCAGCCCACCC 0: 1
1: 1
2: 10
3: 104
4: 752
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784022_1091784033 2 Left 1091784022 12:3231539-3231561 CCATCCCATGCCCCATGCCAGCC 0: 1
1: 0
2: 6
3: 79
4: 650
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784025_1091784033 -8 Left 1091784025 12:3231549-3231571 CCCCATGCCAGCCCACCCTAAAG 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784017_1091784033 20 Left 1091784017 12:3231521-3231543 CCAGCCATCCCAGCCTGACCATC 0: 1
1: 0
2: 3
3: 27
4: 376
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784020_1091784033 11 Left 1091784020 12:3231530-3231552 CCAGCCTGACCATCCCATGCCCC 0: 1
1: 0
2: 2
3: 35
4: 379
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784021_1091784033 7 Left 1091784021 12:3231534-3231556 CCTGACCATCCCATGCCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 238
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784023_1091784033 -2 Left 1091784023 12:3231543-3231565 CCCATGCCCCATGCCAGCCCACC 0: 1
1: 2
2: 3
3: 34
4: 392
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784018_1091784033 16 Left 1091784018 12:3231525-3231547 CCATCCCAGCCTGACCATCCCAT 0: 1
1: 0
2: 0
3: 43
4: 401
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784027_1091784033 -10 Left 1091784027 12:3231551-3231573 CCATGCCAGCCCACCCTAAAGAG 0: 1
1: 0
2: 1
3: 15
4: 135
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784019_1091784033 12 Left 1091784019 12:3231529-3231551 CCCAGCCTGACCATCCCATGCCC 0: 1
1: 0
2: 1
3: 27
4: 420
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1091784026_1091784033 -9 Left 1091784026 12:3231550-3231572 CCCATGCCAGCCCACCCTAAAGA 0: 1
1: 0
2: 2
3: 17
4: 154
Right 1091784033 12:3231564-3231586 CCCTAAAGAGGTCAACCTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784033 Original CRISPR CCCTAAAGAGGTCAACCTCA AGG Intronic