ID: 1091785971

View in Genome Browser
Species Human (GRCh38)
Location 12:3243660-3243682
Sequence CCCTGGCTTCCTCTTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091785958_1091785971 26 Left 1091785958 12:3243611-3243633 CCGATGAGGTGGAGAAGCAGCCA 0: 1
1: 0
2: 0
3: 39
4: 238
Right 1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 291
1091785965_1091785971 -9 Left 1091785965 12:3243646-3243668 CCTGCTGTCACCCTCCCTGGCTT 0: 1
1: 0
2: 7
3: 45
4: 424
Right 1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 291
1091785963_1091785971 -6 Left 1091785963 12:3243643-3243665 CCTCCTGCTGTCACCCTCCCTGG 0: 1
1: 2
2: 7
3: 52
4: 566
Right 1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 291
1091785962_1091785971 -5 Left 1091785962 12:3243642-3243664 CCCTCCTGCTGTCACCCTCCCTG 0: 1
1: 0
2: 9
3: 79
4: 740
Right 1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 291
1091785961_1091785971 6 Left 1091785961 12:3243631-3243653 CCAGGCATCGGCCCTCCTGCTGT 0: 1
1: 0
2: 1
3: 9
4: 224
Right 1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091785971 Original CRISPR CCCTGGCTTCCTCTTCAGGG AGG Intronic
900946768 1:5835201-5835223 CCCTGGGTTTCTCTTTAGGAAGG - Intergenic
901121625 1:6899052-6899074 CCGTGGATGCTTCTTCAGGGTGG + Intronic
901471705 1:9461131-9461153 CCCTGGTTTCCTCGAGAGGGAGG - Intergenic
903154087 1:21431951-21431973 TCCTGGCTTCCCCTTCCAGGAGG - Intergenic
903238837 1:21968905-21968927 TGCTGGCTTCCTCCTCAGGATGG - Intergenic
903242758 1:21994569-21994591 TGCTGGCTTCCTCCTCAGGATGG - Intronic
903732023 1:25503669-25503691 CCCTGTCCTCCTCTGCACGGAGG + Intergenic
903769546 1:25755133-25755155 CCCTGCCCTACTCGTCAGGGTGG + Intronic
904464616 1:30700419-30700441 TCCTGACTTCCTCTTCAGGTTGG - Intergenic
904577918 1:31517384-31517406 CCCTGGGTGACTCTGCAGGGAGG - Intergenic
905268637 1:36772054-36772076 CAGTGGCTCCATCTTCAGGGAGG + Intergenic
906513131 1:46422973-46422995 CCCTGGCTTCCTGGTCTGGAGGG + Intergenic
907158030 1:52352360-52352382 CTGTGGCTTCCTCTTGAGAGAGG - Exonic
907500274 1:54874668-54874690 GCCTGACTTCCTCTCCAGAGAGG + Intronic
908998787 1:70192796-70192818 CACTGGGGTCCTCTTGAGGGTGG + Intronic
910234862 1:85024920-85024942 CCCTGGCTCCCTCTGCAGTTAGG + Intronic
910759548 1:90720230-90720252 CCCTCGCTGCATATTCAGGGTGG + Intergenic
910884713 1:91952390-91952412 CTCTGGCTTCCTCTGCAGTCTGG + Intronic
912891193 1:113533418-113533440 CCCTGGGGTCTCCTTCAGGGTGG + Intronic
912948601 1:114105310-114105332 CCTTGGCTTATTCTCCAGGGGGG - Intronic
913972016 1:143423152-143423174 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
914066397 1:144248765-144248787 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
914112756 1:144717589-144717611 CCCCAGCTGCCTCTCCAGGGAGG + Intergenic
914251777 1:145927675-145927697 CCGTGGCTTCCTCTTAACCGCGG + Intergenic
914352880 1:146855451-146855473 CCTCGGCTTTCTTTTCAGGGTGG - Intergenic
914952384 1:152127883-152127905 CTCTGGCTTCCTCTCTGGGGTGG + Intergenic
915110856 1:153563993-153564015 CCCTGCCTTCCCATTCAGAGAGG - Intronic
915468511 1:156112436-156112458 GCCTGGCTTCCTTTCCAGGCTGG - Intronic
916070859 1:161168975-161168997 TCTTTGCTTCCTCTGCAGGGCGG + Exonic
917027351 1:170659012-170659034 CCCTGGTTTCCACCTCAGAGAGG + Intergenic
918311848 1:183290754-183290776 CCCTGCCTCCCTCTGCAGTGAGG + Intronic
919409229 1:197223020-197223042 CCTTGTCTTCCTCATAAGGGAGG - Intergenic
920070636 1:203300550-203300572 TCCTTGCTTCCTAATCAGGGTGG - Intergenic
922741594 1:228017146-228017168 CCTTGGCTTCCTGCTCTGGGAGG + Intronic
924095619 1:240547822-240547844 GCCTGACTTCCTCTTCTGGGTGG - Intronic
1063119620 10:3096316-3096338 CCTTGGCATCCTCTTCAGCAGGG + Intronic
1063251781 10:4281990-4282012 CCTGGGCTTCCTCTTAAAGGAGG - Intergenic
1063615280 10:7594887-7594909 CCCTGTTTTCCTCCTCAGTGAGG - Intronic
1063672644 10:8111854-8111876 CACTGACCTCCTCTTCAGGTTGG + Intergenic
1067765490 10:49082855-49082877 CCCTGCCATCTGCTTCAGGGAGG - Intronic
1070173448 10:73950381-73950403 CCCAGCCTTCCTCTTCAGTCTGG - Intergenic
1071215197 10:83393216-83393238 CTTTGTCTTTCTCTTCAGGGTGG + Intergenic
1071345131 10:84685092-84685114 CCTTGCCTTGCTCTGCAGGGTGG + Intergenic
1072493958 10:95936090-95936112 CCCTGGCATACTCTGCTGGGTGG - Intronic
1073075709 10:100824923-100824945 CCCCGGCTTGCTCATGAGGGAGG - Exonic
1073323083 10:102627531-102627553 CCCTGGCTTCCTCTTCAATGAGG - Intronic
1073518623 10:104102786-104102808 CCCTGCCTTGCTCTTCTGGTCGG + Intergenic
1073598754 10:104825549-104825571 CCTTGGCTGCCTTCTCAGGGTGG + Intronic
1074369648 10:112889629-112889651 CCCTGACTTCCTTTTGATGGAGG - Intergenic
1075648198 10:124110140-124110162 CATTGGCTGCATCTTCAGGGTGG - Intergenic
1076798447 10:132809915-132809937 CCATGCATTCCTCTTCCGGGAGG + Intronic
1077307840 11:1875882-1875904 CCCCAGCTGCCTCTCCAGGGAGG + Intronic
1077321843 11:1946372-1946394 CCCTGGTTTCCTCTGCCTGGTGG - Intergenic
1077574662 11:3373260-3373282 CCCAGGATTCCTCTTGAGGATGG - Intronic
1078171021 11:8929331-8929353 CCCTGGCGTGCTCCTCTGGGTGG - Intronic
1081307551 11:41532015-41532037 CCCTGTCATCCTCTTCAGTGTGG - Intergenic
1083194447 11:61076077-61076099 CCCTGGCTTTCAGTTCAGGCTGG - Intergenic
1083252322 11:61476479-61476501 CCCTGGCTTCCCTCTGAGGGCGG + Intronic
1083952611 11:65965270-65965292 CCTTGGCTGCCTCTTGAGTGGGG + Intronic
1084672028 11:70612659-70612681 CCCCGGGTGCCTCTGCAGGGAGG - Intronic
1084694921 11:70747195-70747217 CACCGGTTTCCACTTCAGGGTGG - Intronic
1084861965 11:72024862-72024884 CCCTGGGATCCTCCTCTGGGAGG - Intronic
1085884226 11:80503672-80503694 TCCCTGCTTCATCTTCAGGGAGG + Intergenic
1086151324 11:83614027-83614049 CACTGGCTTTCTTTCCAGGGAGG - Intronic
1089743714 11:120602427-120602449 TCCTTCCTTCCTCTTCAGGTGGG - Intronic
1089778924 11:120859550-120859572 CCCTGGCTTCCTTATCATTGTGG - Intronic
1090681694 11:129065914-129065936 CCCTGACTTTCTCTTCAGCTGGG + Intronic
1202804860 11_KI270721v1_random:1685-1707 CCCTGGTTTCCTCTGCCTGGTGG - Intergenic
1091785971 12:3243660-3243682 CCCTGGCTTCCTCTTCAGGGAGG + Intronic
1094020469 12:25908327-25908349 TCATGGCTGCCTCTTCAGAGAGG - Intergenic
1096514053 12:52146717-52146739 CCCTGGATTCCCCGGCAGGGGGG - Intergenic
1096543453 12:52321519-52321541 CCCTGCTTGCCTCTTCAGTGTGG + Intergenic
1097399697 12:59114124-59114146 ACCTGGCATCCACATCAGGGGGG - Intergenic
1100412710 12:94337963-94337985 CCCTTGCTTCCTTTTCAGCTTGG - Intronic
1100721043 12:97358452-97358474 TCCTGGGTTCCTCTTCCAGGAGG - Intergenic
1101247915 12:102902569-102902591 CACTGATTTCCTCTTCTGGGAGG + Intronic
1102856858 12:116301830-116301852 CCCTGTCTTCCATTTCTGGGTGG - Intergenic
1103567303 12:121823117-121823139 GCCCGGCTTCCTCTTCATTGGGG - Exonic
1104643558 12:130482112-130482134 CCCTGGCTGCCACCTCAGTGCGG + Intronic
1105004156 12:132710784-132710806 CCCCGGCTGCCGCTTCCGGGCGG - Intergenic
1108744478 13:53377696-53377718 CCCTGGGTCCCTGTTCAGGGAGG - Intergenic
1110063041 13:71066098-71066120 CACTGGCTTCTACTTGAGGGTGG + Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1111091486 13:83452888-83452910 ACCTGGCTGGCACTTCAGGGTGG + Intergenic
1115308675 14:31957635-31957657 CCCTGACTTCCAGTTCAGAGAGG - Intergenic
1116259954 14:42612539-42612561 CCATGTCTTCCTGTTCATGGGGG - Intergenic
1117060355 14:51956255-51956277 CCATGACTACCTCTTCAGGTTGG - Intronic
1117545813 14:56794409-56794431 CCCAGGCTTCCTCTTGACGTGGG - Intergenic
1121615541 14:95311351-95311373 CCCTGCTTTCCTCTCCTGGGGGG - Intronic
1121684671 14:95826874-95826896 CACTGGCTTCATCCTAAGGGTGG + Intergenic
1121690253 14:95873169-95873191 CCTTGCCTGCTTCTTCAGGGAGG + Intergenic
1121727879 14:96166266-96166288 CCCTGGCTTCCTGGACAGAGAGG - Intergenic
1122378892 14:101287513-101287535 CTCTTCCTTCATCTTCAGGGTGG - Intergenic
1123025955 14:105424123-105424145 CCCTGGCTCACTCTCCAGGCAGG + Intronic
1123987598 15:25658959-25658981 CCCTGGCTTCCGGCTGAGGGTGG + Intergenic
1124200920 15:27677900-27677922 CACTAGCTTCCTCGTCAGGTAGG + Intergenic
1125284800 15:38080950-38080972 CACAGGCTTCCTTATCAGGGAGG - Intergenic
1125727685 15:41876496-41876518 CTCAGGCTTTCTTTTCAGGGAGG + Intronic
1126860466 15:52877993-52878015 CTCTGGCTTCCTCTCCCAGGGGG + Intergenic
1128615124 15:69102921-69102943 CCCTGCTTCCCTCTTCAGGCAGG + Intergenic
1129601987 15:77004458-77004480 CCCTGACTTCCTCCCCAGTGTGG - Intronic
1130109366 15:80952106-80952128 GCCTGGCTTCCCCATCGGGGAGG - Intronic
1130351879 15:83099912-83099934 CCCTGGTTTCTTCTTCAGAGAGG + Intergenic
1130408399 15:83623726-83623748 CTCTGGCTTCCTCTTCCTTGAGG + Intergenic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1131657369 15:94475802-94475824 CCCTGGTTTACTCTTTAGAGGGG - Intronic
1131737993 15:95354880-95354902 CCCTGTCTTCTTATTCAGGTAGG - Intergenic
1132044939 15:98555582-98555604 CAATGGCTTACTCTGCAGGGTGG - Intergenic
1132148492 15:99443096-99443118 CCCTGGAGCCCACTTCAGGGTGG + Intergenic
1132746790 16:1439537-1439559 CCCTCCCCTCCCCTTCAGGGCGG - Intronic
1132756096 16:1486202-1486224 CACCGGCTCCCGCTTCAGGGAGG - Exonic
1132812925 16:1810314-1810336 CCCTGTCGTCCTCTCCAGGCCGG - Intronic
1133457464 16:5954931-5954953 TCCTGGGTTCCTCTTGAAGGAGG + Intergenic
1134215142 16:12311453-12311475 TCCTGGCTTCCTCTGCTGGCTGG + Intronic
1136014064 16:27383655-27383677 GGCTGGCTTCCCTTTCAGGGAGG - Intergenic
1136449231 16:30343287-30343309 CACTGGCTACCTCTTCCAGGTGG + Intergenic
1136513403 16:30753277-30753299 ACCTGGTTTCCTTTTCAGAGAGG - Exonic
1137560368 16:49498444-49498466 CCCCGCCTTCCTCTCCAGGCTGG - Intronic
1138439567 16:57026005-57026027 CCATGGCTGCCTCTGCAGGCAGG - Exonic
1138447297 16:57072187-57072209 CCTTGGCTTCCTTCTCAGGCAGG + Intronic
1138563553 16:57816355-57816377 TCCTGGCTTCCTCTTGAGGAAGG + Intronic
1138659970 16:58511138-58511160 CACTGGCATCCTCTTGAGGGAGG + Intronic
1139529445 16:67535873-67535895 CCCAGGCTTCGCCTTCAAGGAGG + Intronic
1139981146 16:70860067-70860089 CCTCGGCTTTCTTTTCAGGGTGG + Exonic
1140267448 16:73433065-73433087 CCCTGGCTTTCTCTCCTGGCTGG + Intergenic
1140786744 16:78349496-78349518 TCCTGGCTTCTTCTAAAGGGTGG - Intronic
1142046195 16:87926775-87926797 CACTGGCTACCTCTTCCAGGTGG - Exonic
1143107106 17:4535365-4535387 GCCTGGCTTGGTCCTCAGGGAGG + Intronic
1144769819 17:17753196-17753218 CCCTGCCTTCCTCCTGAGGCAGG - Intronic
1145272546 17:21412562-21412584 CCCTGGCTGCCTCTTTCTGGAGG + Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1146571394 17:33956406-33956428 CCCTGGCTGCCCCTTCAGTCAGG + Intronic
1146572106 17:33961775-33961797 CCCTGGCTGCCCCTTCAGGCAGG + Intronic
1147044303 17:37742353-37742375 CCCTGCCTTTCTCTTCCAGGAGG + Intronic
1147243856 17:39108228-39108250 CCTAGGCTTCATCTTCATGGGGG - Exonic
1147579842 17:41622084-41622106 CCCTGCCTCCCTCATGAGGGTGG - Intronic
1148644283 17:49210443-49210465 CCTTGGCTTCCTCTGCTGGGTGG + Exonic
1148986802 17:51629425-51629447 CCATGCCTTCCTTTACAGGGTGG - Intergenic
1150057358 17:62030466-62030488 GCCTGGCTTCCACATCAAGGTGG + Intronic
1150283188 17:63941101-63941123 CTCGTGCTTCCTCTTGAGGGTGG + Exonic
1150294232 17:63999132-63999154 CCTGGGGTTCCTGTTCAGGGGGG + Intronic
1151359284 17:73578961-73578983 CTCAGGCTTCCTCTCCAGCGTGG + Intronic
1151558467 17:74859011-74859033 CCCTGGCTTCCCCTCCTGGGTGG + Intronic
1151928374 17:77214986-77215008 CTCTCGCATCCACTTCAGGGTGG + Intronic
1152634961 17:81427125-81427147 CCGGGGCTTCCTCGGCAGGGAGG - Intronic
1152673657 17:81625001-81625023 CTCTAGCTTCCTCTTCAGTGTGG - Intronic
1152749711 17:82057056-82057078 CCCTGGCTCCCTTCTCTGGGCGG - Exonic
1154116157 18:11614271-11614293 CCCTGGCTGCCCCGTCTGGGAGG + Intergenic
1155492525 18:26414356-26414378 TCCTTGCTTCCCCTTGAGGGAGG + Intergenic
1156265448 18:35484025-35484047 CCCTTGCCTCCACTTCAGTGTGG - Intronic
1156308916 18:35904937-35904959 GCCTGGCCTCCTCTTCCAGGTGG + Intergenic
1157715068 18:49879264-49879286 CTCTGGCTTAGTCTTCAGAGAGG + Intronic
1158899988 18:61953575-61953597 CCCTGCCTGTCTCTTCTGGGAGG + Intergenic
1160221397 18:76980467-76980489 CTCTCTCTTCCTTTTCAGGGAGG - Intronic
1160624864 18:80196724-80196746 CCCTGGATTCTTCTGGAGGGGGG + Intronic
1161030950 19:2057546-2057568 CCGTGGCTTCCTCTTCCGGGAGG + Intergenic
1161046620 19:2138361-2138383 CCATGGGGTCCTCTTCTGGGTGG - Intronic
1161741610 19:6024341-6024363 CCCTGAGTTCATCTACAGGGAGG + Intronic
1162066503 19:8129046-8129068 CCCCGGCTTCCACTTCTGGCAGG - Exonic
1164449424 19:28347698-28347720 CAATGTCTTCCTCTTCAGTGTGG - Intergenic
1165372598 19:35418826-35418848 CCCTGGATTTCTCTTCAGAGTGG + Intergenic
1166360894 19:42252623-42252645 CCCTGGCTCCCACTTCTGGCAGG + Intronic
1166673291 19:44724283-44724305 CCCTGGCTCCCACTTCAGACAGG + Intergenic
1166994348 19:46712783-46712805 CCCTTGGTCCCTCTTGAGGGTGG - Intronic
1167048357 19:47064890-47064912 CCCTTCCCTCCTCCTCAGGGTGG - Exonic
1167472822 19:49684904-49684926 CCCTGCCTGCCTCCCCAGGGTGG + Exonic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
926855288 2:17249714-17249736 ACCTGGCTTCCTCTGCAGTGAGG - Intergenic
927307785 2:21593549-21593571 CCAGGGCATCCTCTTCAGGGTGG - Intergenic
927919606 2:26961784-26961806 GGCTGGCTTCCTCTTCTGCGTGG + Intergenic
929763515 2:44825548-44825570 CCCTGGGCTCCTCTTGAGAGGGG - Intergenic
934176715 2:89584089-89584111 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
934287021 2:91658449-91658471 CCCCAGCTGCCTCTCCAGGGAGG - Intergenic
935331635 2:101981610-101981632 CTCAGGCTTCCTGTGCAGGGTGG - Intergenic
936034571 2:109100604-109100626 CCCTGACTTTCTCTCCAGGCGGG - Intergenic
937032242 2:118750389-118750411 CCATGGCCTCCACTTGAGGGAGG - Intergenic
937370666 2:121295272-121295294 ACCTGGCCTACTCTTCTGGGCGG - Intergenic
937702929 2:124884548-124884570 CCCAGCCCTACTCTTCAGGGTGG - Intronic
937739553 2:125333876-125333898 CTCTGTCTTCCTTTTCAGGGTGG - Intergenic
938014250 2:127854416-127854438 CTGTTGCTTCCTCTTCAGTGTGG - Intronic
938062733 2:128265725-128265747 TCCTGGCTTCCCCTTCCAGGAGG + Exonic
938927197 2:136054958-136054980 CACCGTCTTCCTCTTCTGGGTGG + Intergenic
940150062 2:150589981-150590003 CCAGGGATTCCCCTTCAGGGTGG - Intergenic
943355356 2:186848992-186849014 CACTGGCTTCCTGCTGAGGGAGG - Exonic
943378809 2:187117415-187117437 CTCTGGCTTCATCTTCTTGGGGG + Intergenic
943540673 2:189209983-189210005 CCCTAGCTTCCCTTTCAGGGCGG - Intergenic
944194253 2:197035847-197035869 CCCTGGGATCCTCTGAAGGGAGG - Intronic
944573453 2:201068459-201068481 CACTGGCTTCCACTTCAGAGTGG - Intronic
944827267 2:203497195-203497217 TGCTGGCTTCCTCCACAGGGAGG - Intronic
946175346 2:217919079-217919101 CCCTCCCTCCCTATTCAGGGTGG - Intronic
1169801552 20:9516482-9516504 CCTCGGCTTGCTCTTTAGGGCGG + Intronic
1170600039 20:17835172-17835194 CACTGGTTGCCTCTGCAGGGGGG + Intergenic
1171189481 20:23149141-23149163 CCCCGGCTTCCTCCACATGGAGG + Intergenic
1171211982 20:23324244-23324266 TCCTGGCTTCCCCGTCTGGGTGG - Intergenic
1172614041 20:36271906-36271928 GCATGGCTTCCTCTTTTGGGTGG - Intergenic
1173822853 20:46030127-46030149 CCGTGGGTTCCTATTCAGGACGG + Intronic
1174590413 20:51640481-51640503 CCTTGGTTTCCTCTTCTGTGTGG - Intronic
1175269330 20:57722800-57722822 CCCCGGCTTTCTCTGCAGTGGGG - Intergenic
1175326815 20:58135389-58135411 CCCTGGCCACCAGTTCAGGGAGG - Intergenic
1175994792 20:62807233-62807255 TCCTGGCTTCCACCTTAGGGTGG - Intronic
1176103805 20:63376424-63376446 CCCCGGCTTCCTCTGCAGCAGGG - Intronic
1179879392 21:44287138-44287160 GGCTGGCTTCCCCTGCAGGGAGG - Intronic
1180040954 21:45279669-45279691 CCCAGCCATCCTCTTCTGGGTGG + Intronic
1180090087 21:45529411-45529433 CCTGGGCTTCCCCTCCAGGGTGG - Intronic
1180195690 21:46192219-46192241 GCTTGGCGTCCTCTTCAGGGGGG - Intronic
1180850735 22:19018796-19018818 CCCTGCCCCCCTCTTCAGGAGGG + Intergenic
1181436256 22:22912895-22912917 CACTGGGTTCCTGCTCAGGGAGG - Intergenic
1181441970 22:22941426-22941448 CCCAAGCTCCCTCCTCAGGGAGG + Intergenic
1182585668 22:31343146-31343168 CCCTGGTTTTCTCTGGAGGGGGG + Intronic
1182698275 22:32210920-32210942 CACTGGGTTCCTGCTCAGGGAGG - Intergenic
1183341542 22:37284461-37284483 CTCTGGCCTCCTCCTCAAGGAGG - Intronic
1183510031 22:38229311-38229333 CCACGGCCTCCTGTTCAGGGAGG - Intronic
1184247535 22:43243267-43243289 CCCTGGCTTCCTCCTCCAGCTGG + Intronic
1184273350 22:43397125-43397147 CCGTGGATTCAGCTTCAGGGAGG - Intergenic
1184819269 22:46896767-46896789 CACTGGTTTCCTCTTCACCGTGG + Intronic
1184843097 22:47063978-47064000 CCCTGTTTTCCTCTTCTGTGAGG + Intronic
950304487 3:11907649-11907671 CTCTGGCTTTCTCTGCAGGCCGG - Intergenic
950879541 3:16311997-16312019 GCCTGGCTTCCTCTGCTGGAGGG + Intronic
953063047 3:39443721-39443743 CCAGGGCTCCCTCTGCAGGGAGG + Intergenic
953084507 3:39653756-39653778 GCCTGGCTTCCCATTCGGGGAGG + Intergenic
954391425 3:50269903-50269925 ACCTGCCTTCCTCTTCCTGGGGG + Intronic
955921933 3:63966286-63966308 CCTTGGCTACCCCTGCAGGGAGG + Intronic
958617156 3:96510078-96510100 CCCTGGGTTTCTCTGCAGGGGGG - Intergenic
959622159 3:108410344-108410366 CACTGGCTTCCTTTACAGAGGGG + Intronic
961714322 3:128848276-128848298 GGCTGGCTTCCTCTGCAGGCCGG + Intergenic
961785821 3:129346057-129346079 GTCTGGCTTCCTCTACAGGATGG - Intergenic
967942796 3:194779296-194779318 CCCCAGCTTCCTGTCCAGGGCGG - Intergenic
969086853 4:4663027-4663049 CCCTAACTTCCCCTTCTGGGTGG + Intergenic
969322069 4:6418339-6418361 CTTTGGCTTCCTCTCCAGGAGGG - Intronic
972691817 4:41406511-41406533 CCCTCCCTCCCTCTCCAGGGAGG + Intronic
973754686 4:54063879-54063901 GCCACCCTTCCTCTTCAGGGTGG - Intronic
974218819 4:58938112-58938134 CCCAGGTTGCCTCTTCAGTGAGG + Intergenic
976117017 4:81738681-81738703 CCCTGAGTTCCTGTTCAGGAAGG - Intronic
978909436 4:114047242-114047264 CCATGACATCCTCTTCAAGGGGG + Intergenic
979314547 4:119246347-119246369 ACCTGGCTTCCTCATCATGGTGG - Intronic
984778476 4:183504544-183504566 CCCGGGCTTCCCCTTTAAGGGGG + Intergenic
986194671 5:5527113-5527135 ACCTGGCTGCCTCCTCAGGCTGG - Intergenic
988904499 5:35772275-35772297 CCCAGGATTCCACTTCAGAGGGG - Intronic
989696721 5:44210461-44210483 CACTGGCGTCCACTTGAGGGTGG - Intergenic
990636491 5:57733629-57733651 CAATGGCTGGCTCTTCAGGGTGG + Intergenic
994766868 5:103929392-103929414 CCCTTGCCTCTTCTTCAGAGAGG - Intergenic
994803540 5:104412941-104412963 CCTGAGCTTCCTCTTCAGTGGGG - Intergenic
997463370 5:134071013-134071035 CCCTAGGTTCCTCTGCTGGGCGG - Intergenic
997476442 5:134145241-134145263 CCCTCACTTCCTCTTCAAGATGG + Intronic
997771754 5:136561491-136561513 CCCTGTCTTCTTCCTCAGGCTGG + Intergenic
999245672 5:150153286-150153308 CCCTGGCTTGGTCTTGAGAGAGG - Intronic
1000193522 5:158936701-158936723 CACTGGCTTCCTCCTCTGGATGG + Intronic
1001274470 5:170340367-170340389 ACCTGCCTTCCTCTTCTGGAAGG - Intergenic
1001763377 5:174225457-174225479 CCCTGCCTGCCTCTGTAGGGAGG - Intronic
1002045861 5:176541589-176541611 CCCAGGCCTCCTCTGCAGTGGGG + Intergenic
1002563774 5:180099075-180099097 CCTGGGCTTCTTCTCCAGGGAGG - Intergenic
1003084198 6:3048427-3048449 CGATGGCCTCCTCTTCAGGCAGG + Intergenic
1004817612 6:19329632-19329654 CACTGGGTTCCACTTGAGGGTGG - Intergenic
1006438624 6:34039984-34040006 CCCTGTCTTCCATTTCAGGGTGG + Intronic
1006790552 6:36698430-36698452 CTCTGGCTTCCACTTCCTGGTGG + Intronic
1007708594 6:43806679-43806701 CCCCAGCCTCCTCTTCAGGCAGG - Intergenic
1010193654 6:73218870-73218892 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1010197055 6:73250478-73250500 TGTTGGCTTCCTCTTCAGGTTGG - Intronic
1010775425 6:79879346-79879368 GCCAGGCTGGCTCTTCAGGGTGG - Intergenic
1011219280 6:85036856-85036878 TCCCTGCTTCCTCTTCTGGGAGG - Intergenic
1013647117 6:112156073-112156095 CCTTGGCTTCCTCTACAGAAAGG - Intronic
1013771984 6:113638067-113638089 CCCTGCCTGGCTCTGCAGGGAGG - Intergenic
1014292131 6:119570973-119570995 TGCTGCCTTCTTCTTCAGGGTGG - Intergenic
1015263617 6:131266105-131266127 CTCTGGCTTACTCTTCAGGAAGG + Intronic
1017679924 6:156853419-156853441 CCCAAGCTTCCTTTCCAGGGAGG + Intronic
1018873337 6:167799512-167799534 CCCTGGCTTGCTCATCACTGTGG - Intergenic
1018926119 6:168208108-168208130 CAGTGGATGCCTCTTCAGGGTGG + Intergenic
1019294093 7:264818-264840 CCCTGGCTTGTTCTTCTGGGCGG - Intergenic
1019416757 7:931186-931208 CCCTGGCTGCCTGGCCAGGGTGG + Intronic
1019497351 7:1346679-1346701 CCCTGGACTCCTGTTCAGGATGG - Intergenic
1019778079 7:2924207-2924229 CCCCGGCTTCCCCTTCACTGGGG + Intronic
1023896603 7:44438980-44439002 CACTGGCCTCCTCTTCACCGAGG - Intronic
1024374200 7:48619067-48619089 CCCTGCCTTCCTCTGCAAAGTGG - Intronic
1026307730 7:69156391-69156413 CCTTGGCTTTGTCTTCATGGTGG + Intergenic
1027244892 7:76359846-76359868 CCCCTTCTTCCTCTCCAGGGTGG + Intergenic
1027808331 7:82859181-82859203 GCCTGTCTTTCCCTTCAGGGTGG - Intronic
1029159906 7:98544210-98544232 CCCTGGCAGGCTGTTCAGGGTGG + Intergenic
1029797225 7:102908965-102908987 CTGTGTCCTCCTCTTCAGGGTGG + Intronic
1031639039 7:124139837-124139859 CTGTGTCTTCCCCTTCAGGGCGG + Intergenic
1033360485 7:140635742-140635764 CCCTGGCTTGCAGTTCAGAGGGG - Intronic
1033882394 7:145902098-145902120 CCCTGTCTTTCCCTTCAGGATGG + Intergenic
1034251225 7:149692583-149692605 CCCTGGCTGCTCCTTCAGGGAGG - Intergenic
1034889278 7:154825614-154825636 CCCTGGCTTCCTCAACACTGAGG - Intronic
1035252898 7:157608714-157608736 CCCTGGCTTCATCTCCAGCCTGG - Intronic
1035616130 8:1003140-1003162 CCCTGGCTGCTCCTTCAGGATGG + Intergenic
1035756217 8:2034867-2034889 CCCTGGCTTCCTCATCTGTAAGG - Intergenic
1036216453 8:6883714-6883736 TGGGGGCTTCCTCTTCAGGGAGG + Intergenic
1036218319 8:6899414-6899436 CTTTGGCTTCCGCTTCAGGAGGG + Intergenic
1037332769 8:17760491-17760513 CCTTGGCTTTGTCTTCATGGTGG - Intronic
1037646446 8:20796717-20796739 CCCTGGCTTTCACCTGAGGGTGG - Intergenic
1040106769 8:43546108-43546130 CCCTGTCTCCCACATCAGGGTGG - Intergenic
1042941884 8:74116190-74116212 CCCTGGGGTCCTAATCAGGGGGG + Intergenic
1048496313 8:134939036-134939058 TCCTTGCTCCCTCTTTAGGGAGG + Intergenic
1048847087 8:138612131-138612153 CAGTGGCTTCCTCTGGAGGGTGG + Intronic
1049003421 8:139840217-139840239 CCCTGGCCTCCCCTGCAGGGAGG + Intronic
1049156597 8:141070968-141070990 TCCTGGCCTCCGCGTCAGGGAGG - Intergenic
1049299499 8:141862123-141862145 TCCTGGCTTCCTGTTCATGGAGG + Intergenic
1049423206 8:142525901-142525923 TCCTGGCCTCCTCTGCTGGGGGG - Intronic
1049478727 8:142809996-142810018 CCCTGGCTTCCTCTGCCTGGGGG + Intergenic
1049492706 8:142913670-142913692 CCCCTGCAGCCTCTTCAGGGCGG + Intronic
1049774763 8:144399118-144399140 CCCTGGGCACCTCTTCAGAGAGG + Exonic
1050601877 9:7261192-7261214 CCCTGGCTTCATAATGAGGGAGG - Intergenic
1051326970 9:15982564-15982586 CCCTTGCTTCCTCTAAAGGCTGG - Intronic
1051760920 9:20463258-20463280 CCCTGGCTTCTCTTTCAAGGGGG + Intronic
1052778253 9:32754821-32754843 CCCTGGCTTCCCCTGCAGTGTGG - Intergenic
1057879229 9:98780557-98780579 CCCTGCCTTCCTCATGAGAGAGG - Intronic
1060098451 9:120814788-120814810 ACCTGGCTTCCTCTCCATTGAGG + Intergenic
1060197455 9:121632818-121632840 CACCGCATTCCTCTTCAGGGAGG - Intronic
1060781827 9:126418697-126418719 CCCTGGCTTCCTCCTAAGTCTGG + Intronic
1060889199 9:127177520-127177542 CCCTGGGCTCTTCCTCAGGGAGG - Intronic
1060992376 9:127856472-127856494 CCCTGGGTGCCTCTGGAGGGAGG + Intergenic
1061242291 9:129381712-129381734 CCCGGGCTCCCTCCTCCGGGAGG + Intergenic
1061264630 9:129497835-129497857 CTCAGGCACCCTCTTCAGGGAGG - Intergenic
1061732842 9:132629834-132629856 CCCTGGGTTCATCTTCCTGGGGG + Intronic
1062032106 9:134366386-134366408 TCCCAGCTTCCTCTGCAGGGCGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1192885920 X:75335545-75335567 GCCTGGCTGCCTCGTCTGGGAGG - Intergenic
1193861837 X:86677760-86677782 CCCTGGCCTTTTCTTCAGTGAGG - Intronic
1194223711 X:91227985-91228007 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1194290997 X:92071900-92071922 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1194857789 X:98956015-98956037 CTCTGTCTTTCCCTTCAGGGAGG + Intergenic
1200560175 Y:4691367-4691389 CTGTGTCTTCCCCTTCAGGGTGG - Intergenic
1200608506 Y:5296475-5296497 CCATGGCCTTCTCTTCAGGGTGG + Intronic
1201077335 Y:10197680-10197702 CTCAGGCTCCCTCTTCAGAGTGG - Intergenic
1201729973 Y:17192647-17192669 AGCTGGCTCCCTCTGCAGGGAGG - Intergenic