ID: 1091786196

View in Genome Browser
Species Human (GRCh38)
Location 12:3244669-3244691
Sequence CCACATGGTCCCCTTTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091786196_1091786208 19 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786208 12:3244711-3244733 CGGTGTGAGACCCGGGTAATGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1091786196_1091786206 12 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786206 12:3244704-3244726 TTAGTCACGGTGTGAGACCCGGG 0: 1
1: 0
2: 0
3: 1
4: 99
1091786196_1091786210 25 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786210 12:3244717-3244739 GAGACCCGGGTAATGGGGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 235
1091786196_1091786207 18 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786207 12:3244710-3244732 ACGGTGTGAGACCCGGGTAATGG 0: 1
1: 0
2: 0
3: 9
4: 52
1091786196_1091786211 26 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786211 12:3244718-3244740 AGACCCGGGTAATGGGGAGAGGG 0: 1
1: 0
2: 2
3: 10
4: 158
1091786196_1091786209 20 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786209 12:3244712-3244734 GGTGTGAGACCCGGGTAATGGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1091786196_1091786205 11 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786205 12:3244703-3244725 TTTAGTCACGGTGTGAGACCCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1091786196_1091786204 -1 Left 1091786196 12:3244669-3244691 CCCCCCTAAAGGGGACCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 83
Right 1091786204 12:3244691-3244713 GTAGATGGTCTCTTTAGTCACGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091786196 Original CRISPR CCACATGGTCCCCTTTAGGG GGG (reversed) Intronic
912354463 1:109043195-109043217 CCCCATTTTCCCCTTTTGGGAGG - Intergenic
912556957 1:110523528-110523550 CCACATGGTGGCCTGGAGGGAGG - Intergenic
915228770 1:154430386-154430408 CCACGTGCTCCCCTCAAGGGAGG + Intronic
916678072 1:167081052-167081074 CCATATGGACCCCCTTAGGGAGG - Intronic
919901243 1:202045874-202045896 CCACATGGCCCACTCTGGGGAGG - Intergenic
920009870 1:202859949-202859971 CCACAAACTCCCCTTTTGGGGGG + Intergenic
1063088446 10:2840218-2840240 CCACATGCTCCCCTTTTGTTGGG + Intergenic
1064094033 10:12409256-12409278 CCTCATGGTCCCTATTACGGTGG + Intronic
1067354254 10:45510823-45510845 CCACATAGTCCACTTTATAGAGG - Intronic
1069333052 10:67316683-67316705 CCATATTGTCATCTTTAGGGTGG - Intronic
1069556013 10:69399087-69399109 CCTCCTGGTCCCCCTTAGGTGGG + Intronic
1070854219 10:79593709-79593731 CCACATGGTCCATTTGTGGGTGG - Intergenic
1070857239 10:79615668-79615690 CCACATGGTCCATTTGTGGGTGG + Intergenic
1070977541 10:80617208-80617230 CCAGGTGGTCTCCTTGAGGGTGG + Intronic
1075860031 10:125667356-125667378 AGTCATGGTCCCCATTAGGGGGG + Intronic
1076982649 11:213044-213066 CCATGTGGACCCCTGTAGGGTGG + Intronic
1079226276 11:18608306-18608328 TCATATGGTCCCATTAAGGGAGG + Exonic
1089104683 11:115992504-115992526 CCACATGATTCCTTTTAGGAGGG + Intergenic
1091786196 12:3244669-3244691 CCACATGGTCCCCTTTAGGGGGG - Intronic
1091884164 12:4003753-4003775 TCCCAGTGTCCCCTTTAGGGAGG - Intergenic
1094525206 12:31226798-31226820 CCACATGGTCCCGGTTACAGGGG + Intergenic
1102688768 12:114744153-114744175 CCACAGGATCCCCTTTGGGGTGG - Intergenic
1105509644 13:21040641-21040663 CCACATGCTCCCCTCTACAGAGG - Intronic
1111658618 13:91181437-91181459 CAACATGGTCTGCTTTAGTGAGG + Intergenic
1113471928 13:110553151-110553173 CCACATGGTCACCTCTACTGAGG - Intronic
1116131244 14:40857284-40857306 CCACAGAATCCCCTTTAGAGAGG - Intergenic
1118736056 14:68702723-68702745 CCACAGGTACCCCTTAAGGGAGG - Intronic
1130094885 15:80848561-80848583 TCACATCGTCCCATTTATGGAGG + Intronic
1132912761 16:2323878-2323900 ACACAGGGGCCCCTTTTGGGGGG + Intronic
1135822361 16:25695234-25695256 CCACATGGTCCCCTTAAGTGAGG - Intronic
1141741337 16:85895155-85895177 CAACATGGTCAGGTTTAGGGAGG + Intergenic
1141779591 16:86150783-86150805 TGACATGGTCACCTTCAGGGAGG - Intergenic
1148713739 17:49700563-49700585 CTACCTGGTCCCCTCCAGGGAGG - Intergenic
1148959896 17:51384551-51384573 CCACGTGGTCCCAGGTAGGGAGG + Intergenic
1152905112 17:82965659-82965681 CCACGTGGGCCCCTTTAACGAGG - Exonic
1153723795 18:7935826-7935848 ACACAGGGTCTACTTTAGGGTGG - Intronic
1157814438 18:50720704-50720726 CCTCATGGTCCCCTGGTGGGTGG + Intronic
1157829488 18:50843810-50843832 CCACATGGCTTCCTTCAGGGGGG + Intergenic
1161591981 19:5133056-5133078 CCCCAGGCTCCCCTTTAGGTTGG + Intronic
1164294628 19:23898937-23898959 CCACAATGTCCCCTGTAGGAAGG - Intergenic
1164313402 19:24065879-24065901 TCACAAGGTCCCCTGTAGGCAGG - Intronic
930102683 2:47615483-47615505 GCACATGGTGGCCTTGAGGGTGG - Intergenic
935884595 2:107603178-107603200 CTAGATGGTCCCATCTAGGGGGG - Intergenic
937433719 2:121862675-121862697 CCACATGGCTGCCTTGAGGGAGG - Intergenic
937677727 2:124610027-124610049 CCAACTGGTCTCCTTTGGGGAGG + Intronic
937865648 2:126749575-126749597 CCACATGGACCCCTTTGGGTTGG - Intergenic
938705999 2:133927575-133927597 CCACATGGACCACATTAGTGTGG + Intergenic
939037956 2:137155691-137155713 CCAAATGGTCCCCATCAAGGAGG - Intronic
939410304 2:141816089-141816111 CCAAATGTTCACCTATAGGGAGG + Intronic
941633786 2:167913804-167913826 CCACCTTCTCCCCTTTGGGGGGG - Intergenic
946213165 2:218163578-218163600 ACACATGTTCCCCTTGGGGGTGG - Exonic
1170755003 20:19194590-19194612 ACACATGATCACCTTTAGTGAGG - Intergenic
1172014738 20:31866571-31866593 AAGCATGGTCCCCTCTAGGGCGG - Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1179231979 21:39512196-39512218 CCACATGTACAACTTTAGGGGGG + Intronic
1179392768 21:41009014-41009036 CCACATGGTGGCCTGTAGCGTGG - Intergenic
1181002157 22:19992884-19992906 CCAGTGGGCCCCCTTTAGGGTGG - Intronic
1182146557 22:28000415-28000437 CCAGATGGGCCTCTTTATGGTGG - Intronic
1184783705 22:46661805-46661827 CCACTTGGTCCCCTTCGGGGAGG - Intronic
950184262 3:10935298-10935320 CCACAGCGTCCCCTTGAGGCAGG - Intronic
952086872 3:29833077-29833099 CCACTTGTTCCCTCTTAGGGAGG - Intronic
963841737 3:150114612-150114634 CCACATAGTCCCCTTTTGGTAGG + Intergenic
967380395 3:188851463-188851485 CCACATTTTCCCCTGTATGGAGG + Intronic
967423030 3:189294554-189294576 CCACTGTGTCCCCTTTAGAGAGG + Intronic
975823783 4:78298836-78298858 AAACATGGTCCCCATTTGGGAGG + Intronic
987525484 5:19044755-19044777 CCACAAGGTCCCTTATAGGAGGG - Intergenic
989245178 5:39246200-39246222 CCACAGGGTCCCCTATCTGGTGG - Intronic
990446402 5:55897601-55897623 CCACATGGTCCTTCCTAGGGCGG + Intronic
998283446 5:140835262-140835284 CCACATGGACCCCTTAAGTGGGG + Exonic
998284810 5:140849374-140849396 CCACATGGACCCCTTAAGTGGGG + Exonic
999263695 5:150253148-150253170 CCACAGGGAGCCCTTTGGGGAGG + Intronic
999277156 5:150338976-150338998 CTTCATGATCCCCTTAAGGGTGG + Intronic
1001024195 5:168209590-168209612 CCACATTTTCCCCTTGAGGAAGG - Intronic
1024655925 7:51451365-51451387 CCACCTGTGCCCCTTCAGGGCGG - Intergenic
1024883047 7:54111290-54111312 CCAAATGGTCCCATTAAGGGAGG + Intergenic
1029444492 7:100604691-100604713 CCCCGAGGACCCCTTTAGGGAGG - Intronic
1033587739 7:142786979-142787001 CCACAGTGTCCCTTTTAGAGTGG + Intergenic
1034730393 7:153382016-153382038 CCACATGATCCCCTGTCAGGCGG + Intergenic
1041020548 8:53633851-53633873 CTGCATGGGCCCCTTTGGGGTGG - Intergenic
1052619564 9:30889046-30889068 CCATATGGTCCCTCTAAGGGTGG + Intergenic
1053610546 9:39709043-39709065 ACAGATGGTCCCCTTTAAGATGG - Intergenic
1053868585 9:42467068-42467090 ACAGATGGTCCCCTTTAAGATGG - Intergenic
1054087707 9:60762114-60762136 ACAGATGGTCCCCTTTAAGATGG + Intergenic
1054242977 9:62633352-62633374 ACAGATGGTCCCCTTTAAGATGG + Intergenic
1054557101 9:66667870-66667892 ACAGATGGTCCCCTTTAAGATGG + Intergenic
1059607163 9:115845938-115845960 CCATGTGGGCCCCTTTTGGGTGG - Intergenic
1187234647 X:17455856-17455878 CAACATGGTGGCATTTAGGGAGG - Intronic
1193085908 X:77447835-77447857 CCGCAGGATCCCCTTTAGGTGGG - Exonic
1196812005 X:119636275-119636297 CCACGTGGTGCCCTTTATGGTGG - Intronic
1200951960 Y:8906311-8906333 AAACATGGTCCCCTTTTGGAAGG + Intergenic
1202161004 Y:21937041-21937063 AAACATGGTCCCCTTTTGGAAGG - Intergenic
1202230352 Y:22649332-22649354 AAACATGGTCCCCTTTTGGAAGG + Intergenic
1202312804 Y:23546833-23546855 AAACATGGTCCCCTTTTGGAAGG - Intergenic
1202557998 Y:26123761-26123783 AAACATGGTCCCCTTTTGGAAGG + Intergenic