ID: 1091784876

View in Genome Browser
Species Human (GRCh38)
Location 12:3237293-3237315
Sequence CATCAGGAGGCAAGCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784876_1091784880 0 Left 1091784876 12:3237293-3237315 CCTGATGGGCTTGCCTCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1091784880 12:3237316-3237338 ACTTACGATCAAAGACAGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 63
1091784876_1091784879 -4 Left 1091784876 12:3237293-3237315 CCTGATGGGCTTGCCTCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784876 Original CRISPR CATCAGGAGGCAAGCCCATC AGG (reversed) Intronic
900651737 1:3733160-3733182 CCTCAGGAGGCAGGACCTTCGGG + Exonic
900811758 1:4807834-4807856 CATCAGGAGCCTAATCCATCAGG + Intergenic
902702729 1:18183711-18183733 CATCTGGAGCCAAGCCCAGCTGG - Intronic
904297938 1:29534423-29534445 AGTCAGGAGGCATTCCCATCTGG - Intergenic
905580471 1:39080462-39080484 CACCAGGAGACACGCCCATATGG + Intergenic
907629127 1:56062332-56062354 CATCAGGTGGCAGGGCCATGGGG - Intergenic
909756723 1:79235464-79235486 CTACAGGAGGCAAGCACAACAGG - Intergenic
914877078 1:151520196-151520218 CAGCAGGAGGCAGCCCCACCAGG + Exonic
915007165 1:152649130-152649152 CATCAGGAAACCAGCTCATCAGG - Intergenic
915627286 1:157122734-157122756 AATCAGAAAGCAAGCCCAGCAGG - Exonic
919565965 1:199188728-199188750 CATGAGGAGGCAAACACATGAGG - Intergenic
920938198 1:210455769-210455791 AATCAGGAGGGAACCCAATCAGG - Intronic
921294813 1:213691790-213691812 CATCAGGAAGTAAGCTAATCAGG + Intergenic
922117269 1:222626273-222626295 CATCAGGAGTGAAGCCAAACAGG - Intronic
922406163 1:225315886-225315908 CATCAGGAGGCATGCAGATCAGG + Intronic
1062865233 10:846846-846868 CAGCAGGAGGCAAGCGCATGAGG + Intronic
1064271593 10:13870792-13870814 GAACGGGAGGCAAGCCCATGTGG + Intronic
1069775897 10:70926955-70926977 CAGCAGGAGGCGAGGCCAGCTGG - Intergenic
1073618766 10:105025277-105025299 CATCTGGAGGCAAGATCAGCTGG + Intronic
1075723634 10:124600857-124600879 CATTAGGAGCCAAGGCCATGAGG + Intronic
1075983847 10:126766504-126766526 CATCAGGAGGCATGGGCATCAGG + Intergenic
1076553590 10:131305201-131305223 CATGAGGAGGCTAGCCCTTTGGG + Intronic
1077045040 11:540961-540983 CATCAGCAGGCAAGACCAGCAGG - Intronic
1079940716 11:26677124-26677146 GACCAGGAGGCAAGAACATCTGG + Intronic
1082802158 11:57423092-57423114 GATCAGGAGGCCTGCACATCAGG + Intronic
1083354563 11:62056534-62056556 TATCAGGAGGCAGGGCCATTGGG + Intergenic
1084632916 11:70367256-70367278 CAGCAGGTGGCAGTCCCATCTGG - Intronic
1085190230 11:74614288-74614310 AATCTGGAGGCAAGGCCATCAGG + Intronic
1087027525 11:93664711-93664733 CATCAGAATGTAAGCTCATCAGG - Intronic
1087425583 11:97981769-97981791 CATAAGCAGGCATGACCATCCGG - Intergenic
1087643889 11:100785295-100785317 AATCAGGAGGCCGGGCCATCTGG + Intronic
1089882392 11:121787270-121787292 CATCAGGAGGCAAGGGGATAAGG + Intergenic
1091784876 12:3237293-3237315 CATCAGGAGGCAAGCCCATCAGG - Intronic
1091885785 12:4016041-4016063 CAACAGAAGGCATGCCCATATGG - Intergenic
1101558815 12:105836169-105836191 CAACAGCAGACAAGCCCATGGGG - Intergenic
1102966300 12:117130352-117130374 AATCAGCAGGCAAACCCTTCTGG - Intergenic
1103420033 12:120773303-120773325 CAGCAGGTGGGAAGCCCATCGGG + Intronic
1103864938 12:124044204-124044226 CACCAGGAGGCAAGACCTTTTGG - Intronic
1111628016 13:90813879-90813901 CATCAGGAGGCATGCAGGTCAGG - Intergenic
1114067000 14:19069165-19069187 CAGCAGGAGGCAAAAACATCAGG - Intergenic
1114095266 14:19330863-19330885 CAGCAGGAGGCAAAAACATCAGG + Intergenic
1119208676 14:72813139-72813161 AATTTGGAGCCAAGCCCATCAGG - Intronic
1119605488 14:76012613-76012635 CATCAGGCGGCAGCCCCAGCAGG + Intronic
1121916932 14:97844139-97844161 CATCTGGAGGAAAGCCTTTCAGG - Intergenic
1122266694 14:100549988-100550010 CACCAGGCAGCAAGCCCAGCAGG - Intronic
1124129711 15:26972653-26972675 CATCAGGAGGCAATGCCAGGAGG + Intronic
1128091028 15:64919024-64919046 CTACAGCAGGCAAGCCCAGCAGG - Intronic
1129931843 15:79417773-79417795 CATCAAGAGGCCTGACCATCAGG + Intronic
1132543161 16:520904-520926 CATGAGGAGCCAAGACCAGCAGG + Exonic
1134661731 16:15989363-15989385 CAGCAGGAGGCAAGCACGGCTGG - Intronic
1136274360 16:29169759-29169781 CATCTGGAGTCAGCCCCATCTGG - Intergenic
1138477430 16:57280085-57280107 CATCAGGGGCCAAGGCCATCAGG - Intronic
1139469840 16:67172231-67172253 CATTAGGAGGCAAAGACATCAGG - Intronic
1139959772 16:70710835-70710857 GACCAGGAGGACAGCCCATCTGG - Intronic
1142078643 16:88135405-88135427 CATCTGGAGTCAGCCCCATCTGG - Intergenic
1149419678 17:56497273-56497295 CAGCAGTAGGCAGGCCCATGAGG - Intronic
1154433000 18:14322786-14322808 CAACAGCAGCCCAGCCCATCAGG + Intergenic
1156983398 18:43320815-43320837 CATCAGGAGGGAGGGACATCAGG - Intergenic
1162524292 19:11198181-11198203 CATCAGGAAGGAGGCCCTTCGGG + Intergenic
1163239147 19:16048688-16048710 CACATGGAGACAAGCCCATCAGG + Intergenic
1166565858 19:43765167-43765189 CCTCTGGAGGCCAGCCCACCTGG - Intergenic
1166770603 19:45279813-45279835 CTCCAGGAGGCAAGCAGATCTGG + Intronic
1168018886 19:53594695-53594717 CAGGAGGTGGCAAGCCCCTCTGG + Intergenic
1168723573 19:58568943-58568965 CAGCAGGATGCAAGCCCAGGAGG + Intronic
924967686 2:92970-92992 CATCAGGAGGCAAGGGGGTCAGG - Intergenic
925362298 2:3288077-3288099 CATCAGGATGCCACCCCGTCAGG - Intronic
927140219 2:20125111-20125133 CAGCAGGAGTCAAGCCCAGGCGG - Intergenic
928710296 2:33997522-33997544 CAACAGCAGGCCAGCCCATGAGG - Intergenic
929861760 2:45684279-45684301 CACCAGGAGCCAAGACCTTCTGG - Intronic
931212032 2:60206790-60206812 CATCAGGAGGCATGGGGATCAGG + Intergenic
933723816 2:85414824-85414846 CACCAGGAGGCCAGGCCTTCTGG + Intronic
938484394 2:131689257-131689279 CAGCAGGAGGCAAAAACATCAGG - Intergenic
947098213 2:226591135-226591157 CATCAGGAGAAAAGACCCTCTGG + Intergenic
948944605 2:241213145-241213167 CATGAGGAGGCCAGCCCCTGCGG - Intronic
948944615 2:241213178-241213200 CATGAGGAGGCCAGCCCCTGCGG - Intronic
948944625 2:241213210-241213232 CATGAGGAGGCCAGCCCCTGCGG - Intronic
1168846329 20:947088-947110 CACTAAGAGCCAAGCCCATCTGG - Intergenic
1170304654 20:14924934-14924956 CCTAAGGAGGCAAGGCAATCGGG - Intronic
1174950225 20:55034485-55034507 CACAAGGAAGCAAGCCCAACTGG - Intergenic
1175563717 20:59955194-59955216 CATCATGAGGCATCCCCACCCGG - Intergenic
1180485477 22:15791749-15791771 CAGCAGGAGGCAAAAACATCAGG - Intergenic
1182932650 22:34189837-34189859 CATCTGCAGGCAATACCATCTGG + Intergenic
1183175896 22:36224584-36224606 CAGCCTGAGGCAAGCCCATGGGG + Intergenic
1183541380 22:38431189-38431211 TGTCAGGAGGCAATCCCACCGGG - Intronic
1184925959 22:47637550-47637572 CATCAGCAGGCTTGGCCATCAGG - Intergenic
949496363 3:4635793-4635815 CAACAGGAGGCAAGGCAATAAGG - Intronic
950993325 3:17465243-17465265 CTTCAAGAAGCATGCCCATCAGG + Intronic
961682429 3:128608158-128608180 CATCAGGCGCCAAGCCCCGCTGG + Intergenic
963279541 3:143369106-143369128 AAGCATGAGCCAAGCCCATCTGG - Intronic
965695964 3:171408524-171408546 CATCAGAAAGCAGGCCGATCTGG + Intronic
965781864 3:172294618-172294640 TATCAGGAAGGAAGCCCATGCGG + Intronic
970320635 4:14872241-14872263 CACCAGGAGTCAAGCCTACCTGG + Intergenic
971409188 4:26352402-26352424 TATCAGGAGGGAAGCCCTTTGGG - Intronic
971486658 4:27167752-27167774 CCTCAGCAGGCAAGGCCAGCAGG - Intergenic
975382322 4:73715838-73715860 CATCAGAAGGCATTCCCTTCAGG - Intergenic
975827983 4:78339610-78339632 CACCAGGAGACAGGCCCAGCAGG + Intronic
976478621 4:85513153-85513175 CATCAGGAGGCAACTCCATAGGG + Intronic
982314330 4:154016266-154016288 CACCAGGAGACAAGCCCAAGAGG - Intergenic
982366307 4:154583200-154583222 AATCAGAAGGCAAGACCACCAGG + Exonic
988692075 5:33582351-33582373 CATCAGGTGGCCAGCCCCACAGG + Intronic
996525311 5:124473114-124473136 CACCAGGAGGCAAGCCCAGTGGG + Intergenic
997822932 5:137082319-137082341 AACCAGGAGGCCAGCCCATGGGG + Intronic
997880288 5:137583135-137583157 CATAAGCAGGGAAGGCCATCAGG + Intronic
998717781 5:144905783-144905805 CATCAGGAGGCACGGGGATCAGG - Intergenic
1002170580 5:177372017-177372039 AATCAGCAGCCCAGCCCATCGGG + Exonic
1005750436 6:28876905-28876927 CATAAGGAAGCCAACCCATCTGG + Intergenic
1007289629 6:40775628-40775650 CTTCAGGAGGAAAGCCAGTCGGG + Intergenic
1008473868 6:51915202-51915224 CATCAGGTGACAAAGCCATCTGG - Intronic
1013672687 6:112422058-112422080 CGTCAGGAGGCAAGGAGATCAGG - Intergenic
1015423292 6:133036112-133036134 CCTCAGTAGGAAAGCCAATCAGG - Intergenic
1018440366 6:163806916-163806938 CATCTGGAGGCCAGGCCAGCAGG + Intergenic
1024055922 7:45659829-45659851 CATCAGGAACCATGCCCAGCAGG - Intronic
1029947242 7:104545566-104545588 CACCTGGAGGAAAGCCCATAGGG - Intronic
1047457403 8:125028528-125028550 CATCAGGAGTGAAGCCCAATAGG - Intronic
1048303148 8:133265996-133266018 GAGCAGGAGGCAAGGCCATCAGG + Intronic
1049386463 8:142345321-142345343 CACCAGGAGGGAAGCCCACCAGG + Intronic
1050225141 9:3445481-3445503 GATCTGAAGTCAAGCCCATCTGG + Intronic
1055877035 9:80955510-80955532 CATCAGCAGGGAAGACCATGAGG - Intergenic
1060521200 9:124295052-124295074 CATCAGGAGGCCAGCTGATTGGG - Intronic
1060977648 9:127774369-127774391 CATCAGTAGGCAGTCCCATTTGG - Exonic
1189876764 X:45444296-45444318 CATCAGGAAGCCTGCCCATGAGG - Intergenic
1191682048 X:63850950-63850972 CAGCAGAAGGCCAGCCCAACAGG - Intergenic
1194567704 X:95513439-95513461 CATCATGAGGGAAGCACATAAGG - Intergenic
1198081555 X:133244981-133245003 TATCACGAGGTAGGCCCATCTGG - Intergenic
1198130142 X:133685963-133685985 CATCTGGAGCTAGGCCCATCTGG + Intronic
1199713511 X:150489462-150489484 CATTAGGAGGCAAGACCTTGAGG - Intronic