ID: 1091785157

View in Genome Browser
Species Human (GRCh38)
Location 12:3238937-3238959
Sequence CATGCAGGCCCTCCCAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091785149_1091785157 23 Left 1091785149 12:3238891-3238913 CCCAAGCTGTTTCCTTGCTTCAT 0: 1
1: 0
2: 2
3: 30
4: 253
Right 1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG 0: 1
1: 0
2: 3
3: 20
4: 149
1091785152_1091785157 11 Left 1091785152 12:3238903-3238925 CCTTGCTTCATGTTCTCTCTGGT 0: 1
1: 0
2: 2
3: 38
4: 318
Right 1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG 0: 1
1: 0
2: 3
3: 20
4: 149
1091785150_1091785157 22 Left 1091785150 12:3238892-3238914 CCAAGCTGTTTCCTTGCTTCATG 0: 1
1: 0
2: 1
3: 23
4: 252
Right 1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG 0: 1
1: 0
2: 3
3: 20
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091785157 Original CRISPR CATGCAGGCCCTCCCAAAGG AGG Intronic
900579490 1:3401948-3401970 CATGCAGGCCCACACAAACATGG + Intronic
900682686 1:3925467-3925489 CAGGCACTCCCTCCCAAAGCAGG - Intergenic
902723195 1:18318014-18318036 CATGCAGGCCCTAGCAGTGGGGG + Intronic
913317273 1:117563818-117563840 CAGGCAAGCCCTCCCTCAGGAGG + Intergenic
915625094 1:157109560-157109582 CAGGAAGGCCCTGCCAAAGAGGG + Intergenic
915635948 1:157186628-157186650 CAGGGAGGGCCTCCCAGAGGAGG - Intergenic
915648127 1:157288430-157288452 CAGGGAGGACCTCCCAGAGGAGG + Intergenic
920516255 1:206586481-206586503 CATGCAGACCCTCAGAAAGCAGG - Intronic
921524827 1:216203904-216203926 CATTCATGCCATCCCAAATGAGG + Intronic
923128859 1:231057407-231057429 CATGGAGGCCCTGCAAAAGTGGG - Intergenic
1063444536 10:6102266-6102288 GATGCAGCCCTTCCCACAGGTGG - Intronic
1065265510 10:23971152-23971174 CACGCGGCCCCTCCCAAGGGCGG - Intronic
1068520273 10:58069892-58069914 TATCCAGGCCATCCCAAAAGTGG - Intergenic
1070606055 10:77899199-77899221 CATCCAGGCCCTCCCAGACTGGG + Intronic
1070774182 10:79100239-79100261 CAAGGAGGGCCTCCCAGAGGAGG + Intronic
1072412778 10:95219139-95219161 CATGCAGGGCACCCCAAAGAGGG - Intronic
1073454057 10:103626068-103626090 CATGCGGGCCCTTCCCAATGGGG + Intronic
1074110167 10:110417341-110417363 CATTCAGGTCCTCCCTTAGGGGG - Intergenic
1075078061 10:119364421-119364443 GATTCAGTTCCTCCCAAAGGTGG - Intronic
1075698311 10:124451518-124451540 CTTGCTGCCCCTCCCAGAGGTGG + Intergenic
1077724605 11:4661556-4661578 CATGCTGGCGCTCCCCAAAGCGG - Intergenic
1078655613 11:13236088-13236110 GATACAGACACTCCCAAAGGTGG - Intergenic
1080029804 11:27648503-27648525 CATGGAGGCCTTTCCAAAAGTGG - Intergenic
1080691079 11:34558589-34558611 CATCCAGGCCTTGGCAAAGGTGG - Intergenic
1083713374 11:64562114-64562136 GATGCCGGCCATCCCAAAAGCGG - Exonic
1084495341 11:69500197-69500219 CATGCAGGCTCTCACACAGCAGG + Intergenic
1084864093 11:72041642-72041664 CATGCAGGCCCTCTGATCGGGGG + Intronic
1084947136 11:72644149-72644171 CAGGGAAGCCCTCCCAGAGGAGG - Intronic
1089248404 11:117138833-117138855 GATGGAGGCCAACCCAAAGGGGG - Intergenic
1090650395 11:128801147-128801169 CATGGAGGCCCTCTCGAATGTGG - Intronic
1091785157 12:3238937-3238959 CATGCAGGCCCTCCCAAAGGAGG + Intronic
1096515302 12:52152299-52152321 CAGGCGGGGCGTCCCAAAGGCGG + Intergenic
1099919806 12:88943460-88943482 CATGAAGGCTCTCCCGAAGAGGG - Intergenic
1101948436 12:109155716-109155738 CTTGCAGGCCATCCCAAAACAGG - Intronic
1102861301 12:116338716-116338738 CAGGCAGGGCCTCCCACAGATGG - Intergenic
1103171327 12:118822659-118822681 CATGGAGTCATTCCCAAAGGGGG - Intergenic
1103840437 12:123859279-123859301 CAGCCAGGCCCTCCCTACGGAGG - Intronic
1103932312 12:124457308-124457330 CCTGCAGGCCCTCCCCACGCTGG + Intronic
1104955741 12:132465069-132465091 CCTGCAGGTGCTCCCAGAGGCGG + Intergenic
1107763525 13:43708255-43708277 CATGCAGCCCCTCCCAAGTGCGG + Intronic
1110471267 13:75862700-75862722 CATTCAGTCTTTCCCAAAGGGGG + Intergenic
1111476865 13:88761216-88761238 CATGCAGCCCCTCCCAACAGCGG - Intergenic
1115239379 14:31239848-31239870 CATGCGGCCCCTCCCAAGTGCGG - Intergenic
1117971687 14:61257294-61257316 CACGCAGGCCCAGCCAGAGGCGG + Intronic
1121405330 14:93716167-93716189 CAAGCAGGCCCTCACAGAGCTGG + Intergenic
1122785756 14:104162659-104162681 CCTGCAGCCCCTCCCAAGGCTGG - Intronic
1128311351 15:66633325-66633347 CATGCAGGGGCTCCCGAAGGGGG - Intronic
1129686594 15:77689526-77689548 CATCCAGGCCCTCCCATGGGTGG + Intronic
1130011780 15:80157942-80157964 CATACAGGGCCACCTAAAGGGGG + Intronic
1131676580 15:94676192-94676214 CATGGAGGCCATCTCAAAAGAGG + Intergenic
1131953257 15:97704512-97704534 CATGCTGCCACTCCCGAAGGTGG - Intergenic
1132513218 16:354008-354030 CCATCAGGCCCTCCCCAAGGAGG + Intergenic
1132812445 16:1807821-1807843 CATGCATGCCCTCCCCCCGGAGG - Exonic
1134332485 16:13263791-13263813 CATTCAGCTTCTCCCAAAGGTGG - Intergenic
1136225447 16:28857327-28857349 CATGCATGGCTTCCCAGAGGAGG + Intronic
1138208980 16:55147091-55147113 CAGGCAGGCCCTCCCCAGAGGGG - Intergenic
1141464568 16:84197260-84197282 AACACAGGGCCTCCCAAAGGAGG - Intergenic
1143919456 17:10319227-10319249 CACCCAGCCCCTCTCAAAGGGGG - Intronic
1144308453 17:13990746-13990768 GGTACAGGCTCTCCCAAAGGAGG - Intergenic
1145397695 17:22508038-22508060 CCTGGAGGCCCTCCACAAGGTGG - Intergenic
1152093230 17:78258278-78258300 CATGCAGGACACACCAAAGGAGG - Intergenic
1156451614 18:37269607-37269629 CAGGCAGGTCCCTCCAAAGGAGG + Intronic
1158591165 18:58780184-58780206 CAAGCACGCCCTCACAATGGCGG + Intergenic
1159990433 18:74900325-74900347 CATGCAGTACCCCCAAAAGGTGG - Intronic
1160756151 19:758038-758060 CGTGCAGGCCCTCCCGCCGGTGG - Exonic
1164118681 19:22246110-22246132 CATCCTGGCCCTGCCAAAAGTGG - Intergenic
1164148311 19:22526798-22526820 CAAGCAGGCCGTCCCAAATCTGG + Intronic
1165023953 19:32945831-32945853 CATGCAGTACCTCCCCATGGTGG + Intronic
1166376164 19:42328334-42328356 CATGCAGGGCCTCCCTTGGGAGG + Intronic
926891486 2:17643034-17643056 CATGTAGGCTCTCCAGAAGGAGG - Intronic
927900813 2:26817046-26817068 CCTGCAGCCCCTCCCATGGGAGG + Intergenic
929646444 2:43633285-43633307 CATCCTGGCCCTCCCAGTGGGGG - Intergenic
930732870 2:54744969-54744991 CATGCAGGCCTTCCCAGTGAGGG + Intronic
932396921 2:71454786-71454808 TATGAAGGCCCTCCTATAGGAGG - Intronic
933269726 2:80220591-80220613 CATGAAGGCCATCCCAAAGAAGG - Intronic
933662591 2:84939798-84939820 CCTGCAGGCCATCACAAAGGCGG - Intergenic
944127824 2:196314207-196314229 CAAAGAGGCCCTCCCCAAGGAGG - Intronic
944383314 2:199136925-199136947 GATGCAGGCTCTGCCTAAGGAGG - Intergenic
944468247 2:200025307-200025329 CATGTAATCCCTTCCAAAGGTGG + Intergenic
946334613 2:219028714-219028736 AATTCAGGCCCTCCCAAGGGAGG + Intronic
948267191 2:236643556-236643578 CATGGAGTCCCTCCCAACTGAGG - Intergenic
948348342 2:237318054-237318076 CCTTCAGGTCTTCCCAAAGGTGG + Intergenic
948723507 2:239918291-239918313 CAGGGAGGCCCTCACCAAGGAGG + Intronic
948927064 2:241105940-241105962 CAAGCAGGCCCTGCCAGGGGTGG - Intergenic
1170551451 20:17480867-17480889 CGTGCAGGGCGGCCCAAAGGTGG - Intronic
1171490125 20:25510883-25510905 CATGCAGGGCAGCCCCAAGGTGG - Intronic
1172768371 20:37363073-37363095 CATGGTGGCCTTCCCAGAGGAGG - Intronic
1172797823 20:37554915-37554937 CATGCGGCCCGTCCCAAATGCGG + Intergenic
1175149893 20:56925396-56925418 CATGCAGGCCCGCCTGAATGGGG + Intergenic
1176039647 20:63058647-63058669 CATGCAGGCACTCACAGAGCTGG - Intergenic
1178294899 21:31401514-31401536 CAGGCAGGCTCTCCAAAAGGTGG - Intronic
1179667592 21:42923270-42923292 CCTGCAGGGCCTCCCGATGGCGG + Intergenic
1181402286 22:22657496-22657518 CATGCAGTCACACACAAAGGAGG + Intergenic
1181953971 22:26574889-26574911 CATGCAGCCCCTCCAAGAGTGGG - Intronic
1182318938 22:29465943-29465965 CAGGGAGAGCCTCCCAAAGGAGG - Intergenic
1183244435 22:36683001-36683023 CATGCCTGCCATCCCAAAGGGGG + Intronic
1184391275 22:44204930-44204952 CCTGCCGGCCCTCCCACAGTAGG - Intronic
1184507730 22:44914282-44914304 CATGCAGACCCTCCCCATGGTGG - Intronic
951384575 3:22027899-22027921 TATGCAGGCACTACCAAAAGTGG + Intronic
951858216 3:27221870-27221892 CAGCCAAGCCCTCCCTAAGGAGG - Intronic
953694634 3:45147610-45147632 GATACAGGCCCTCCCAGAGGTGG - Intergenic
953703661 3:45215367-45215389 CATGCCGGCCCTCCCTAATGAGG - Intergenic
953925616 3:46980950-46980972 CACGCTGGCCCTCCATAAGGAGG + Intronic
954763241 3:52892490-52892512 CATGCTGGCACTCCAGAAGGAGG + Intronic
955866438 3:63389388-63389410 CAGGCAGGCTCTCCCAACGATGG + Intronic
960039292 3:113133309-113133331 CAAGCAGGCACTCCCAACTGGGG - Intergenic
967020373 3:185517291-185517313 CCTGCAGGCCCTCACCATGGGGG - Intronic
968549182 4:1213684-1213706 CAGGCAGGGCCCCCCACAGGGGG - Intronic
968731560 4:2271581-2271603 CCTGCAGCCCCTCCCCCAGGAGG + Intronic
968908215 4:3464085-3464107 CATGCTGACCCTCCCCAAGCTGG - Intronic
969111281 4:4845964-4845986 CATTCAGGGCCTCCCAATGAGGG - Intergenic
972830852 4:42812030-42812052 CAGGGAAGCCCACCCAAAGGAGG - Intergenic
979065239 4:116123135-116123157 CATACAGCCCCTCCCAAGTGCGG - Intergenic
983312359 4:166080998-166081020 CATGCAGGGCCTGCCTAAGGTGG - Intronic
986070148 5:4274814-4274836 GCTGCAAGCCCTCCCAAAGGTGG - Intergenic
988562182 5:32291214-32291236 CATGCAGGCACCACCAAAAGTGG + Intronic
989505013 5:42217184-42217206 CATGCTCCCCCTCCCAAAAGGGG - Intergenic
990887164 5:60607704-60607726 CAGGAAGGCCCTCTCTAAGGAGG + Intronic
993173420 5:84451439-84451461 CATGCTGCCCCTCCCCAAGCTGG + Intergenic
993240375 5:85376253-85376275 CATGTAGGCACTCTCAAAGATGG + Intergenic
996769967 5:127075399-127075421 CAGCCAGGCACTCCCAAAGAGGG - Intergenic
997008359 5:129847577-129847599 AAAGCAGGCCTGCCCAAAGGAGG - Intergenic
998944676 5:147325603-147325625 CAAGCAGGCCCTTCCAAAGAAGG - Intronic
999405089 5:151299930-151299952 CATGAAGGCCAAACCAAAGGTGG - Intronic
1000296150 5:159915496-159915518 CAGGGACGCACTCCCAAAGGTGG - Intergenic
1001314433 5:170632443-170632465 TCTGCAGCCCCTGCCAAAGGAGG - Intronic
1001743815 5:174074643-174074665 ACTGCAGGCTCTTCCAAAGGTGG + Intronic
1002043365 5:176529629-176529651 CATGCAGGCCCTCCTGAACCTGG - Exonic
1006368643 6:33631113-33631135 GATGCAGGCCAGCCCCAAGGAGG - Intronic
1007095822 6:39212419-39212441 GAGGCAGGCTCTGCCAAAGGAGG - Intronic
1007294792 6:40813781-40813803 CATGCAGCCCCCTCCACAGGTGG + Intergenic
1008040819 6:46796380-46796402 CAGGCAGGGCCTCCCACAGGAGG - Intronic
1008644806 6:53503136-53503158 CCTTCATGACCTCCCAAAGGAGG - Intronic
1010099846 6:72091121-72091143 CATGCAGGACTTCCAACAGGAGG - Intronic
1013467638 6:110431137-110431159 TTTGCAGACCCTCCCCAAGGGGG - Intronic
1013759837 6:113505008-113505030 CAGGCAGGCCCTTCAAAAGAGGG - Intergenic
1018595181 6:165471584-165471606 CCTGCAGGCCCTCCCATGGAGGG + Intronic
1019348743 7:543307-543329 CAGGCAGGCCCTGCCATATGGGG - Intergenic
1021698241 7:23293960-23293982 CTTGCAGCCTCTCCCATAGGAGG - Intergenic
1023230712 7:38025208-38025230 CATGTGGGCCCTCCCAGAGCTGG + Intronic
1024218417 7:47267335-47267357 CATGCAGAATCTCCCCAAGGAGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1025144595 7:56492928-56492950 CATGGAGGCCCTCCCCAAGGGGG - Intergenic
1025260194 7:57413400-57413422 CATGGAGACCCTTCCCAAGGGGG - Intergenic
1026118780 7:67518616-67518638 CATCCAGGCCCTCCCTGAGTTGG + Intergenic
1026913596 7:74106870-74106892 CAGGCGGGCCCTCCCAAAGCAGG + Intronic
1027270582 7:76516435-76516457 CATGCAGGCCCTGCCAGCGGAGG + Intronic
1029600836 7:101562638-101562660 CATCCAGGCTCTCCCATAGCGGG - Intergenic
1035652372 8:1277754-1277776 CAAGCCGGCCCTGCCAAGGGTGG - Intergenic
1035824605 8:2631207-2631229 CATGCTCCCCCTCCCATAGGGGG - Intergenic
1036711066 8:11078853-11078875 CAAGCAAGGCCTCCCAAGGGGGG + Intronic
1037163070 8:15795819-15795841 CATGCAGTCCCTCCAAAATAAGG - Intergenic
1039850946 8:41364525-41364547 GATGAAGGCCCTCCCTGAGGAGG + Intergenic
1041390002 8:57339514-57339536 CGGGCTGGTCCTCCCAAAGGGGG + Intergenic
1041561700 8:59225973-59225995 CTGGCAGGACCTCCCAAATGGGG + Intergenic
1041991606 8:63999430-63999452 CATGCAGGGCCTACCAAACCTGG + Intergenic
1042063185 8:64843721-64843743 CATGAAGGCCCTCATAGAGGTGG + Intergenic
1044821613 8:96159432-96159454 CATGCAGGCGTTCCCACAGAGGG + Intronic
1047107401 8:121748258-121748280 TGTGCAGGCCATGCCAAAGGAGG + Intergenic
1047994905 8:130325015-130325037 CTTGCAGGCCCTTCCAGAGGTGG + Intronic
1049749153 8:144275352-144275374 CTTCCAGCCCCTCCCAAATGAGG + Intronic
1055697107 9:78897501-78897523 CAAGCAGGCTGTCCCAAAGAGGG + Intergenic
1055787192 9:79883756-79883778 CTTGCAGGACCTCCCAGAGAAGG + Intergenic
1056085671 9:83147508-83147530 CATGCTGCCCCTCCCATAAGGGG - Intergenic
1058947341 9:109870062-109870084 AATTCAGGACCTCCCAAAGCTGG - Intronic
1186448750 X:9654611-9654633 CATGCATGCCCTCGCCGAGGTGG - Intronic
1189377316 X:40475824-40475846 CAGCCAGCCCCTCCCCAAGGCGG - Intergenic
1190641236 X:52483660-52483682 CATGCAGACCCTCCCCAAGGGGG + Intergenic
1190646436 X:52529205-52529227 CATGCAGACCCTCCCCAAGGGGG - Intergenic
1191979013 X:66904957-66904979 CCTGCAGGTCATCCCAAAGGTGG - Intergenic
1192220090 X:69191950-69191972 TATGCAGGCTCTGCCAGAGGAGG - Intergenic
1198221262 X:134604717-134604739 CCTGCAGGCCCCAGCAAAGGGGG - Intronic
1200259835 X:154608226-154608248 CATCCAGGCCGTGCCAAAGCCGG - Intergenic