ID: 1091784869

View in Genome Browser
Species Human (GRCh38)
Location 12:3237263-3237285
Sequence CCCAGGAATATCTGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784869_1091784880 30 Left 1091784869 12:3237263-3237285 CCCATCACACAGATATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1091784880 12:3237316-3237338 ACTTACGATCAAAGACAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63
1091784869_1091784872 -8 Left 1091784869 12:3237263-3237285 CCCATCACACAGATATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1091784872 12:3237278-3237300 TTCCTGGGCTTGCCTCCTGATGG 0: 1
1: 0
2: 1
3: 28
4: 467
1091784869_1091784879 26 Left 1091784869 12:3237263-3237285 CCCATCACACAGATATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1091784869_1091784873 -7 Left 1091784869 12:3237263-3237285 CCCATCACACAGATATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1091784873 12:3237279-3237301 TCCTGGGCTTGCCTCCTGATGGG 0: 1
1: 0
2: 2
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784869 Original CRISPR CCCAGGAATATCTGTGTGAT GGG (reversed) Intronic
905259844 1:36709518-36709540 CCCCGGGATGTCTGTGTCATAGG - Intergenic
906667244 1:47630637-47630659 CCCAGGAAAACCTGTGTGGGAGG - Intergenic
907403117 1:54238034-54238056 CCCAGGACTTTCTGTGTCCTGGG + Intronic
907583277 1:55591402-55591424 CCCAGGTGTATCTGTGTTTTAGG + Intergenic
907779782 1:57555816-57555838 CCAAGGAATTTCTATGTGTTGGG + Intronic
912625573 1:111202982-111203004 CCCTGGGACATCTGTGTGAATGG - Intronic
912683346 1:111742914-111742936 CCCAGGAGTGTGTGTGTGTTGGG + Intronic
912926444 1:113917318-113917340 CCCAGAAAAATCTGAGAGATTGG + Intergenic
916409061 1:164526653-164526675 CTTGGGATTATCTGTGTGATAGG - Intergenic
916592739 1:166208390-166208412 CCCAGGAATAAGTGGGTCATTGG - Intergenic
919850317 1:201667994-201668016 CCCAGGAAATTCTGGGTCATTGG + Intronic
920678385 1:208054521-208054543 CCCAGGATTGTCTGTGAGATGGG - Exonic
921505444 1:215963357-215963379 CCCAGGAAAATTCGTGTCATTGG - Intronic
1063384635 10:5608448-5608470 CCCGGGAATGTCTGTGTGGGAGG - Intergenic
1064286902 10:13999402-13999424 CCCAGGGATATCTGTATTCTGGG + Intronic
1066821616 10:39499467-39499489 CTCAGAAATTTCTTTGTGATGGG + Intergenic
1073381368 10:103080275-103080297 CCCAGGACTATCTGGATGCTAGG - Exonic
1074218498 10:111411552-111411574 CTTAGGAAAATCTGGGTGATGGG - Intergenic
1074298481 10:112212204-112212226 GACAGGAATATCTGTCTGACAGG + Intronic
1077433616 11:2527865-2527887 CCCAGGTGCATCTGTGGGATGGG + Intronic
1077649624 11:3958515-3958537 CGCAGGAATATCTCTCAGATAGG + Intronic
1077789586 11:5424072-5424094 CCCAGCAATATCGGTTTGAAGGG + Intronic
1080217448 11:29861409-29861431 CCCATGAATATCTGTCTCCTAGG - Intergenic
1083058543 11:59846471-59846493 CACAAGAAGTTCTGTGTGATGGG - Intergenic
1083190407 11:61047968-61047990 CCCAGAGAACTCTGTGTGATAGG - Intergenic
1083780304 11:64914151-64914173 CCCAGGAGTGTCTGCGGGATGGG - Exonic
1086054516 11:82630828-82630850 CCCATGACTATATGAGTGATAGG - Intergenic
1087214017 11:95475570-95475592 ACCAGGAACATCTTTCTGATTGG - Intergenic
1088780968 11:113133641-113133663 CTCAGGTTTATGTGTGTGATGGG + Intronic
1089078726 11:115759608-115759630 CGCAGGAATACCTGTGTGGAGGG + Intergenic
1091197965 11:133747743-133747765 CCCAGGGATCTGCGTGTGATGGG - Intergenic
1091784869 12:3237263-3237285 CCCAGGAATATCTGTGTGATGGG - Intronic
1093743942 12:22718690-22718712 CCCATGCATATCTGAGTGTTTGG + Intergenic
1094744121 12:33323519-33323541 CTAAGGAATCTCTGTGTGACAGG + Intergenic
1095031572 12:37291091-37291113 CTCAGGAACCTCTTTGTGATGGG + Intergenic
1095533296 12:43216327-43216349 ACCATTAATTTCTGTGTGATGGG + Intergenic
1096237269 12:49938105-49938127 CCCAGGAGGCTCTGTGTGACTGG + Intergenic
1096619773 12:52856940-52856962 CCCAGGAATGTCAGTGTTAAAGG + Intergenic
1100902759 12:99261612-99261634 ACCAGGATTCGCTGTGTGATTGG - Intronic
1101801291 12:108024320-108024342 CCCATCAATATATGTGTGGTAGG - Intergenic
1106803219 13:33278290-33278312 CCCTTGAATATCTGTCTAATGGG + Intronic
1108574913 13:51782500-51782522 ACCAGGAATATCAGGGTCATAGG + Intronic
1109345781 13:61113430-61113452 CCCAGGCATCTCTGTGTTCTTGG + Intergenic
1110562245 13:76921810-76921832 CCCAGCAATATCTCTGAGGTAGG + Intergenic
1111896534 13:94149332-94149354 CCCAGGAAAAGCTGTGAGAAAGG + Intronic
1111911489 13:94317122-94317144 CTCAGGAATGTGTGTGTCATTGG + Intronic
1114911266 14:27200912-27200934 GCCCAGAATATCTGTGAGATTGG - Intergenic
1115679955 14:35726919-35726941 CCCAGTATTATCTGTATCATAGG + Intronic
1120719199 14:87872123-87872145 CACAGGGATATCCGTGGGATAGG + Intronic
1121508413 14:94493877-94493899 CCAGGGAACATCTGTGTGGTTGG + Intronic
1121588094 14:95077747-95077769 CCAATGAATATCAGTGTGTTTGG + Intergenic
1122472031 14:101975272-101975294 CTCAGCAACACCTGTGTGATAGG - Intronic
1123698115 15:22894020-22894042 CCCAGGAATCTCTGGGAAATGGG - Intronic
1123972992 15:25526531-25526553 CCCAGGTATTGCTGTGTGGTAGG - Intergenic
1124512741 15:30340586-30340608 CCCAGAAATATCTGGTTGGTGGG + Intergenic
1124730174 15:32190164-32190186 CCCAGAAATATCTGGTTGGTGGG - Intergenic
1126284716 15:46997281-46997303 CATAGAAATATATGTGTGATTGG + Intergenic
1127673705 15:61220305-61220327 CTCAGGAATGTTTGTGTGACGGG - Intronic
1127911376 15:63418875-63418897 CCTAGGAATATCTAGGAGATGGG + Intergenic
1130035531 15:80357667-80357689 TCCTGAAATATCTGGGTGATGGG + Intronic
1132956531 16:2597287-2597309 CCCAGGGATTTCTGTGTGCAGGG + Intronic
1133967293 16:10540601-10540623 CCCACTAATATCTGGGTGTTTGG + Intronic
1134188687 16:12104655-12104677 CCCAGGATTAGCTGTGGGTTGGG + Intronic
1139372120 16:66475451-66475473 CCCAGGGATCCCTGTGTGACAGG + Intronic
1139471512 16:67180396-67180418 CCCAGGAGCATCTGTGAGAACGG + Exonic
1141887794 16:86904635-86904657 CCCAGAGATACCTGTGTGCTGGG - Intergenic
1145981142 17:29012377-29012399 GCCAGGAGGATCTGTGTGAATGG - Intronic
1150259640 17:63778319-63778341 CCCAAGAATGTCTGTTTTATTGG - Intronic
1152265335 17:79290881-79290903 CCCAGAAATAGCTGTGTGCTTGG + Intronic
1152331035 17:79673165-79673187 CCCAGGAATACCTGGGAGCTGGG - Intergenic
1155321778 18:24626261-24626283 CCCAGGAAAAACTATATGATTGG - Intergenic
1156609866 18:38713364-38713386 TTCAGGAATATGTGTGTGCTGGG + Intergenic
1156732938 18:40217127-40217149 ACCAGAAAAATCTGTGAGATAGG - Intergenic
1161592039 19:5133284-5133306 CCCAGGAAGAGCTGCGTGACGGG - Intronic
1163664693 19:18597874-18597896 CCCAGGCGTATGTGTGTGTTGGG + Intronic
1163748644 19:19062636-19062658 CCCAGGCATGGCTGTGTCATCGG - Intergenic
1163920811 19:20286810-20286832 TCCAGGAAAATATTTGTGATTGG - Intergenic
1164725032 19:30460500-30460522 CACAGTCATATCTCTGTGATGGG - Intronic
1165263937 19:34645122-34645144 CCCAGAAATATCTTCGTGAAGGG + Intronic
1167850257 19:52195799-52195821 TCCAGGAACCTCTGTGTGTTCGG + Intronic
931181317 2:59903952-59903974 CCCTGGCATACCTGTGTGAGAGG - Intergenic
931372826 2:61680042-61680064 CCCAGGATTTTCTTGGTGATTGG - Intergenic
932816686 2:74867533-74867555 TCCAGGAATATCTGTGGGTAAGG - Intronic
933970082 2:87463153-87463175 CCCAGCAATGTCTGATTGATAGG + Intergenic
934980143 2:98832877-98832899 CCCAAGAAAATGTGTGTGATCGG - Exonic
936323701 2:111487343-111487365 CCCAGCAATGTCTGATTGATAGG - Intergenic
936634112 2:114235771-114235793 CCCATGCATATATGGGTGATTGG - Intergenic
939541428 2:143498779-143498801 CCCAGGAATGTCTCTGTGACAGG - Intronic
942177546 2:173348648-173348670 CACAGGAAAATCTGTGCCATGGG - Intergenic
942973058 2:181980493-181980515 CCCAGGAATAGGAGTGTCATGGG - Intronic
944471348 2:200056141-200056163 CCCAGGAATATCACACTGATTGG + Intergenic
945314218 2:208353440-208353462 CACAGGAATATTTGGGTGGTAGG - Intronic
947548152 2:231026913-231026935 CCTTGGAATTTCTGAGTGATAGG + Intergenic
1170257079 20:14356870-14356892 CCCAGCCAGAGCTGTGTGATGGG + Intronic
1171348483 20:24484601-24484623 TCCAGGAATAGATGTGGGATGGG + Intronic
1171644628 20:27405812-27405834 CCCAGAAATTTATTTGTGATGGG + Intergenic
1173281504 20:41632244-41632266 CCCAGGAATCTGTGTTTGACAGG - Intergenic
1174569578 20:51492179-51492201 GACAGGAAGATGTGTGTGATGGG - Intronic
1174910283 20:54600662-54600684 CCCAGTAAAATCTTTGTGAGTGG - Intronic
1180096678 21:45558573-45558595 CCCAGAAATAAATGTGTGAGAGG + Intergenic
1181544611 22:23594860-23594882 GCCTGCAATGTCTGTGTGATTGG - Intergenic
1181815703 22:25435035-25435057 GCCTGCAATGTCTGTGTGATTGG + Intergenic
1183023790 22:35048659-35048681 ACATGGAATATCTGTGTGACAGG - Intergenic
1185135348 22:49068100-49068122 TCCAGGAATATATGTTTTATAGG - Intergenic
955729238 3:61966517-61966539 CCCAGGTAGAACTATGTGATAGG + Intronic
958075088 3:88666256-88666278 CCCAGGAGTATATGTGTGCGTGG + Intergenic
958469568 3:94499920-94499942 CAGAGGAATATATGTGTGAGTGG - Intergenic
958853470 3:99356492-99356514 CCTAGGAAGATATGTGAGATGGG + Intergenic
959200935 3:103246005-103246027 CCCAGTAACATCTCTGTGAAAGG - Intergenic
963392571 3:144685909-144685931 CCCATGAATATGTGAGTGATTGG + Intergenic
963618845 3:147578429-147578451 TCCAGGATTTTCTCTGTGATAGG + Intergenic
965888758 3:173483106-173483128 ACCAAGAATATCTGTGTAATAGG - Intronic
974008483 4:56584953-56584975 CCCTGGAATATGTCTATGATAGG + Intronic
974203469 4:58669850-58669872 CCCAGTAATATCTCTGTAGTTGG - Intergenic
975868803 4:78754758-78754780 CCTAGGAATATCTGTGAAAAGGG + Intergenic
976326879 4:83781834-83781856 CCTAAGAATATCTGTCTTATAGG + Intergenic
976410176 4:84704345-84704367 CTTAAGAATATCTGTGTGAAAGG + Exonic
978356040 4:107875605-107875627 CACAGGTATATGTGTGTCATGGG - Intronic
979041316 4:115800503-115800525 CCCATGAAGTGCTGTGTGATAGG + Intergenic
979087574 4:116432518-116432540 CCAAAAAATTTCTGTGTGATAGG + Intergenic
979191491 4:117864691-117864713 CCCATCAATATTTGGGTGATGGG + Intergenic
979208232 4:118068321-118068343 CCCAGTAATATCTGTGTTTTAGG - Intronic
979935910 4:126695274-126695296 GGCAGGAATATAAGTGTGATGGG - Intergenic
989944797 5:50209416-50209438 CCGAGAAACATCTTTGTGATGGG - Intergenic
991123746 5:63046062-63046084 CTCAGGAAAATCTGTGAAATAGG + Intergenic
994577880 5:101604194-101604216 CCCTGGAATTTCTGAGTAATAGG + Intergenic
995583527 5:113623950-113623972 CCCAGTATTCTCTCTGTGATGGG - Intergenic
996473134 5:123883949-123883971 CACAGAAATATCTGTGTGGGAGG + Intergenic
1001193048 5:169648185-169648207 GCCAGGAAAATCTTTGTTATGGG + Intronic
1003452790 6:6251656-6251678 CTCAGGAAAATGTGTGTGTTTGG + Intronic
1003726194 6:8767437-8767459 CCCAGGAATATATGGGTAATTGG + Intergenic
1004494574 6:16151434-16151456 CCAAGGGATATTTGTGTGTTTGG + Intergenic
1006311594 6:33264890-33264912 TCCAGGTGTTTCTGTGTGATTGG + Exonic
1006770084 6:36546261-36546283 CCTAGGAGTTTATGTGTGATGGG + Intronic
1006974020 6:38079893-38079915 CCCAGGACTTTCTGGGTGTTGGG + Intronic
1012934481 6:105351936-105351958 CCCTGGTATATGTGTGTGAATGG + Intronic
1017281020 6:152626006-152626028 CACAGGCCTATTTGTGTGATAGG + Intronic
1017978731 6:159380062-159380084 CCAAGGAATATGTGTTTGGTTGG - Intergenic
1021392242 7:20106936-20106958 CCCAGTAGTATCTGTGAAATAGG + Intergenic
1024922180 7:54569931-54569953 CTTAAGAATATCTGTGTGTTGGG + Exonic
1026316775 7:69234122-69234144 ACCAGGAATAGCTGAGTGAGAGG + Intergenic
1032536700 7:132670352-132670374 CACAGGAATATCTGTGGCTTTGG + Intronic
1037761173 8:21742772-21742794 CCCAGGCATCTCTGAGTGGTTGG - Intronic
1038178365 8:25202336-25202358 CCCAGGGATCTCTGGGTGATGGG + Intronic
1038529470 8:28306186-28306208 GACAGGAATATCTGTTTTATGGG + Intergenic
1038945616 8:32356447-32356469 ACAAGGAAACTCTGTGTGATTGG - Intronic
1039828693 8:41195599-41195621 CCCAGGAATACCTCTGTCCTTGG + Intergenic
1040724936 8:50370834-50370856 CCGAGGAATATATATGTGAATGG + Intronic
1042377787 8:68075536-68075558 CCCAGGTATATCTGCCTCATTGG + Intronic
1043861741 8:85325536-85325558 TCCAGGAATGACTTTGTGATGGG + Intergenic
1044492109 8:92831364-92831386 CCCAGGACTATCTATATTATTGG - Intergenic
1045464338 8:102455707-102455729 CCAAACAATATCTGTGTGATTGG + Intergenic
1045858426 8:106790413-106790435 CCCAGTATTATCTCTCTGATAGG + Intergenic
1046261516 8:111774179-111774201 CACAGGAATATCTGCGAGAGTGG + Intergenic
1047778215 8:128091022-128091044 CCCAGGAAAGTCTGTGGGAAAGG - Intergenic
1047805522 8:128355458-128355480 CCCACGAATATTTATGTAATGGG + Intergenic
1047911696 8:129536721-129536743 GCCAGGAATGTCTGTGTATTTGG + Intergenic
1050004782 9:1118797-1118819 CCCAGCAATGTCTATGTGAGTGG - Intergenic
1053366167 9:37524022-37524044 CTCAGGAGTCTCTGTGTGACTGG + Intronic
1055149744 9:72982235-72982257 CTGAGAAATATCTGTGTCATGGG + Intronic
1056601781 9:88052561-88052583 CCCAGGAATATCTTTCTTAAGGG - Intergenic
1058290559 9:103235823-103235845 CCCAAGAAGGTCTGTGTTATAGG - Intergenic
1061861724 9:133471885-133471907 CACAGGAAGAGCAGTGTGATGGG - Exonic
1062628913 9:137454960-137454982 CCCAGACACATCTGTGTGATTGG + Intronic
1186614265 X:11170398-11170420 CCCAGGAAGCTCAGTGTGGTAGG + Intronic
1190872213 X:54433779-54433801 CCCAGGGATGTCTGTCTGGTGGG + Intergenic
1192048442 X:67700821-67700843 CCCAGGGAGATCTGAGTCATTGG + Intronic
1192539779 X:71958072-71958094 CTCAGGAATGTTTGTGTGGTGGG + Intergenic
1195598891 X:106724016-106724038 ACCAGGTAGAACTGTGTGATAGG - Intronic
1197013024 X:121590144-121590166 TCCATGGATATCTGTGTCATAGG + Intergenic
1198568179 X:137926815-137926837 CCCAGGAAAATTTGTGTCCTGGG + Intergenic