ID: 1091784874

View in Genome Browser
Species Human (GRCh38)
Location 12:3237280-3237302
Sequence GCCCATCAGGAGGCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784874_1091784880 13 Left 1091784874 12:3237280-3237302 CCTGGGCTTGCCTCCTGATGGGC 0: 1
1: 0
2: 4
3: 22
4: 250
Right 1091784880 12:3237316-3237338 ACTTACGATCAAAGACAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63
1091784874_1091784879 9 Left 1091784874 12:3237280-3237302 CCTGGGCTTGCCTCCTGATGGGC 0: 1
1: 0
2: 4
3: 22
4: 250
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784874 Original CRISPR GCCCATCAGGAGGCAAGCCC AGG (reversed) Intronic
902249113 1:15141719-15141741 ACCCACAAGGAGGCAAGCCCAGG + Intergenic
902518350 1:17001954-17001976 GGCCCAGAGGAGGCAAGCCCTGG + Intronic
902547993 1:17202209-17202231 TCCCATCAGGATTCAACCCCAGG - Intergenic
902713419 1:18256085-18256107 GCCCATCAGGTGGGAGGGCCTGG - Intronic
903791156 1:25894024-25894046 GCTCCTCAGGATGCAGGCCCAGG - Intronic
904382931 1:30123847-30123869 GCTCAGCATGAGGCAGGCCCCGG - Intergenic
904413016 1:30336322-30336344 CCCCATGAGGAGGCAGGGCCTGG - Intergenic
904442417 1:30540433-30540455 GCAGATCAGGAGGCAAGCTGGGG + Intergenic
905016388 1:34781580-34781602 GCCCCTCCGGAGGCTGGCCCGGG + Exonic
907314686 1:53560821-53560843 CCCCTTCAGGTGGCAAGGCCTGG - Intronic
908074229 1:60496525-60496547 GCTCATGAAGAGGCAAGCTCTGG - Intergenic
908641205 1:66225554-66225576 GCCCATCAGGAGAAATGCCATGG - Intronic
908804605 1:67917242-67917264 ACCCATCAGGAGCTAAGCCTTGG - Intergenic
911158100 1:94656178-94656200 GACAATCAGGACTCAAGCCCAGG + Intergenic
912542714 1:110429182-110429204 GCCCATCAGGACACAAAGCCAGG - Intergenic
912729294 1:112087807-112087829 GCCCCTGAGGAGGCAAGGGCCGG - Intergenic
913326984 1:117635945-117635967 GCCCAAGAGGAAGCAAGCACTGG - Intergenic
915301855 1:154956267-154956289 GCCCACCAGGAGGTAAGCCCAGG - Intergenic
916648623 1:166814772-166814794 ACCCATGAGGAGGCAAGGCAAGG - Intergenic
919927387 1:202199355-202199377 GCCCATCAGAAGGCAGACCCGGG + Intronic
921774550 1:219081925-219081947 GCCATCCAGGAGGCAAGGCCTGG + Intergenic
922169313 1:223142004-223142026 GCCAGTCAGAAGGGAAGCCCTGG - Intronic
923110071 1:230883295-230883317 GACCATCATGAGGCAAACACAGG - Intergenic
1064006299 10:11702043-11702065 TCCCATCAGATGGCAAACCCAGG - Intergenic
1067247408 10:44558247-44558269 CCCCACCAGGAGGAAAGGCCAGG - Intergenic
1069743054 10:70697760-70697782 GCCCCTCAGGGTGTAAGCCCAGG - Intronic
1069834356 10:71299331-71299353 CCCCATCAGGAGGCTGCCCCAGG - Exonic
1069942577 10:71965270-71965292 GCCCTTCCGGAGGCGAGGCCCGG + Intronic
1071664206 10:87538011-87538033 GCCCACCAGGAGACCAGCCTGGG - Intronic
1072691585 10:97575540-97575562 GCGCATAAGGAGGCAAGGCTAGG + Intronic
1074011813 10:109489909-109489931 TCCCATCAGGAGGCAGACTCAGG + Intergenic
1076000293 10:126907547-126907569 CCCCATCTGCAGGCAAGCACAGG - Intronic
1076505627 10:130971016-130971038 GCCCTTCTGTAGCCAAGCCCAGG + Intergenic
1076549925 10:131271711-131271733 GCCCATGTGGAGGGAAGGCCTGG + Intronic
1077094529 11:793681-793703 GCCAGCCAGGAGGCAAGTCCTGG - Intronic
1077364695 11:2156830-2156852 GCCCAGCAGGGGTCCAGCCCAGG - Intronic
1077429989 11:2511584-2511606 GCCCAACAGGAGCCCAGCTCTGG - Intronic
1080219182 11:29880474-29880496 CCTAATCAGGAAGCAAGCCCAGG - Intergenic
1081756915 11:45551317-45551339 GGCCATCACGAGGAAATCCCCGG + Intergenic
1081806035 11:45891032-45891054 GTCCATCAGGAGCCAGGCCAAGG - Intronic
1081841788 11:46207409-46207431 GCACAGCAGGAGGCAAGCAGTGG + Intergenic
1082260563 11:50073963-50073985 GGCCATCAGGAGGCAGGAGCTGG + Intergenic
1082792501 11:57356205-57356227 GCACATCAGGACTCAAACCCAGG + Intronic
1082815337 11:57504271-57504293 GACCTTGAGAAGGCAAGCCCTGG - Intronic
1083412645 11:62504889-62504911 GCCCATCAGCAGGCCAGCTTAGG - Intronic
1084751235 11:71205488-71205510 GCCCCTCAGGAGGCAGTGCCAGG + Intronic
1085259311 11:75195308-75195330 GCCCATCAGGAGGCAGTGCCAGG - Intronic
1085382330 11:76131317-76131339 GCCCATCTGGAGGCCAGCTCAGG - Intronic
1085617777 11:78014650-78014672 TCCCATTAGGAGGCAAAGCCAGG + Intergenic
1086602962 11:88658049-88658071 GCACAGCAGGAGGTGAGCCCTGG + Intronic
1088761558 11:112933855-112933877 GGCCCTCAGGAGGGAAGCCCAGG - Intergenic
1089104284 11:115989353-115989375 TCCCACCAGGAGGCAAGATCGGG + Intergenic
1089324825 11:117649911-117649933 GCACATCAAGAGGCAACTCCTGG - Intronic
1089574608 11:119432510-119432532 TCTCACCAGGAGGCAGGCCCCGG - Intergenic
1089621059 11:119722499-119722521 GCCCATCTGGAGGCTAGCCGTGG - Intronic
1091550116 12:1530485-1530507 GCCGATCCGGAGGGAGGCCCTGG - Intronic
1091591752 12:1846629-1846651 GCTTCTCAGGAGGCCAGCCCGGG + Exonic
1091765276 12:3116232-3116254 GCAGATCAGGATGCAGGCCCTGG + Intronic
1091784874 12:3237280-3237302 GCCCATCAGGAGGCAAGCCCAGG - Intronic
1092164939 12:6336818-6336840 TCCCAGCAGGAAGCAAGCCAAGG + Intronic
1096546105 12:52341305-52341327 GCCCATCATGGGGTCAGCCCTGG + Intergenic
1102430189 12:112876903-112876925 TCACTTCAGGAGCCAAGCCCAGG + Intronic
1102450097 12:113035617-113035639 GCGCATAAGGAGGCAAGGCTAGG + Intergenic
1102490552 12:113287596-113287618 GAGGGTCAGGAGGCAAGCCCAGG - Intronic
1103335112 12:120183620-120183642 GCGCACCAGGAGGCAGGTCCAGG + Exonic
1104799013 12:131540744-131540766 GCCCATCAGTAGGCAAGTGGTGG + Intergenic
1104830820 12:131750063-131750085 GCCCTTCGGGAGGCTGGCCCTGG + Intronic
1104938994 12:132386128-132386150 GCCCACCAGGAGGAACCCCCTGG - Intergenic
1105451175 13:20501723-20501745 TCCCATAAGGAAGCAATCCCTGG - Intronic
1107290891 13:38851880-38851902 ATCCATCAGGAGACAGGCCCTGG - Intronic
1111515553 13:89326543-89326565 GCCCATCATGAGACAAACTCAGG + Intergenic
1112723706 13:102277557-102277579 GCAGATCGGGAGGCCAGCCCTGG + Intronic
1113776102 13:112945999-112946021 GCTCATCAGCACGCCAGCCCGGG + Intronic
1114452596 14:22836959-22836981 GCCCGCCGGGAGGCGAGCCCGGG + Intronic
1119472287 14:74907551-74907573 GCCTCTGAGGAGGCAACCCCAGG + Intronic
1121035371 14:90699013-90699035 GCGAATCAGCAGACAAGCCCTGG - Intronic
1121087838 14:91160128-91160150 GCCCACCACAAGGCAGGCCCAGG + Intronic
1121323104 14:93004187-93004209 GGCCAGCAGGAGGCACACCCTGG + Intronic
1121415858 14:93779042-93779064 GCCAAGCAGGAGGGAAGCCAAGG - Intronic
1121694975 14:95904832-95904854 TCCCCTCAGGACGCTAGCCCTGG + Intergenic
1123179812 14:106459330-106459352 GTCCATCAGGCGCCAGGCCCAGG - Intergenic
1124129709 15:26972650-26972672 CACCATCAGGAGGCAATGCCAGG + Intronic
1125207223 15:37167402-37167424 GCACATCAGGAGGTGAGCCGTGG + Intergenic
1128290359 15:66473926-66473948 GCACATCAGGAGGCTAGGGCGGG - Intronic
1130742865 15:86619966-86619988 GCCCATCAGCAGGAAAGACTGGG - Intronic
1132128099 15:99247700-99247722 GCCCATTTGCAGGCAAGTCCTGG - Intronic
1132299861 15:100768745-100768767 GACCATCAGGAAGCAACACCTGG - Intergenic
1132606854 16:797221-797243 GCCCCTCATGAGGCAGGGCCAGG + Intronic
1132722469 16:1323486-1323508 GCCCAGCAGGCACCAAGCCCAGG - Intronic
1133117056 16:3583301-3583323 GCCCAGCAGGAGGCCACCACAGG - Exonic
1133229653 16:4360518-4360540 GCCCATCAGGACTCCAGGCCAGG + Exonic
1133500218 16:6358751-6358773 ATCCATCAGGAGACAAGCTCTGG - Intronic
1133716943 16:8458896-8458918 ACTCATCTAGAGGCAAGCCCTGG + Intergenic
1135972756 16:27084396-27084418 GGCCAGCATGAGGCAAGCCAGGG - Intergenic
1136233301 16:28900431-28900453 GGCCCTGAGGCGGCAAGCCCAGG + Intronic
1136501090 16:30669956-30669978 GCCCTTGGGGAGGCAGGCCCAGG - Exonic
1136544817 16:30949030-30949052 CCCCATCATGTGGCTAGCCCCGG + Intergenic
1136682977 16:31978691-31978713 TCCCAGCAGCCGGCAAGCCCTGG - Intergenic
1136886173 16:33931559-33931581 TCCCAGCAGCCGGCAAGCCCTGG + Intergenic
1137499368 16:48998449-48998471 GCCCAGTGGGAGGGAAGCCCAGG + Intergenic
1138476260 16:57272113-57272135 GCCCAGAAGGAGGAAGGCCCTGG - Intronic
1139354559 16:66359887-66359909 GCCCAGAACCAGGCAAGCCCAGG - Intergenic
1141127938 16:81414475-81414497 GCCAAGAAAGAGGCAAGCCCTGG - Intergenic
1141189160 16:81811160-81811182 GAGACTCAGGAGGCAAGCCCAGG - Intronic
1141835138 16:86533463-86533485 GGTCATCAAGAGGCAAGCCATGG + Intronic
1142210369 16:88805685-88805707 GCGGCTCAGGAGGCAGGCCCGGG - Intronic
1203086263 16_KI270728v1_random:1186241-1186263 TCCCAGCAGCTGGCAAGCCCTGG - Intergenic
1142632296 17:1232933-1232955 GCCCAGCAGGAGGCAAGGAGGGG - Intergenic
1143845995 17:9772961-9772983 GCCCACCAGGAAGCAGGGCCGGG - Intronic
1143998585 17:11031508-11031530 CCTCAGCAGGAGGCAACCCCAGG + Intergenic
1144743005 17:17594698-17594720 GGCCATCAGGAGGTTTGCCCTGG - Intergenic
1145000968 17:19304455-19304477 GCCCAGCAGAAAGCAACCCCAGG + Intronic
1145307012 17:21680970-21680992 GACCAGGAGGAGGAAAGCCCAGG - Intergenic
1145923403 17:28628254-28628276 GGTCATCAGGAGGTAAGCTCGGG - Exonic
1145995985 17:29105296-29105318 GGGCAGCAGGAGGAAAGCCCAGG + Intronic
1146257015 17:31397523-31397545 GCACATCAGAAGGAAGGCCCAGG + Intronic
1146551061 17:33780777-33780799 GCCCTTCAGGGAGCAAGACCTGG + Intronic
1147143882 17:38474400-38474422 TCCCAGCAGCCGGCAAGCCCTGG - Intronic
1147332522 17:39707164-39707186 GCCCAGCTGGAGGCAGGGCCTGG - Intronic
1148062845 17:44848528-44848550 GGCCATAAGGAAGGAAGCCCTGG - Intronic
1148210910 17:45807971-45807993 GCCCAGCAGCAGCCATGCCCAGG - Intronic
1149537645 17:57444775-57444797 GCACATCCAGAGGAAAGCCCGGG + Intronic
1151427659 17:74041535-74041557 GCCCATCAGAAGGCATTCCCCGG + Intergenic
1152031790 17:77847378-77847400 GCACAGCTGGAGGCAAGCCTGGG - Intergenic
1152127168 17:78454207-78454229 GCCAAGCGGGAGGCAACCCCAGG + Intronic
1153985329 18:10345840-10345862 GCCCATCAGGCCCCAGGCCCAGG - Intergenic
1155158667 18:23178369-23178391 GGACATCAGGCGGCCAGCCCAGG - Intronic
1155158681 18:23178417-23178439 GGACATCAGGCGGCCAGCCCAGG - Intronic
1156349910 18:36295374-36295396 GCACATCAGGAAGCAGGCCCTGG + Intergenic
1157204584 18:45687598-45687620 ACCCATCAAGAAGCAAGCACTGG - Intergenic
1157680713 18:49603304-49603326 CCCCATCAGGAGCCCAGCTCTGG - Intergenic
1158346236 18:56519661-56519683 GACACTCAGGAGGCAAGCCCTGG - Intergenic
1160500272 18:79398178-79398200 CTCCATGAGGAAGCAAGCCCGGG - Intronic
1161394073 19:4035420-4035442 GGCCAACTGGAGGCAGGCCCTGG - Intronic
1161565206 19:4998061-4998083 CCCAGTCAGGAGGCAACCCCTGG - Intronic
1162061945 19:8101478-8101500 GCACAGCAGGAGCCAAGGCCTGG - Intronic
1163744619 19:19037933-19037955 GCACAGCAGGAGGCAAGCGTAGG + Intronic
1165386521 19:35513437-35513459 GGCCAGCAGGAGGCAGGCCAGGG + Exonic
1166079227 19:40433552-40433574 GCCTGTCAGGAGACAAGGCCAGG + Intergenic
1168467785 19:56618204-56618226 GCACAGCAGGATTCAAGCCCTGG - Intronic
1168723571 19:58568940-58568962 GACCAGCAGGATGCAAGCCCAGG + Intronic
927140220 2:20125114-20125136 GCACAGCAGGAGTCAAGCCCAGG - Intergenic
929898846 2:45984359-45984381 GAGCATCAGGAGCCAAGGCCAGG + Intronic
932189726 2:69730622-69730644 GGCCATGTGGAGGCAGGCCCAGG - Intronic
932598316 2:73107817-73107839 GCCGAGCAGGAGCCAAGGCCAGG + Intronic
933338731 2:80994664-80994686 GCCAAAGAGGATGCAAGCCCAGG + Intergenic
933588149 2:84202037-84202059 GCTTATCAGGAGAAAAGCCCTGG - Intergenic
933888227 2:86740061-86740083 GCACAGCAGGAGGCAAGCAGCGG + Intronic
933921951 2:87056645-87056667 GCACAGCAGGAGGCAAGCAGCGG - Intergenic
935129797 2:100253230-100253252 GCCCATCTGGCGGCCTGCCCTGG - Intergenic
937327640 2:121001007-121001029 ACCCTTAAGGAGGCAAGGCCAGG + Intergenic
938310273 2:130284955-130284977 GCCAATGAGGAGTAAAGCCCAGG + Intergenic
938444658 2:131367419-131367441 GCCGATGAGGAGTAAAGCCCAGG - Intergenic
940277780 2:151957428-151957450 GCCCATCTTGAGGCAAGCAAGGG + Intronic
941540690 2:166780322-166780344 GCCCATCAGAATGTAAGCTCTGG + Intergenic
943961760 2:194273558-194273580 GTAGATCAGGAGGCTAGCCCAGG - Intergenic
947254678 2:228148661-228148683 GCCCACCAGGAGACACTCCCAGG - Intronic
947969476 2:234310398-234310420 GCTCAGCAGGAGAAAAGCCCAGG - Intergenic
948118961 2:235514672-235514694 GGCCACCAGGTGGCAGGCCCTGG - Intronic
948277867 2:236723894-236723916 GCCCTTCAGGAGGCCAACACAGG - Intergenic
948766871 2:240226946-240226968 GCCCCTCAGCAGGCAGGTCCAGG + Intergenic
948771166 2:240251865-240251887 CCCCATCTGGGAGCAAGCCCTGG + Intergenic
948887270 2:240890520-240890542 GCCCATCATGCGGCCACCCCTGG - Intronic
948951987 2:241259072-241259094 GCCCATCAGTAGGAAAGCCTGGG + Intronic
949026907 2:241770597-241770619 GTCCCTCAGCAGGCAAGGCCAGG - Intergenic
1170737197 20:19022317-19022339 GCCCAGCATGAGCCAAGCACAGG - Intergenic
1170871815 20:20212979-20213001 TGCCATCAGGAGGAGAGCCCGGG + Intronic
1170977618 20:21181277-21181299 GGCCAGCATGAGGCAAGACCAGG - Intronic
1172704495 20:36873013-36873035 GCCCAGAGGGCGGCAAGCCCTGG - Intergenic
1175982416 20:62745767-62745789 GGCCAACAGCAGGGAAGCCCTGG - Intronic
1180063119 21:45396648-45396670 GCCCATCAGGGGTCACGTCCTGG - Intergenic
1182468793 22:30534235-30534257 GCCCACCAAGGGGCATGCCCAGG - Intronic
1183242429 22:36667971-36667993 GCCCAGCATGAGGCAAGAGCAGG - Intronic
1183508827 22:38223436-38223458 GGCCACCAGGTGGCAACCCCTGG + Intronic
1183523626 22:38310839-38310861 GGCCATCTGGAGTCAGGCCCTGG + Intronic
1184093817 22:42305881-42305903 GCCCCTCAGGAGGGAGGCACTGG + Intronic
1184979951 22:48089162-48089184 GCCCTTGAGGAGACAAGGCCTGG - Intergenic
1185076330 22:48684868-48684890 GCCTATCAGCAGGGAAGCTCTGG - Intronic
950536413 3:13581592-13581614 GCCAGTCAAGAGGCCAGCCCAGG + Intronic
950574397 3:13823104-13823126 GCCCATCTGGTGACCAGCCCTGG - Intronic
952071324 3:29640017-29640039 GACCATCAGGAAGCATGCTCTGG + Intronic
954392092 3:50273243-50273265 TCGCATCAGGAGGCAAGGCCAGG + Intronic
957014992 3:75053014-75053036 GCCAATCACAAGGCCAGCCCAGG - Intergenic
959573649 3:107911083-107911105 GACCCTCAGGAGGCCAGACCGGG - Intergenic
961381441 3:126498636-126498658 GCCCAGGAGGAGGCACCCCCTGG - Intronic
961667765 3:128504312-128504334 GGCCATCCGGAGCCAAGGCCTGG + Intergenic
962102165 3:132354146-132354168 GCCCATCAGAAGGCCAGCTCTGG + Intronic
962149018 3:132872862-132872884 ACCAATCATGAAGCAAGCCCTGG - Intergenic
962276341 3:134017568-134017590 GCCCATCAGGAAGCCTGCACAGG - Intronic
962880751 3:139574225-139574247 GGCCATCTGGCTGCAAGCCCTGG - Intronic
966124667 3:176562035-176562057 GCCCAGCAGGAAGCATGCCCAGG - Intergenic
966209741 3:177440685-177440707 GCACAACAGAAGGCATGCCCCGG - Intergenic
967929325 3:194679307-194679329 GGCCATCAGGAGTCAGGCCCTGG + Intergenic
968048800 3:195639548-195639570 GCCCTTCAGGATGCCAGCCTTGG + Intergenic
968098601 3:195950079-195950101 GCCCTTCAGGATGCCAGCCTTGG - Intergenic
968305817 3:197650376-197650398 GCCCTTCAGGATGCCAGCCTTGG - Intergenic
968516230 4:1016781-1016803 GCCCATCAGGTGCCAGGGCCAGG - Intronic
968641303 4:1716407-1716429 GCCCACCAGGGGTCCAGCCCAGG - Exonic
969610978 4:8227688-8227710 GGCCAGCAGGAAGCAGGCCCGGG - Exonic
969711941 4:8849692-8849714 GCCCATGTGGATGCAACCCCAGG + Intronic
985135006 4:186777801-186777823 GCCCATCGGGAGGAAAGACAGGG - Intergenic
985407311 4:189650653-189650675 GCCCACCAGGAGGTTTGCCCAGG + Intergenic
985505280 5:276027-276049 GCCCTTCAGGATGCCAGCCTTGG + Intronic
985639206 5:1055647-1055669 GACCAAGGGGAGGCAAGCCCCGG + Intronic
985742847 5:1629593-1629615 GCCCTTCAGGATGCCAGCCTTGG - Intergenic
986250066 5:6047404-6047426 GCTCAACAGAATGCAAGCCCAGG + Intergenic
988135927 5:27171767-27171789 GCACAGCAGGAGGCAAGCGGCGG + Intergenic
988376250 5:30439500-30439522 GCCTCCCAGGAGCCAAGCCCTGG - Intergenic
995461861 5:112411745-112411767 TCCCATTAGGAGGCTGGCCCAGG + Intronic
997638955 5:135435897-135435919 GGCCATCTTGAGCCAAGCCCAGG - Intergenic
997652220 5:135530861-135530883 GCCCAGCAAGGGGAAAGCCCTGG - Intergenic
1002409550 5:179062708-179062730 GCCCAGAAGGAGGCAGGCCTGGG + Intronic
1003839535 6:10105774-10105796 GCCCATCAGCTGGCCAGGCCAGG - Intronic
1004591251 6:17054091-17054113 GACCATGAGGAGGCTAGCCAGGG + Intergenic
1005362076 6:25040458-25040480 GACCACCAGTAGCCAAGCCCTGG - Intronic
1006188070 6:32191678-32191700 TCCCCCCAGGAGGCAAACCCAGG - Intronic
1006271550 6:32970126-32970148 GCCCATCAGGGGGCCGGCCATGG - Intronic
1006354783 6:33548806-33548828 GCACAGCAGGAGCCCAGCCCTGG - Intergenic
1006433486 6:34013324-34013346 GCACATAAGGAGGCGAGGCCAGG + Intergenic
1007582439 6:42967502-42967524 GCACATCAGCAGGCAGGTCCTGG + Exonic
1010062157 6:71635589-71635611 GTCAATCAGGAGTCAAGGCCTGG + Intergenic
1017525056 6:155235120-155235142 GCCCCTCAGCTGGAAAGCCCTGG + Intronic
1017951741 6:159141131-159141153 GCCCCTCAGGAGGCAGGGGCTGG - Intergenic
1017986082 6:159444289-159444311 TCCCATCAGGAGGCTGGGCCAGG - Intergenic
1018645335 6:165942776-165942798 GCCCTCCAGGAGGAAAGCCCTGG + Intronic
1018785131 6:167102459-167102481 CCCCATGGGGAGTCAAGCCCAGG - Intergenic
1019310320 7:357288-357310 GCCTCTCAGGAGGCAAGCACAGG - Intergenic
1019358196 7:591897-591919 GCCCACCAGAAAGCCAGCCCCGG + Intronic
1019520773 7:1459663-1459685 GCCTATCAGGAGGCAGGACCCGG - Intergenic
1019635844 7:2075164-2075186 GGCAATTAGGAGCCAAGCCCTGG + Intronic
1019868041 7:3731341-3731363 AACCATTAGGAGGCGAGCCCCGG + Intronic
1020281377 7:6651974-6651996 CCTCAGCAGGTGGCAAGCCCTGG + Intronic
1022479575 7:30734113-30734135 GCCCATCTGGAGGCAAGGGGAGG - Intronic
1023556854 7:41432279-41432301 GCCTATGAGGAGGCAAGCATTGG + Intergenic
1025813080 7:64887925-64887947 CCCCATCAGGATGCAAGTTCTGG - Intronic
1026045328 7:66902688-66902710 GGCCATCAGGAGGCAGGAGCTGG - Intergenic
1026939189 7:74277006-74277028 CCCCATCAGGAAGGAAGCACTGG - Intergenic
1026959717 7:74400575-74400597 GCCCACCAGGAGGCAAGCCACGG + Intronic
1027177506 7:75914292-75914314 ACCAAGCAGGAGGCAAGCCCTGG - Intronic
1034431872 7:151045256-151045278 GCTCATCCGGAGGCAGGCCCTGG + Exonic
1035205112 7:157289944-157289966 GTGCGTCAGGAGGCAGGCCCAGG + Intergenic
1035263339 7:157675256-157675278 GCTCGGCAGGAGGGAAGCCCTGG - Intronic
1037966191 8:23135501-23135523 GCCCAGCAGGAACGAAGCCCTGG + Intergenic
1038644918 8:29352948-29352970 GCCTCTCAGGAGGCAGGTCCGGG + Intergenic
1041413383 8:57581310-57581332 GCCTATAAGGAGGGAAGCACGGG - Intergenic
1042206123 8:66331609-66331631 GCCTATCAGGAGCCAAGCCCTGG - Intergenic
1042338828 8:67657598-67657620 GCCTATCAGGAAGCAAGAGCTGG - Intronic
1042932576 8:74028071-74028093 GCCCATCAGGAGTTTTGCCCAGG - Intronic
1047761846 8:127960349-127960371 GGCCTCCAGGAGGCAAGACCAGG - Intergenic
1047891390 8:129315202-129315224 GCCCAGCAGGAGGTGAGCTCAGG + Intergenic
1048307501 8:133294587-133294609 GTCCATGAGGAGGCAAGTTCAGG + Intronic
1048607208 8:135982035-135982057 GCACAACAGGAGGTAAGCCATGG + Intergenic
1049180383 8:141219119-141219141 TCCCATCATGAGGGCAGCCCCGG - Intronic
1049229505 8:141474719-141474741 GCCCACCAGGAGCAGAGCCCTGG + Intergenic
1049423817 8:142528434-142528456 GCCCCTCAGGAGTCCAGCCTGGG - Intronic
1049715830 8:144091053-144091075 GCACATCAGGAGGCCAGGGCAGG - Intergenic
1050130199 9:2403957-2403979 GCCCAGCTGGTGGCAAGTCCTGG - Intergenic
1054786614 9:69216434-69216456 GCCCATCAGCAGGCCCACCCGGG - Exonic
1057170624 9:92961004-92961026 GCCCACCAGGAGAGAGGCCCAGG - Intronic
1057509583 9:95666382-95666404 GTCCATCAGAAGGCCAGCTCCGG + Intergenic
1059117588 9:111613534-111613556 ACGCAGGAGGAGGCAAGCCCAGG + Intergenic
1059519111 9:114923190-114923212 GCCCATAAGAAGGCAAGCCCAGG - Intronic
1060702306 9:125767061-125767083 GCTCATCAGGTGGAAAGACCTGG + Intronic
1061386746 9:130295039-130295061 GCCAAAGAGGAGGCCAGCCCCGG - Intronic
1203792409 EBV:158973-158995 GCCCATCCGGGGGCAGGGCCTGG + Intergenic
1186220645 X:7345642-7345664 GCCCATCAGGAGTTTTGCCCAGG - Intronic
1186428324 X:9483078-9483100 GCACTTCAGGAGGCCAGCCCTGG - Intronic
1189450404 X:41123673-41123695 GTCCATCAGGAGCCTGGCCCTGG - Exonic
1189852054 X:45187625-45187647 GCCCTGCAGGAGGGGAGCCCGGG + Intronic
1190732546 X:53234905-53234927 GCCCATCAGGCAGCACCCCCAGG + Exonic
1192848373 X:74928179-74928201 GTCCATCAGGAGACCAGCCATGG + Intergenic
1195108111 X:101619578-101619600 CCCTTTCAGGAGGCAAGCCAGGG + Intergenic
1197527726 X:127582922-127582944 GCCCTCCAGGAGGCAAGTCATGG + Intergenic
1199613833 X:149639726-149639748 GCCCCTCAGGGGGCAGGCTCAGG + Intergenic
1200164498 X:154026845-154026867 GCCCACCAGCAGGCAGGGCCGGG + Intronic
1201771604 Y:17621600-17621622 GCCGACCAGCAAGCAAGCCCAGG + Intergenic
1201829951 Y:18284386-18284408 GCCGACCAGCAAGCAAGCCCAGG - Intergenic