ID: 1091784875

View in Genome Browser
Species Human (GRCh38)
Location 12:3237290-3237312
Sequence CAGGAGGCAAGCCCATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784875_1091784880 3 Left 1091784875 12:3237290-3237312 CCTCCTGATGGGCTTGCCTCCTG 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1091784880 12:3237316-3237338 ACTTACGATCAAAGACAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63
1091784875_1091784879 -1 Left 1091784875 12:3237290-3237312 CCTCCTGATGGGCTTGCCTCCTG 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784875 Original CRISPR CAGGAGGCAAGCCCATCAGG AGG (reversed) Intronic
900574004 1:3374092-3374114 CACGAGGCAAACCTCTCAGGAGG + Intronic
900917944 1:5651416-5651438 CAGTGGCCCAGCCCATCAGGTGG - Intergenic
901186385 1:7375970-7375992 CAGGAGGCAGGCCTACCAAGGGG + Intronic
902625446 1:17673641-17673663 CAGGAGGCAACCTCTGCAGGAGG + Intronic
902636830 1:17740174-17740196 CAGGAGACAAGCCCATGAGTAGG - Intergenic
904246971 1:29194673-29194695 CAGGAGGCAGGCCCAGGAAGGGG - Intronic
904906730 1:33902831-33902853 CAGGAGGAAAGGCAATCAGAGGG - Intronic
907148867 1:52263170-52263192 CAGGAACCAAGCCCAGAAGGTGG + Intronic
911909262 1:103611706-103611728 CAGGAAGCAAGCTCATAAAGAGG + Intergenic
917711937 1:177693867-177693889 CAGTAGGCAATTCCATCAGCTGG + Intergenic
919896144 1:202010918-202010940 GAGGAGGGAAGCCCAGCTGGAGG + Exonic
920734544 1:208519018-208519040 AAGGAGGAAAGCCCAACAGCAGG - Intergenic
921831384 1:219731823-219731845 TGGGAGGCAAGCTCATCAGAAGG + Intronic
922351022 1:224734720-224734742 CAGGAGTCAAAACCACCAGGAGG - Intronic
922620778 1:226986716-226986738 CAAGAGGCAGGCCCAGCAGTAGG + Exonic
924116629 1:240753842-240753864 TAGGAGGAAGGCCCATCAGGGGG - Intergenic
1064388566 10:14921434-14921456 CAGGAGGCAACAGAATCAGGAGG - Intronic
1066185187 10:33003503-33003525 CAGGACGCCATCCCATCATGGGG - Intronic
1067577635 10:47418350-47418372 CAGGAGGCAAGTCAACCAGAGGG + Intergenic
1069687000 10:70324758-70324780 CAGGAAGCAAGGGCAGCAGGTGG + Intronic
1069942076 10:71963425-71963447 CAGGAGGAATGCCCAGCAAGTGG + Intergenic
1070330197 10:75410776-75410798 CAGGAGCAAAGCCCTTGAGGTGG - Intergenic
1070872441 10:79768493-79768515 CAAGAGGCAAGGCCTTTAGGAGG - Intergenic
1071639362 10:87290645-87290667 CAAGAGGCAAGGCCTTTAGGAGG - Intergenic
1071655875 10:87447304-87447326 CAAGAGGCAAGGCCTTTAGGAGG + Intergenic
1075074045 10:119338633-119338655 CAGGAGGGCAGCCCATGAGATGG - Intronic
1075671787 10:124268039-124268061 CAGGAGGCAGGGGCACCAGGAGG + Intergenic
1076425328 10:130363376-130363398 CAAGGGGCAAGCACAGCAGGAGG + Intergenic
1076440687 10:130479369-130479391 CAGGAAGACAGCCAATCAGGAGG - Intergenic
1077045039 11:540958-540980 CAGCAGGCAAGACCAGCAGGAGG - Intronic
1077337280 11:2011037-2011059 CAGGAGGCAACCCCACCACAGGG - Intergenic
1077747485 11:4923553-4923575 CAAGAGACAAGCCAATCATGGGG + Exonic
1079940718 11:26677127-26677149 CAGGAGGCAAGAACATCTGGTGG + Intronic
1080311718 11:30901584-30901606 AATCAGGCAAGCCCATCAGTAGG - Intronic
1080335722 11:31193676-31193698 TAGGAGGGAAGGCCATCAGAGGG - Intronic
1080590006 11:33714908-33714930 CAGCAGGCAGGTCCTTCAGGAGG - Intronic
1083683141 11:64360434-64360456 CAGGAAGCAGCCCCGTCAGGTGG - Intronic
1083720805 11:64602659-64602681 CAGGATTCAAACCCATCAGTAGG + Intergenic
1084220390 11:67674303-67674325 CAGGGGGCAAGCCCACCAAGGGG - Intronic
1084455816 11:69267697-69267719 CAGGAGGCAGGCCCCAGAGGAGG + Intergenic
1085467744 11:76735660-76735682 GAGGAGGCAAACCCTCCAGGTGG - Intergenic
1085516195 11:77113207-77113229 CAAGAGGGAGGCCCAGCAGGCGG - Intronic
1086284106 11:85225641-85225663 GAGGAGGCAATGCCATAAGGAGG - Intronic
1088970733 11:114772758-114772780 CATGAGCCAAGCACATCAGTGGG - Intergenic
1089355020 11:117843872-117843894 CAGGAGGCAGGGCCAAGAGGTGG + Intronic
1089812364 11:121142542-121142564 CAGGAGGCAATGCCTTGAGGAGG - Intronic
1091098369 11:132845573-132845595 CAGGATGGGAGCCCTTCAGGTGG + Intronic
1202820264 11_KI270721v1_random:66219-66241 CAGGAGGCAACCCCACCACAGGG - Intergenic
1091784875 12:3237290-3237312 CAGGAGGCAAGCCCATCAGGAGG - Intronic
1094110387 12:26855667-26855689 CAGGAAGCAAGACTATCAGCAGG - Intergenic
1100320212 12:93484104-93484126 CCTCAGGCAAGCCCCTCAGGAGG - Intronic
1100807885 12:98306651-98306673 CCTCAGGCAAGCCCTTCAGGAGG - Intergenic
1101902325 12:108799927-108799949 CAGAAGGCAGACCCACCAGGTGG + Intronic
1102578160 12:113870240-113870262 CAGGAGGCGTGGCCATCAGCAGG - Intronic
1103885797 12:124199154-124199176 CAGGAGAAAAGCTCAGCAGGAGG - Intronic
1104066207 12:125309092-125309114 CAGTTTACAAGCCCATCAGGTGG - Intronic
1104203814 12:126617378-126617400 CACTAGGCAAGCCTATCTGGGGG + Intergenic
1104551827 12:129764133-129764155 CAGGTAGCAAGCCCATCACTTGG + Intronic
1105823529 13:24101143-24101165 CAGGGGCCAGGGCCATCAGGAGG - Intronic
1109069182 13:57741455-57741477 CAGGACTCAATCACATCAGGTGG - Intergenic
1109569239 13:64164529-64164551 CAGGATGCATGCTCATCAGCTGG + Intergenic
1109659142 13:65435804-65435826 CAGGTGGCAAGCCTAGCTGGGGG + Intergenic
1112421921 13:99260096-99260118 CAGCAGGCCATGCCATCAGGTGG - Intronic
1114438535 14:22727899-22727921 GAGGAGGCAGGCGCATCATGAGG + Intergenic
1117806957 14:59503503-59503525 CAGGAAGCAAGCACATAAAGTGG + Intronic
1119992163 14:79210959-79210981 AAGGAGGCAATCCAAGCAGGTGG - Intronic
1121432136 14:93895116-93895138 GAGGAGGCAGCCCCATGAGGAGG - Intergenic
1121907992 14:97765018-97765040 CAGGAGGCAGGGCCCTCAGATGG + Intergenic
1126900664 15:53310919-53310941 GGGCAGGCAGGCCCATCAGGAGG - Intergenic
1129004094 15:72357825-72357847 CAAGAAGCAAGCCAATAAGGGGG + Intronic
1129668445 15:77592799-77592821 CATGAGGCAAACCCATCACCAGG + Intergenic
1130851558 15:87799644-87799666 CAGGAGGCCACCCCATCACAGGG + Intergenic
1130854019 15:87824904-87824926 CAGGAGTCCATCCAATCAGGGGG - Intergenic
1132911907 16:2318091-2318113 CAGGAGCCCAGCCCTTCTGGGGG + Intronic
1133316087 16:4884976-4884998 CAGGAGGCGAGGCCCCCAGGTGG - Exonic
1134316499 16:13123742-13123764 CAGGAAGCAAGCCCTTCTTGTGG + Intronic
1134899325 16:17921734-17921756 TGGGAGGGAAGCCCAGCAGGAGG + Intergenic
1135434929 16:22420488-22420510 CAGCCAGCAACCCCATCAGGCGG - Intronic
1135765702 16:25176206-25176228 GGGGAGGCAAGCCCAGCAGGGGG - Intronic
1137691876 16:50434044-50434066 CAGTAGTCAAGCCCATCACTTGG + Intergenic
1137963358 16:52907621-52907643 CAGGAGGCAGGCAGATCACGAGG - Intergenic
1138564797 16:57825164-57825186 CAGGAGGCAAGTCCCTCAAGAGG - Intronic
1140663289 16:77208047-77208069 CAGAATGCAAGCCCTTCAAGGGG + Intronic
1140710053 16:77669279-77669301 CAGGAGACAAACTAATCAGGAGG + Intergenic
1140986783 16:80165531-80165553 CAGGATGCAAGCCCATGATGAGG - Intergenic
1141058998 16:80846898-80846920 CAGGAGGCAAGGCCTTTATGAGG - Intergenic
1141650584 16:85390759-85390781 CAGCAGGCAAGGCCAGCACGGGG - Intergenic
1141777417 16:86133691-86133713 CAGGAGGCCAGGGCACCAGGAGG - Intergenic
1141951020 16:87339460-87339482 CAGGTGACAAGCCCCACAGGAGG + Intronic
1141951500 16:87342860-87342882 CAGGAGGTGAGCCCACCAGCCGG - Exonic
1142044112 16:87914264-87914286 CAGCCAGCAACCCCATCAGGCGG - Intronic
1143731521 17:8885290-8885312 CAGGAGGCAAGGCCATGGGGAGG - Intronic
1143731572 17:8885421-8885443 CAGGAGGCGAGGCCATGGGGAGG - Intronic
1143731805 17:8885963-8885985 CAGGAGGCAGGGCCATGAGAGGG - Intronic
1144447175 17:15341736-15341758 CAGGAGGGAAACCCGTCGGGCGG + Intergenic
1145781387 17:27566187-27566209 CAGGATGCAAGGCCACCAAGAGG - Intronic
1146629510 17:34459771-34459793 AGGGAGGTAACCCCATCAGGAGG + Intergenic
1148952219 17:51323206-51323228 CAGGATGCAGGCCTCTCAGGAGG + Intergenic
1151427442 17:74040289-74040311 CAGGTGGCAACCCCAGCAGCTGG + Intergenic
1151936705 17:77266385-77266407 CAGCAGGCAAGGCCAGCAGGAGG + Intergenic
1152536569 17:80953555-80953577 CTGGAGGCACGGCCATCCGGAGG - Intronic
1153382246 18:4453988-4454010 CTGGAGGCAAGCCCTGCAGCCGG + Intronic
1153560398 18:6367037-6367059 CAGAAGGCAAGGCCAGGAGGGGG + Intronic
1155259028 18:24023544-24023566 AAGGAGGCCAGCCCAACTGGTGG + Intronic
1155694084 18:28662834-28662856 CCTCAGGCAAGTCCATCAGGAGG - Intergenic
1156306721 18:35884575-35884597 CAGGGTGCAAGCCAATGAGGGGG - Intergenic
1156983397 18:43320812-43320834 CAGGAGGGAGGGACATCAGGAGG - Intergenic
1157803863 18:50643749-50643771 CAAGAGGCAAGACCGGCAGGTGG - Intronic
1160071834 18:75635778-75635800 CACGAGGCAAGACGCTCAGGTGG + Intergenic
1161868543 19:6852910-6852932 CAGCGGGCCAGCCCATAAGGGGG - Intronic
1162875477 19:13617996-13618018 CAGGAGTGAAGCCCATCTGCAGG + Intronic
925391515 2:3497745-3497767 CAGGAGGCCAGCCCCGCACGAGG + Exonic
926707238 2:15845512-15845534 CAGGGAGCAGGCTCATCAGGAGG + Intergenic
928842146 2:35622380-35622402 CAGGAGTTAAGCAAATCAGGAGG + Intergenic
929303116 2:40328831-40328853 CTGGAGGCAAGCAGATCAGATGG - Intronic
932716960 2:74107948-74107970 CAGGAGGCAAACCAATAAAGTGG - Exonic
933725447 2:85424289-85424311 CGGGAGGCCAGGCCAACAGGAGG - Intronic
934514899 2:94980621-94980643 CAGAAGGCAAGCCCGCCTGGAGG + Intergenic
936163874 2:110103718-110103740 CAGAAGGCCAGCCCACCCGGAGG - Intronic
936707137 2:115088184-115088206 TAGGAGGCAAGGCCTTTAGGAGG - Intronic
939958520 2:148546417-148546439 CATGAAGCAAGACCATCAGCTGG + Intergenic
940907227 2:159180124-159180146 CAGCAGCCAGGCCTATCAGGTGG - Intronic
944509874 2:200453971-200453993 AGGGAGGCAGGCCCAGCAGGAGG - Intronic
946049115 2:216846956-216846978 TAAGAGGCAAGCCTTTCAGGAGG - Intergenic
948765241 2:240216087-240216109 CAGGAGGCAGACCCCTGAGGAGG - Intergenic
1172957374 20:38770762-38770784 CACGTGGCAAGCCCAGCAGCTGG + Intronic
1173459413 20:43230977-43230999 CTGGTGGCAAGCCCATCTGCAGG + Intergenic
1177179181 21:17726525-17726547 CATCAGGCAATTCCATCAGGAGG + Intergenic
1178473660 21:32917697-32917719 CGGGGTGGAAGCCCATCAGGGGG - Intergenic
1183172907 22:36201312-36201334 GAGGATGGAACCCCATCAGGGGG - Intronic
1183180367 22:36255667-36255689 GAGGATGGAACCCCATCAGGGGG + Intronic
1184014573 22:41776246-41776268 CATGGGGCATCCCCATCAGGAGG + Exonic
1184998300 22:48226547-48226569 CAGGCGGCAAGCTCATCACCGGG + Intergenic
1184998310 22:48226593-48226615 CAGGTGGCAAGCTCAGCAGCGGG + Intergenic
949532214 3:4967119-4967141 CAGGAGCCAATCCGATCAAGTGG + Intergenic
953219996 3:40960919-40960941 CAGGAGCCAAGTCCATAAGAGGG + Intergenic
954287689 3:49630332-49630354 CAGGTGGCAGGCCCTTCAGGAGG + Intronic
954440583 3:50519708-50519730 CAGGAAGCAAGGGGATCAGGTGG + Intergenic
955398714 3:58575863-58575885 CAGGAGGGAAGGCCACCAGCTGG - Intronic
956898900 3:73693135-73693157 CAGGAGGCAAGCCTAGCTGATGG + Intergenic
957403241 3:79743921-79743943 CCTGAGGCAGGCCCTTCAGGAGG - Intronic
960351377 3:116597392-116597414 CTGGATGAAAGCCCATCAGGTGG + Intronic
961683769 3:128616287-128616309 CAGAAGGTAGGGCCATCAGGAGG - Intergenic
962891368 3:139676020-139676042 CAGGATGCCAGCCCATGAGAAGG - Intronic
962940747 3:140122702-140122724 CAGGAGGCAGGCCCATCACTTGG - Intronic
964231544 3:154476030-154476052 TAGAAGGCAAGGTCATCAGGAGG + Intergenic
965781867 3:172294621-172294643 CAGGAAGGAAGCCCATGCGGGGG + Intronic
966929031 3:184663872-184663894 CCAGAGGCAAGCCTATGAGGCGG + Intronic
966941757 3:184752429-184752451 CAAGAGGGAAGCCAATCAGTAGG - Intergenic
968495308 4:912070-912092 GAGGAGGCAGGGCCCTCAGGGGG + Intronic
968661602 4:1801015-1801037 CAGGGGGCAGGCCCATCTAGTGG - Intronic
969043944 4:4322916-4322938 TAGGAAGCAAGGCCATAAGGAGG - Intergenic
969136560 4:5033815-5033837 CAGCAGGCCAGCCCATCAGTTGG - Intergenic
971409187 4:26352399-26352421 CAGGAGGGAAGCCCTTTGGGAGG - Intronic
973769981 4:54197481-54197503 CAGGAGACAAGGCTCTCAGGGGG - Intronic
976580872 4:86735197-86735219 CAGGCTGCCAGCCCATCATGTGG - Intronic
980759024 4:137203725-137203747 CAGGAGGCCAGGTCATGAGGAGG + Intergenic
982273533 4:153616147-153616169 CAGGAGACAGGCCCATCTGAGGG + Intronic
982986297 4:162211575-162211597 TAGGAGGCAAGAAAATCAGGAGG - Intergenic
984868640 4:184307918-184307940 CCTCAGGCAGGCCCATCAGGAGG - Intergenic
985292130 4:188396916-188396938 CAGGAGAAAAGCTCACCAGGAGG + Intergenic
987979568 5:25064424-25064446 CAGGAGGCAAAACCATCCCGTGG + Intergenic
991705138 5:69350359-69350381 CAGGAGGAAATCCCAACTGGTGG + Intergenic
991950097 5:71939041-71939063 CAGGAAGTAAGTCCAGCAGGAGG - Intergenic
992138831 5:73775053-73775075 CAAGGGGCAAGCCTATCTGGAGG + Intronic
994723917 5:103412427-103412449 CAGGAGGCATCCACCTCAGGTGG + Intergenic
997507762 5:134431895-134431917 CACGAGGCAGGCCAATCATGAGG - Intergenic
997880289 5:137583138-137583160 AAGCAGGGAAGGCCATCAGGAGG + Intronic
1001680646 5:173554621-173554643 CAGGAGGCCAGCCTGTGAGGGGG + Intergenic
1003526719 6:6904284-6904306 CAGGTGGCATGCCCATGAGCTGG + Intergenic
1005454271 6:26004086-26004108 CACAAGGCAAGCCCATTAAGGGG + Intergenic
1006271552 6:32970136-32970158 CAGGACAGAGGCCCATCAGGGGG - Intronic
1007127832 6:39442205-39442227 CAGGAGGCAGCCGCAGCAGGTGG - Intronic
1009504646 6:64461067-64461089 CAGGAAGCACTCCCATCAGCAGG - Intronic
1011989536 6:93496738-93496760 CAGGAAGCAAGCCAGTAAGGGGG - Intergenic
1012743304 6:103049031-103049053 CAGGATGCAACTCCATCAGAGGG - Intergenic
1012926641 6:105274373-105274395 TAGGAGGCAGGGCCTTCAGGAGG - Intergenic
1013735364 6:113221092-113221114 CAGGAGGCAAGTCCAGCTTGAGG + Intergenic
1016382070 6:143494559-143494581 CATAAGGCAGGCCCTTCAGGAGG + Intergenic
1017204829 6:151793370-151793392 CAGGAGGCAGGTCCTTCTGGAGG - Intronic
1018246518 6:161829567-161829589 CAGGGGGCAAGACCACCAGCAGG - Intronic
1019341712 7:511678-511700 CAGGGCTCAAACCCATCAGGTGG + Intronic
1019702721 7:2481787-2481809 CAGGAGGGAGGCCCACCAAGAGG - Intergenic
1023648136 7:42340699-42340721 CATGAGGTTAGACCATCAGGAGG + Intergenic
1024666186 7:51549672-51549694 TAGGTGGCATGCCCATCAGATGG - Intergenic
1028514349 7:91660048-91660070 AAGGAGGTAAGCTCTTCAGGAGG - Intergenic
1029365159 7:100112006-100112028 GAGGAGGGAAGCCAGTCAGGTGG + Intronic
1031990790 7:128197635-128197657 CAGGAGGCAAACCCACCATCAGG - Intergenic
1035477535 7:159153769-159153791 CAGGAGGCAAGGCTTTCACGAGG + Intergenic
1038177933 8:25198153-25198175 CAGGTAACAAACCCATCAGGAGG - Intronic
1040110981 8:43567122-43567144 GAGGAGGCCAGGCCTTCAGGGGG - Intergenic
1040111464 8:43568794-43568816 CAGGAGGCCCGGCCTTCAGGGGG - Intergenic
1040532338 8:48276071-48276093 CAGCAGGCAAGGCCCTCAAGGGG - Intergenic
1041401669 8:57451676-57451698 CAGGAAGCAAGAACATGAGGAGG + Intergenic
1044863336 8:96545082-96545104 CAGGAGGAAAGCTAGTCAGGTGG - Intronic
1045513657 8:102836989-102837011 CAGGAGGCACTCTCATGAGGCGG - Intronic
1047684912 8:127295174-127295196 GTGGAGGGGAGCCCATCAGGAGG + Intergenic
1049549939 8:143252563-143252585 GAGGCGGCAGGACCATCAGGAGG - Intronic
1049600806 8:143506739-143506761 CAGCTGGCGAGCCCACCAGGTGG - Intronic
1049867156 8:144946599-144946621 CAGGACACAAGCCCAACAGCAGG - Intronic
1049867219 8:144946854-144946876 CAGGACACAAGCCCAACAGCAGG - Intronic
1049867305 8:144947199-144947221 CAGGACACAAGCCCAACAGCAGG - Intronic
1049867308 8:144947218-144947240 CAGGACACAAGCCCAACAGCAGG - Intronic
1051386066 9:16510268-16510290 CAGGATGCAGGCCTAGCAGGAGG - Intronic
1051699809 9:19809820-19809842 CAAGAGGAAAGACCAGCAGGTGG - Intergenic
1053508772 9:38669246-38669268 CAGAGGCCAAGGCCATCAGGAGG + Intergenic
1061832912 9:133307093-133307115 CAGGAGGCAAGCCAGACGGGAGG - Intergenic
1062281725 9:135754885-135754907 CAGCAGGCAGGCCCCCCAGGAGG - Intronic
1185720203 X:2375202-2375224 CAGAAAGCAACCACATCAGGTGG + Intronic
1188135045 X:26484406-26484428 CAGCAGGCAAGCGCATCTGCAGG - Intergenic
1190202354 X:48373551-48373573 CAGGAGGCAAGTAGATCATGAGG - Intergenic
1190208184 X:48421864-48421886 CAGGAGGCAAGTAGATCATGAGG + Intergenic
1190755089 X:53394681-53394703 GAGGAGGTCAGCCCATCTGGGGG - Intronic
1191648234 X:63507047-63507069 CAGAAGGCAAGGCCATTGGGTGG + Intergenic
1196026611 X:111047813-111047835 CAGGAGAAAAGTCCTTCAGGCGG - Intronic
1196519774 X:116660338-116660360 CAAGAGACAAGACCATCAAGAGG + Intergenic
1198031915 X:132761413-132761435 CAGGAGCCCACCCCAGCAGGGGG + Intronic
1198483044 X:137058418-137058440 CAATATGCAGGCCCATCAGGTGG - Intergenic
1199713510 X:150489459-150489481 TAGGAGGCAAGACCTTGAGGAGG - Intronic
1200158736 X:153993239-153993261 TAGGATGCAACCCCAACAGGTGG + Intergenic
1200857101 Y:7950690-7950712 CAGGAGTCCTGCCCACCAGGAGG - Intergenic