ID: 1091784879

View in Genome Browser
Species Human (GRCh38)
Location 12:3237312-3237334
Sequence GATGACTTACGATCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091784869_1091784879 26 Left 1091784869 12:3237263-3237285 CCCATCACACAGATATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1091784876_1091784879 -4 Left 1091784876 12:3237293-3237315 CCTGATGGGCTTGCCTCCTGATG 0: 1
1: 0
2: 0
3: 12
4: 113
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1091784875_1091784879 -1 Left 1091784875 12:3237290-3237312 CCTCCTGATGGGCTTGCCTCCTG 0: 1
1: 0
2: 0
3: 14
4: 206
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1091784874_1091784879 9 Left 1091784874 12:3237280-3237302 CCTGGGCTTGCCTCCTGATGGGC 0: 1
1: 0
2: 4
3: 22
4: 250
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56
1091784871_1091784879 25 Left 1091784871 12:3237264-3237286 CCATCACACAGATATTCCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091784879 Original CRISPR GATGACTTACGATCAAAGAC AGG Intronic
902136999 1:14316066-14316088 GATGACTAAAGTTTAAAGACTGG - Intergenic
903898122 1:26621886-26621908 GATGACTTACGTTAGAAGAAGGG + Intergenic
919216660 1:194565226-194565248 AATGACTTACGATCAGAAAAAGG + Intergenic
921738679 1:218658152-218658174 GATGATCAACGATCAAAGAGAGG - Intergenic
1078160469 11:8835738-8835760 GACAACTTAAGATCAAAGAATGG + Intronic
1089237243 11:117040693-117040715 GAAGACTTACCATGGAAGACTGG + Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092030472 12:5279341-5279363 GATGGCTCATGATGAAAGACTGG - Intergenic
1097515470 12:60599341-60599363 CATGACAGACGATCACAGACTGG - Intergenic
1107646142 13:42496119-42496141 GATGACTTTTGAGCAAAGACTGG - Intergenic
1107931437 13:45310963-45310985 GAACACTTACAATAAAAGACAGG - Intergenic
1109517883 13:63468015-63468037 GATGTCTTACGTTCATAGATTGG + Intergenic
1116736176 14:48694963-48694985 GGTGACTTAACAGCAAAGACCGG - Intergenic
1120737394 14:88068265-88068287 GTTTACTTACCATAAAAGACTGG + Intergenic
1122661044 14:103295113-103295135 GATGAGTTATAATCAAAGATTGG - Intergenic
1123027092 14:105430750-105430772 GATGACTCACGAGCTAAGAATGG + Intronic
1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG + Intergenic
1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG + Intergenic
1162633383 19:11946206-11946228 GCTCATTTACGATCTAAGACTGG - Intronic
930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG + Intergenic
931783265 2:65598412-65598434 GATGACTTACGAGAACAGAGTGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
947174685 2:227352985-227353007 GAAGCCTTACAAACAAAGACAGG - Intronic
1170213445 20:13868247-13868269 GATTGCTTACCCTCAAAGACTGG - Intronic
1177568349 21:22853159-22853181 GCTGACATTTGATCAAAGACTGG + Intergenic
1180005948 21:45020611-45020633 GATGACTTACACTCAAATCCTGG + Intergenic
1182779647 22:32857665-32857687 GATGAATAACTTTCAAAGACGGG - Intronic
1185191532 22:49439732-49439754 ATTGACTTATGATCAAAGAGTGG + Intronic
957257344 3:77855539-77855561 GTTGACTAACAATCAATGACTGG + Intergenic
965371747 3:167871264-167871286 GATGACCTACTATCAAATAAGGG + Intergenic
967351748 3:188521341-188521363 GATGTCTTACAAGCACAGACTGG + Intronic
969937441 4:10696255-10696277 GATGACCTAGGACCAAAGAACGG - Intergenic
971268734 4:25117460-25117482 CATGACTTTGGCTCAAAGACAGG + Intergenic
977183004 4:93900891-93900913 CATGACTTATGAGCAAAAACTGG - Intergenic
977992552 4:103461916-103461938 GATGACTTGCCATCAAAGAAAGG + Intergenic
979509582 4:121537072-121537094 AATTACTTAAGATAAAAGACGGG + Intergenic
981763769 4:148223505-148223527 GCTGACTTAAGAGCAAAGTCAGG + Intronic
985298972 4:188467141-188467163 GATAGCTTGTGATCAAAGACTGG + Intergenic
987866042 5:23540560-23540582 GATGACTTTGGAACACAGACAGG - Intergenic
990007077 5:50956050-50956072 TATGACATGCCATCAAAGACTGG + Intergenic
995231739 5:109772463-109772485 GATGAATTGAGATCAAACACAGG + Intronic
996584320 5:125067766-125067788 GAGGTATTATGATCAAAGACTGG + Intergenic
997813033 5:136990597-136990619 CATGACATTCGATCAAAGAAGGG - Intronic
1008001580 6:46365739-46365761 GATGATTTACAATAAAAGAGGGG - Intronic
1009478891 6:64130660-64130682 GATGCCTTCCGAACAAAGAGGGG + Intronic
1009486248 6:64225835-64225857 GATTACCTATTATCAAAGACAGG - Intronic
1024436194 7:49357755-49357777 GCTAACTTAGGACCAAAGACAGG + Intergenic
1031655795 7:124353270-124353292 TAAGACTTAAGATAAAAGACTGG + Intergenic
1032170927 7:129583929-129583951 GATGAGTGTGGATCAAAGACTGG + Intergenic
1037461381 8:19113543-19113565 AATGGCTTACTATAAAAGACAGG - Intergenic
1038461892 8:27724095-27724117 GATGACTTGCCATCAATCACAGG + Intergenic
1046228923 8:111327194-111327216 CATGACTAACTAGCAAAGACAGG - Intergenic
1052401669 9:28008077-28008099 GATGACAAACGATGTAAGACGGG - Intronic
1052733269 9:32314467-32314489 AATGACTTATGTTCAAAGGCAGG + Intergenic
1190567732 X:51747876-51747898 GATGATTTCCCATCAAAAACTGG + Intergenic
1194154355 X:90368531-90368553 GCTGACTTAGTCTCAAAGACTGG - Intergenic
1196668903 X:118345677-118345699 GATGTCTTACTATCCAAGCCCGG - Intergenic
1200296931 X:154929358-154929380 GATGACTGGTGATCAAAGAGAGG - Exonic
1200500712 Y:3945428-3945450 GCTGACTTAGTCTCAAAGACTGG - Intergenic