ID: 1091784871

View in Genome Browser
Species Human (GRCh38)
Location 12:3237264-3237286
Sequence GCCCAGGAATATCTGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784871_1091784872 -9 Left 1091784871 12:3237264-3237286 CCATCACACAGATATTCCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1091784872 12:3237278-3237300 TTCCTGGGCTTGCCTCCTGATGG 0: 1
1: 0
2: 1
3: 28
4: 467
1091784871_1091784873 -8 Left 1091784871 12:3237264-3237286 CCATCACACAGATATTCCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1091784873 12:3237279-3237301 TCCTGGGCTTGCCTCCTGATGGG 0: 1
1: 0
2: 2
3: 18
4: 178
1091784871_1091784880 29 Left 1091784871 12:3237264-3237286 CCATCACACAGATATTCCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1091784880 12:3237316-3237338 ACTTACGATCAAAGACAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63
1091784871_1091784879 25 Left 1091784871 12:3237264-3237286 CCATCACACAGATATTCCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784871 Original CRISPR GCCCAGGAATATCTGTGTGA TGG (reversed) Intronic
902354939 1:15891098-15891120 GCCCAGAAATATATGTGTGTGGG + Intronic
903484253 1:23677841-23677863 GCCCAGGATCATCTGGGCGATGG - Intergenic
906003601 1:42448586-42448608 GCCCAGAAATACCTCTTTGAAGG - Exonic
912243746 1:107939304-107939326 GCCTAGGACCATCTGTGTAAAGG - Intronic
917624492 1:176831776-176831798 GAGAAGAAATATCTGTGTGATGG + Intronic
917661745 1:177183433-177183455 GGCCAGCAATATCTTTGTTAGGG + Intronic
918686227 1:187418981-187419003 ACCCAGGAATATCTTTCTCAGGG - Intergenic
920678387 1:208054522-208054544 CCCCAGGATTGTCTGTGAGATGG - Exonic
921188773 1:212692043-212692065 GCCCAGAAAACTCTGCGTGAAGG + Intronic
1062880626 10:975074-975096 GCACAGGCATTTCTGTGTGCTGG - Intergenic
1064332209 10:14404467-14404489 GTTCATGAACATCTGTGTGAAGG - Intronic
1065337883 10:24673478-24673500 GCCCTGGAACAACTGTGTGGAGG + Intronic
1069723247 10:70562597-70562619 CACCAGGAACATCTGTGCGAGGG - Intronic
1072456391 10:95580055-95580077 GCTCATGAATTTCTGTGTCAGGG - Intergenic
1073946548 10:108757307-108757329 ACCCAGGAATATCTTTCTCAAGG + Intergenic
1074135940 10:110626415-110626437 TCCCAGGAATATCTGACTCAAGG + Intergenic
1075526472 10:123191265-123191287 GCCCAGGAATCTTTGTTTAAGGG - Intergenic
1077508341 11:2942571-2942593 GCCCAGGAGCACCCGTGTGATGG + Intergenic
1077543700 11:3159712-3159734 GCCCAGGACTATCTGAGTCAGGG + Intronic
1077789584 11:5424071-5424093 TCCCAGCAATATCGGTTTGAAGG + Intronic
1083058544 11:59846472-59846494 GCACAAGAAGTTCTGTGTGATGG - Intergenic
1083780306 11:64914152-64914174 GCCCAGGAGTGTCTGCGGGATGG - Exonic
1087270272 11:96104039-96104061 GCCATGGAATATCTCTGTGAGGG - Intronic
1089078725 11:115759607-115759629 CCGCAGGAATACCTGTGTGGAGG + Intergenic
1089635451 11:119808791-119808813 GGCCAGGAGTATCTGTGGGATGG - Intergenic
1089772801 11:120815492-120815514 GCTGGGGAATATCTGTGTGCTGG + Intronic
1091784871 12:3237264-3237286 GCCCAGGAATATCTGTGTGATGG - Intronic
1093065770 12:14656709-14656731 GCTCAGGTAGATATGTGTGAGGG + Intronic
1095321622 12:40835337-40835359 ACCCAGGAATATTTGTAGGAAGG + Intronic
1096260293 12:50085778-50085800 GTCCAGGGATACCTGTATGAGGG + Intronic
1096400652 12:51303529-51303551 GGAGAGGAATGTCTGTGTGAGGG - Intronic
1096819537 12:54223190-54223212 GCCCAGAGATATCGGTGTGGGGG + Intergenic
1096926188 12:55149993-55150015 GCCTGGGAATGTGTGTGTGAGGG + Intergenic
1099354115 12:81611771-81611793 GCCCAGGAGTTTTTGTGTGCTGG - Intronic
1101509912 12:105383608-105383630 ATCCATGAATATCTGTGTTAAGG - Intronic
1102021648 12:109687414-109687436 GCCCAGGGACATCTGGTTGAGGG + Intergenic
1102378364 12:112442073-112442095 GCCCAAGAATATCTTTTTGCTGG + Intronic
1106740137 13:32631725-32631747 GGCCAGGAATATGTATCTGAAGG + Intronic
1107210519 13:37848713-37848735 GACCAGGGAAATCTGTGAGAAGG + Intronic
1107880761 13:44830030-44830052 GCCCAGGAATACCTGGGAAAGGG - Intergenic
1108823854 13:54387801-54387823 GCCCAGGAATCTCTTTCTTAAGG - Intergenic
1108980683 13:56509141-56509163 ACCCAGGAATATCTCTCTGTAGG + Intergenic
1109154133 13:58883602-58883624 ACCCAGGAATGTCTGTGTCAAGG - Intergenic
1110025642 13:70535514-70535536 CCCCAGGAATATCTTTCTCAAGG + Intergenic
1114162214 14:20180695-20180717 ACCCAGGAATATCTTTCTCAAGG - Intergenic
1119496475 14:75084025-75084047 GTCCAGGAAAATATGTCTGATGG - Exonic
1120663308 14:87276321-87276343 TCCCAGATATATATGTGTGAGGG - Intergenic
1202919197 14_KI270723v1_random:15291-15313 GCCCTGGAATATCTCTCTCATGG - Intergenic
1202925432 14_KI270724v1_random:19704-19726 GCCCTGGAATATCTCTCTCATGG + Intergenic
1123698117 15:22894021-22894043 GCCCAGGAATCTCTGGGAAATGG - Intronic
1125229930 15:37442243-37442265 GCCTAGAAATATCTGTATGGTGG - Intergenic
1127673706 15:61220306-61220328 TCTCAGGAATGTTTGTGTGACGG - Intronic
1127868169 15:63048446-63048468 GCCCAGGCCTCTCTGTGCGATGG - Intronic
1130018636 15:80208203-80208225 GCCATGGTATATCTGTGTCATGG + Intergenic
1132345255 15:101104270-101104292 GCCCTGGACCATCTGTGGGACGG - Intergenic
1132956529 16:2597286-2597308 TCCCAGGGATTTCTGTGTGCAGG + Intronic
1139751817 16:69113552-69113574 GACCAGGGATATCTGTGGGGAGG + Intronic
1140544456 16:75792830-75792852 GTCCAGGAATAGATGTTTGAAGG - Intergenic
1144567795 17:16374401-16374423 GCCCAGGAATAGCTGGCTGGAGG + Intergenic
1147324432 17:39663559-39663581 GCCCAGGAGAGGCTGTGTGAGGG - Intergenic
1161592041 19:5133285-5133307 CCCCAGGAAGAGCTGCGTGACGG - Intronic
1161946465 19:7440399-7440421 GTCCAGGAATGTCGGTATGACGG + Exonic
1162256301 19:9492785-9492807 GCCCAGGAATTGATGGGTGAAGG + Intronic
1162930404 19:13954519-13954541 GCCCAGGAAGATATGTCTGTGGG - Exonic
1165263935 19:34645121-34645143 ACCCAGAAATATCTTCGTGAAGG + Intronic
926002229 2:9342995-9343017 ACGCAGGAAAATCAGTGTGATGG - Intronic
926616941 2:15005546-15005568 GCCCAGGAATTTCTGACTCAAGG + Intergenic
936035465 2:109107552-109107574 GGCCAGTAATATCTGAATGAAGG - Intergenic
937577181 2:123437821-123437843 GCCCAGGAACCTTCGTGTGAAGG - Intergenic
939997372 2:148932485-148932507 GCCCAGGACCTTCTGTGTGGTGG - Intronic
942973060 2:181980494-181980516 GCCCAGGAATAGGAGTGTCATGG - Intronic
943329454 2:186541849-186541871 GCCCAGGATTATTTGCGAGAAGG - Intergenic
943535008 2:189137928-189137950 GCCCAGGAAAATATCTGTGTGGG + Intronic
947165465 2:227257271-227257293 GCACAGGAATATCAGTCTGTGGG - Intronic
948614299 2:239188451-239188473 GCACACTAATATCTGTGTGTGGG + Intronic
1170257077 20:14356869-14356891 GCCCAGCCAGAGCTGTGTGATGG + Intronic
1171206729 20:23287518-23287540 GCTCAGGAATCTCTGTCTCAGGG - Intergenic
1171429264 20:25070457-25070479 GCACAGGAGTGTCTGTGTGCAGG - Intergenic
1172963432 20:38815330-38815352 ATCCAGGTATATCTGTGTGTTGG - Intronic
1174465246 20:50712269-50712291 GGACAGAAATATCAGTGTGAAGG + Intergenic
1175856716 20:62124639-62124661 GCGCAGGCCTATCTGTGGGACGG - Exonic
1176255632 20:64151296-64151318 ACACAGGAGTATCTGTGTGGAGG + Intergenic
1178184608 21:30205748-30205770 ACCCAGGAATATCTTTCTCAAGG - Intergenic
1180727949 22:17960539-17960561 GCCCAGGAGTGTGTGTGGGAAGG + Intronic
1181336060 22:22129999-22130021 TCACTGGATTATCTGTGTGAAGG + Intergenic
1182542223 22:31049988-31050010 GCCCAGGATTTCCTGTGTGTGGG - Intergenic
1183477194 22:38042235-38042257 GCCCCGGAGGATCTCTGTGATGG + Intergenic
1185379047 22:50498590-50498612 GCACAGGATTGGCTGTGTGAGGG - Intergenic
954124862 3:48522236-48522258 ACCCACGCATATCTATGTGACGG + Intronic
956454015 3:69402935-69402957 GCCCTGGAATTTCTGTATTATGG + Intronic
957082320 3:75646981-75647003 GCCCTGGAATATCTCTCTCACGG + Intergenic
957525646 3:81375527-81375549 ACCCAGGAATATCTTTCTCAAGG - Intergenic
958486027 3:94710128-94710150 TCACAGGGATATCTGTTTGAAGG + Intergenic
959473029 3:106776004-106776026 ACCCAGGAATATCTTTTTCAAGG - Intergenic
959577054 3:107945728-107945750 GCCCAGAAACATTTCTGTGATGG + Intergenic
960962321 3:123080824-123080846 GCCCTGGAATATCCCTGTGCAGG - Intronic
961641927 3:128370335-128370357 GCCCAGAGATAGCTGTGTGGAGG + Intronic
963405707 3:144861378-144861400 CCACAGGAATCTGTGTGTGAAGG + Intergenic
966764635 3:183449448-183449470 GCACAGGAATTCCTGTGTTAGGG - Intergenic
966818780 3:183909153-183909175 GCCCAGGAGGACCTGCGTGAGGG - Intergenic
967605171 3:191436479-191436501 GCTCATCAATATCTGTGTAATGG - Intergenic
972164583 4:36266759-36266781 GGCCAGGAAACTCAGTGTGAAGG + Intergenic
975061278 4:70004382-70004404 GCCCATGAAAATCTCTGAGAGGG - Intergenic
975868801 4:78754757-78754779 CCCTAGGAATATCTGTGAAAAGG + Intergenic
977464187 4:97362531-97362553 GCCCACCAAAAACTGTGTGAAGG - Intronic
980887173 4:138775796-138775818 GCCCAGGGATCTCTGAGGGATGG - Intergenic
983844792 4:172504515-172504537 ACCCAGGAATATCTTTCTCAAGG - Intronic
984590265 4:181609136-181609158 GGCCAGGAATGTGGGTGTGAAGG + Intergenic
987383398 5:17306880-17306902 CCCGAGGAGTATCTGGGTGAAGG + Intergenic
988502305 5:31793423-31793445 CCACAAGAATATCTGTGGGAAGG - Intronic
989140026 5:38192787-38192809 CCCCAGGAATCTCTGGGTGATGG - Intergenic
989586668 5:43079168-43079190 ACCCAGGAATAACTGTTTCAAGG + Intronic
996403441 5:123086491-123086513 GCCCAGGGTCAACTGTGTGAGGG + Intergenic
996843814 5:127877787-127877809 GTCCAGAAATATGTGTGTGGGGG - Intergenic
1001193047 5:169648184-169648206 GGCCAGGAAAATCTTTGTTATGG + Intronic
1008170792 6:48202908-48202930 ACCCAGGAATATCTTTCTCAAGG + Intergenic
1008875924 6:56327731-56327753 GCCCAGGAGTATCTAACTGATGG - Intronic
1013228232 6:108136702-108136724 GCTGAGGAATAGCTGTGGGAGGG + Intronic
1013673355 6:112429837-112429859 GCAGAAGAATATCTGTGTGAAGG - Intergenic
1016849219 6:148600183-148600205 GCCCAGGAATGTCTTTCTCAAGG - Intergenic
1017652804 6:156598580-156598602 TCCCAGGAATCCCTGTGTCAGGG - Intergenic
1017977742 6:159372941-159372963 GTCTAGGAGCATCTGTGTGAAGG + Intergenic
1018228658 6:161655061-161655083 GCCCAGGAATGCCTCTGTGACGG - Intronic
1021855433 7:24850277-24850299 GCACAGGAGTATCAGCGTGAAGG - Intronic
1030762280 7:113366316-113366338 ACCCAGGAATGTCTTTCTGAAGG - Intergenic
1030782265 7:113616010-113616032 ACCCAGGAATATCTTTCTCAAGG - Intergenic
1035319174 7:158017448-158017470 GCCCAGGAGCACCTGTGTGCAGG + Intronic
1035319585 7:158020110-158020132 ACTCAGGAGCATCTGTGTGATGG + Intronic
1036967177 8:13313070-13313092 GCCCAGGAAATCCTGTGAGAAGG - Intronic
1038178363 8:25202335-25202357 TCCCAGGGATCTCTGGGTGATGG + Intronic
1038235043 8:25745088-25745110 GACCAGAAATATCTGGGGGAAGG - Intergenic
1040580673 8:48696241-48696263 GTCTTGGAATGTCTGTGTGAGGG + Intergenic
1041858903 8:62488791-62488813 GCTGAGGAATAACTGTGTGTAGG + Intronic
1043861740 8:85325535-85325557 GTCCAGGAATGACTTTGTGATGG + Intergenic
1044129498 8:88504157-88504179 GCCCAGGAATGTGTGTGTATGGG + Intergenic
1044264474 8:90165909-90165931 ACCCAGGATTCTCTGCGTGAGGG + Intergenic
1046258700 8:111736910-111736932 GGCCAGGAATTTCTGTTTTAAGG - Intergenic
1049402153 8:142433249-142433271 GCCCAGGAAGAGCTGGATGAAGG - Intergenic
1049573286 8:143379413-143379435 GCCCAGGAATGTGTGTTTGAGGG + Exonic
1050331263 9:4548906-4548928 GCTGAGGAATATCTGTGTTTGGG + Intronic
1053090076 9:35267197-35267219 GCATAGGAATCTCTTTGTGATGG - Intronic
1053471194 9:38347054-38347076 GCCCAGGGGTGTGTGTGTGAGGG + Intergenic
1055373677 9:75625878-75625900 TCCCAGGACTCTCTGTGTGCCGG + Intergenic
1056601783 9:88052562-88052584 ACCCAGGAATATCTTTCTTAAGG - Intergenic
1056820804 9:89840674-89840696 GCCCTGGAATATAGATGTGATGG + Intergenic
1060318860 9:122536685-122536707 GCCCAGGAATGTCTTTCTCAAGG + Intergenic
1061861725 9:133471886-133471908 GCACAGGAAGAGCAGTGTGATGG - Exonic
1062451195 9:136616499-136616521 GCCCAGGAGCACCCGTGTGAGGG + Intergenic
1062641141 9:137519250-137519272 CCCCACGACGATCTGTGTGATGG - Intronic
1203443181 Un_GL000219v1:30455-30477 GCCCTGGAATATCTCTCTCATGG - Intergenic
1203513989 Un_KI270741v1:149364-149386 GCCCTGGAATATCTCTCTCATGG - Intergenic
1186435945 X:9543307-9543329 GGCCAGGAATCTCTGTGGGGTGG + Intronic
1191239126 X:58166444-58166466 GCTCAGAAATATCTGTTTGTAGG - Intergenic
1191239566 X:58173253-58173275 GCTCAGAAATGCCTGTGTGAAGG - Intergenic
1192539778 X:71958071-71958093 GCTCAGGAATGTTTGTGTGGTGG + Intergenic
1194850691 X:98865009-98865031 GCCCAGGATTCTTTGTGTGTGGG - Intergenic
1195608670 X:106838403-106838425 TCTCAAGGATATCTGTGTGAAGG + Intronic
1195678665 X:107526869-107526891 GCCAACCAATAACTGTGTGAGGG + Intronic
1197196765 X:123710163-123710185 GCCAAGGAGTATATGTGTTAAGG + Intronic
1197680423 X:129377066-129377088 ACTCAGGAATATCTATGGGACGG + Intergenic
1199068168 X:143444673-143444695 GTCCAGGAAGAGCTGGGTGAGGG - Intergenic