ID: 1091786830

View in Genome Browser
Species Human (GRCh38)
Location 12:3248041-3248063
Sequence GGAGAGGTTGAGCACATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091786830_1091786837 21 Left 1091786830 12:3248041-3248063 CCAGAGATGTGCTCAACCTCTCC 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1091786837 12:3248085-3248107 CATTTTAATCAGGGAGCTAATGG 0: 1
1: 0
2: 0
3: 14
4: 202
1091786830_1091786834 11 Left 1091786830 12:3248041-3248063 CCAGAGATGTGCTCAACCTCTCC 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1091786834 12:3248075-3248097 ACAGCCACTTCATTTTAATCAGG 0: 1
1: 0
2: 1
3: 17
4: 163
1091786830_1091786835 12 Left 1091786830 12:3248041-3248063 CCAGAGATGTGCTCAACCTCTCC 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1091786835 12:3248076-3248098 CAGCCACTTCATTTTAATCAGGG 0: 1
1: 0
2: 2
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091786830 Original CRISPR GGAGAGGTTGAGCACATCTC TGG (reversed) Intronic
900554449 1:3272779-3272801 GGCGAGGCCGAGCCCATCTCTGG + Intronic
901142699 1:7045285-7045307 GGAGAGGTTGGTCTCATCCCTGG - Intronic
901165811 1:7220861-7220883 GGAGAGGATGAGGACATATGGGG + Intronic
904311231 1:29630917-29630939 GGAGAGGATGGGCACAGCTGCGG - Intergenic
904613895 1:31739496-31739518 GGAGAGGCTGAGCACCTCCTTGG + Exonic
905360022 1:37412720-37412742 GGAAGGGCTGAGCACATCACTGG - Intergenic
906372194 1:45263637-45263659 GAAGAGGTTGAACACATGGCTGG - Intronic
909450895 1:75796995-75797017 GGCGAGGTTGATGAGATCTCAGG - Exonic
910112595 1:83698740-83698762 GCAGTGTTTGAGGACATCTCTGG - Intergenic
910138191 1:83997847-83997869 GGAGATGTTCAGCACATTTTTGG - Intronic
910796264 1:91100479-91100501 TGAGAGGTTTTGCACATGTCAGG + Intergenic
915063995 1:153209824-153209846 AGAGATGATGAGCACATTTCTGG - Intergenic
915316162 1:155030249-155030271 GGGGAGGTGGAGCACATGTGAGG + Intronic
916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG + Intergenic
919807560 1:201389317-201389339 GGAGAGGGTCAGCACAGCTGGGG + Intronic
921904884 1:220485881-220485903 TGAGAGGAGGAGCACCTCTCTGG - Intergenic
1068589703 10:58840937-58840959 AGACAGGTTGAGAGCATCTCAGG + Intergenic
1069804312 10:71108444-71108466 TGGGAGGTAGAGCAGATCTCTGG - Intergenic
1070890157 10:79937062-79937084 GGACAGGATGAGCTCATCTCTGG + Intergenic
1072376348 10:94820591-94820613 GGAGAAGGAGAGCATATCTCAGG - Exonic
1072389853 10:94972199-94972221 GGAGAAGGAGAGCATATCTCAGG - Exonic
1072569369 10:96645245-96645267 GGAGAGTTTAAGCAAATATCTGG - Intronic
1072848692 10:98862144-98862166 AGATAGGTTGAGCCCATCTCTGG + Intronic
1075064959 10:119282993-119283015 GCAGAGTTGGGGCACATCTCAGG + Intronic
1076433948 10:130426760-130426782 GGAGATGTTCAGTAAATCTCAGG + Intergenic
1077870459 11:6258354-6258376 GGAGCAGTTGATGACATCTCAGG + Intergenic
1078929962 11:15905407-15905429 GGAGCTGCTGATCACATCTCAGG - Intergenic
1079699976 11:23533588-23533610 GGAGAGTTTGAGGACTTTTCAGG + Intergenic
1080036685 11:27719151-27719173 GGAGAGGTAGAACACAGGTCTGG + Intronic
1084015036 11:66373379-66373401 GGAGAGGATGAGGGCATTTCAGG + Intergenic
1089643917 11:119865538-119865560 GGAGAGGCTGAGGCCATCTGGGG - Intergenic
1089881809 11:121781206-121781228 GGAATGGTTGTGCACATCTGTGG - Intergenic
1090031753 11:123212236-123212258 GGAAAGGGTGAGCCCATCCCAGG - Intergenic
1090218539 11:124994268-124994290 CGACAGGTAGAGCACATCACAGG + Intronic
1091786830 12:3248041-3248063 GGAGAGGTTGAGCACATCTCTGG - Intronic
1093573474 12:20696432-20696454 AGAGGGGTTGAGTACATCTGCGG + Intronic
1095484200 12:42667399-42667421 GCAGAGGTTAAGCAAATCTTAGG + Intergenic
1096007598 12:48184943-48184965 GGAGAGGAAGCGCCCATCTCTGG + Exonic
1096816599 12:54205629-54205651 TGAGAGCTTGAGCCCACCTCAGG - Intergenic
1098204713 12:68096262-68096284 GGAGAGGTTCAACATATATCAGG - Intergenic
1098293563 12:68981662-68981684 GGAGAGGGTGAGATCAGCTCTGG + Intergenic
1098478639 12:70936516-70936538 GGAGAGGTCTGGAACATCTCTGG - Intergenic
1101136013 12:101743848-101743870 GGTGTGGTGGAGCACATCTGTGG + Intronic
1103010760 12:117456561-117456583 GGAGAGGTTGACCCCATCTAGGG + Exonic
1104308563 12:127633318-127633340 GGAGAGCTTGAAAATATCTCTGG + Intergenic
1104605464 12:130184496-130184518 GGAGAGGGGGGGCCCATCTCTGG - Intergenic
1106788416 13:33129948-33129970 GGGGTGGTTGAGGACATCTCTGG + Exonic
1108753511 13:53473171-53473193 GGAGAGGTGGATCATACCTCGGG - Intergenic
1110006061 13:70271789-70271811 GGAGAAGTAGAACACATCTAAGG + Intergenic
1113924763 13:113935266-113935288 GGAGAGGTGGAAAACAGCTCTGG + Intergenic
1115266508 14:31506278-31506300 GGAGAAGTTCAGCACAGCTAGGG + Intronic
1115701980 14:35962713-35962735 GGAGTGGTGGTGCACATCTGTGG - Intergenic
1116422020 14:44744320-44744342 GGAGAAGTTGAGCACAGCCATGG + Intergenic
1121206988 14:92177788-92177810 AGAGAGGCTGAGCATTTCTCTGG + Intergenic
1122217432 14:100213668-100213690 GGCGTGGTGGAGCACATCTGAGG - Intergenic
1122505840 14:102231215-102231237 GCAGAGGTTGTGCACATTTTCGG - Intronic
1122898314 14:104771502-104771524 GCAGAGGTTGAGCACTGCCCAGG + Intronic
1202830776 14_GL000009v2_random:26976-26998 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1124631665 15:31341224-31341246 GGACAGGCTGAGCCCATCTCTGG + Intronic
1125580258 15:40780210-40780232 GGTGAGGTTGAGCACTTAGCAGG - Intronic
1125594015 15:40873094-40873116 GGAGAGGGTGCGCACACCTTTGG + Exonic
1125741477 15:41967900-41967922 GGCGAGGTTCAGGAAATCTCTGG - Intronic
1128183619 15:65625720-65625742 GGTGAGGTTGAGGATCTCTCGGG - Exonic
1129170632 15:73805411-73805433 GTAGAGGCAGAGCCCATCTCAGG - Intergenic
1130103561 15:80912304-80912326 TGAGAGGTTGTCCACAGCTCTGG - Intronic
1131831928 15:96360009-96360031 GGAGAGGTGAAGCCGATCTCAGG + Intergenic
1132454616 16:15599-15621 GGAGGGGTCGACCACTTCTCTGG + Exonic
1134392908 16:13836238-13836260 GGAGAGCTTGAGAAGATCCCAGG + Intergenic
1135165188 16:20132944-20132966 GGAGAGGTTAAGCACATCACGGG + Intergenic
1139607096 16:68026979-68027001 GAAGAGGTTGAGCCCAATTCTGG - Intronic
1140388693 16:74565688-74565710 GGAAAGGTTGAGAACTACTCTGG - Intronic
1140506828 16:75478839-75478861 GGAGACGTTGAGCGCATTCCTGG + Exonic
1140917639 16:79508250-79508272 GGATTGGCTGAGCACCTCTCAGG + Intergenic
1141138307 16:81481032-81481054 GGAGAAGCTGTGCACACCTCAGG + Intronic
1141848880 16:86630530-86630552 GGAGAGGCTGCACACAGCTCTGG - Intergenic
1142153351 16:88522309-88522331 GGGGAGGTGGAGGACTTCTCAGG + Intronic
1143138121 17:4723525-4723547 GGAAAGGTGGAGCCCAACTCTGG - Intergenic
1144476484 17:15593477-15593499 GGACACGTCGAGCACCTCTCTGG + Exonic
1144790647 17:17856779-17856801 AGAGAGGGTCAGCTCATCTCAGG - Intronic
1146527152 17:33576847-33576869 GGAAAGGTATAGAACATCTCTGG + Intronic
1148790617 17:50170602-50170624 GGAGAGGGTTAGCCCAGCTCTGG - Intronic
1152241318 17:79162817-79162839 GGAGGGGTAGAGGACAGCTCAGG + Intronic
1153234899 18:2976624-2976646 AGAGAAATTGAGCACACCTCAGG - Intronic
1153785234 18:8528605-8528627 GGAGAGTTTGAGCTGATCTGGGG + Intergenic
1157780923 18:50438388-50438410 AGAGAGGATGTGGACATCTCAGG - Intergenic
1158997399 18:62936636-62936658 GCAGAGGTTGTGCCCTTCTCAGG - Intronic
1159359893 18:67386474-67386496 GGAGAGGTTGTGCACTTGTGGGG - Intergenic
1160622192 18:80179336-80179358 AGGGAGGATGAGCTCATCTCTGG + Intronic
1160832009 19:1108541-1108563 GGTGAGGTCCAGCACCTCTCCGG + Exonic
1161183411 19:2900560-2900582 GGAGAGGTTGGGCTCACCCCGGG + Intergenic
1161592570 19:5135438-5135460 CCAGAGGTGAAGCACATCTCAGG - Exonic
1161962158 19:7528915-7528937 CGAGATGGTGAGCACATCGCTGG - Exonic
1164313340 19:24065324-24065346 GGAGAGGATTATAACATCTCTGG + Intronic
1167245983 19:48373477-48373499 GGAGAGACTGAGCTCTTCTCTGG + Intronic
1202641917 1_KI270706v1_random:100800-100822 GGAAAGGGTGAGCACATGCCAGG + Intergenic
925280814 2:2683226-2683248 GGTGAGATTGAGAACATCTGGGG + Intergenic
927712982 2:25337045-25337067 GGAAATGCTCAGCACATCTCTGG + Intronic
931187280 2:59965541-59965563 GGAGAGGTGGAGAAGATATCTGG + Intergenic
932816649 2:74867100-74867122 GGAGGGGGTGAGCACATCGTTGG + Intronic
933830692 2:86205609-86205631 GAAGAGGAGGAGCACATTTCAGG - Intronic
935125834 2:100222025-100222047 GGAGAGGTGGAGCTCTCCTCTGG - Intergenic
935653314 2:105399768-105399790 GCACAGGTTGAGCCCATCCCTGG + Intronic
937565164 2:123276756-123276778 GGAAAGGTTGCAAACATCTCTGG - Intergenic
947758746 2:232588129-232588151 GCAGAGGCTGAGCTCATCTGTGG + Intergenic
948854251 2:240722705-240722727 GCTGAGGCTGAGCACAACTCCGG - Intronic
1170807996 20:19650517-19650539 AGAGATGTTGAGCAAATATCAGG - Intronic
1172798533 20:37560107-37560129 GGCGTGGTGGAGCACATCTGTGG - Intergenic
1174649152 20:52110131-52110153 GGATAGCTGGAGCACTTCTCAGG - Intronic
1176609963 21:8871814-8871836 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1176853810 21:13946275-13946297 GGAAAGGGTGAGCACATGCCAGG + Intergenic
1177472756 21:21580032-21580054 GGAGAGGTGGTGCACACCTGGGG + Intergenic
1178533306 21:33392876-33392898 GGTTAGGTTGTGGACATCTCTGG - Intergenic
1180360027 22:11881065-11881087 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1182217469 22:28731061-28731083 GGAGTGGTGGTGCACATCTGTGG + Intronic
951396375 3:22172554-22172576 AGAGAAGATGAGCACTTCTCAGG - Intronic
954702240 3:52456301-52456323 GGAGGGGTGGAGCCCATCTATGG + Intronic
955340188 3:58119227-58119249 GGAGAGGTTGAGAACACCCATGG + Intronic
955414596 3:58680425-58680447 GCAGACATTGAGCACATCTGGGG + Intergenic
959243275 3:103828575-103828597 GGGGAGGTTAAGCACATGTAGGG + Intergenic
959648270 3:108726733-108726755 GGGGAGGCCCAGCACATCTCAGG - Intergenic
967399275 3:189042569-189042591 GGAGAGGTTGTGTGGATCTCTGG + Intronic
967496888 3:190151546-190151568 GTAGAGGCTGAACACATATCTGG + Intergenic
1202736647 3_GL000221v1_random:6604-6626 GGAAAGGGTGAGCACATGCCAGG - Intergenic
968625043 4:1623241-1623263 GGGGAGCTTGGGCCCATCTCAGG - Intronic
972945291 4:44246828-44246850 TGAGATGTAGAGCACATATCTGG + Intronic
972979574 4:44678920-44678942 GGAGAGTGTGAGCACTGCTCAGG + Intronic
974465384 4:62248955-62248977 GGAAAGTTTGAGCTCATTTCTGG + Intergenic
980884050 4:138742932-138742954 GGATAGGCTGTGCCCATCTCAGG + Intergenic
982773488 4:159419610-159419632 GAATAGGTTCAGCACAACTCTGG - Intergenic
983132367 4:164037117-164037139 GTAGAGGTTGAGCAGTTCTGAGG + Intronic
983891272 4:173032861-173032883 GGATAGATTGTGCACATCACTGG + Intronic
1202769286 4_GL000008v2_random:186665-186687 GGAAAGGGTGAGCACATGCCAGG + Intergenic
986190673 5:5493998-5494020 GGGGAGGGTGAGCAGACCTCGGG - Intergenic
987904948 5:24064412-24064434 GGAGTGGTGGTGCACATCTGTGG - Intronic
990614498 5:57493628-57493650 GGAGATGCTGAGCACATCCCCGG + Intergenic
991667474 5:69013569-69013591 GGAGATTTTGAGCATATGTCAGG + Intergenic
998002898 5:138638886-138638908 GAAGAGGTAGAGCACCTCTAAGG + Intronic
1001090440 5:168736389-168736411 GGAGGGGTTGATCACATCTTTGG - Intronic
1002199137 5:177517280-177517302 GGAGAGGTTGGGCACCTGGCAGG - Exonic
1002668578 5:180846295-180846317 GGAGAGGATGGCCACAGCTCAGG - Intergenic
1003352500 6:5331351-5331373 GGAGCCGTGGATCACATCTCTGG + Intronic
1003454370 6:6267845-6267867 GCTGAGGTTGAGCACATAACAGG - Intronic
1003781050 6:9427240-9427262 GGTGAGGTTGAGCACAGAGCTGG + Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007214432 6:40226404-40226426 GCAAAGGTTGAGCACAGATCCGG + Intergenic
1007952647 6:45886054-45886076 GGAAAGGTTGAGCTCATTTGGGG - Intergenic
1009493938 6:64326891-64326913 GGGGAGCTTGATCACATCCCAGG + Intronic
1009834581 6:68982833-68982855 GGTGAGGCAGAGCACCTCTCGGG - Intronic
1011422197 6:87185248-87185270 GGAAAGGTTTAGCACATTTTTGG - Intronic
1014178972 6:118363324-118363346 GGAGAGATTGAGCATATTTATGG + Intergenic
1015200844 6:130578477-130578499 GGAGAGGTTGGTCATGTCTCAGG + Intergenic
1015322365 6:131890401-131890423 ACAGATGTTGAGCACATCACTGG + Exonic
1016972718 6:149779445-149779467 GGAGAGACTGAGCACAGTTCAGG - Intronic
1017817286 6:158025196-158025218 GGAGAGGTGCAGGAGATCTCTGG + Intronic
1018377704 6:163229213-163229235 GGAGAGGTGGTGCACACCTATGG + Intronic
1019738919 7:2663320-2663342 GGAGGGGATGAGGACATTTCCGG - Exonic
1022535587 7:31096291-31096313 GGGGAGGATGCACACATCTCTGG + Intronic
1022637485 7:32150555-32150577 TGAGAGATTAAGCACAGCTCAGG + Intronic
1026084929 7:67255084-67255106 GGAGAGCTTGAGTTCATTTCTGG + Intergenic
1026692245 7:72559836-72559858 GGAGAGCTTGAGTTCATTTCTGG - Intronic
1028846803 7:95490656-95490678 GGAGAGGATGTACACATTTCTGG - Intronic
1029309117 7:99644842-99644864 GGACAGGTTGAGGTCAGCTCAGG + Intergenic
1032295868 7:130638237-130638259 GGAGAGCTTGAGCACTGTTCTGG + Intronic
1034378242 7:150665432-150665454 TGAGTGGTGGAGCACATTTCAGG - Intergenic
1034401995 7:150868493-150868515 TGAGAGGCTGAGCAAATCTTCGG - Intergenic
1034539466 7:151747105-151747127 AGAGAGGGTGAGCAGAACTCGGG + Intronic
1037065038 8:14567032-14567054 GGAGAAATTGAGCACAGCCCCGG - Intronic
1038218305 8:25583572-25583594 GGAGAGGTTGAACACAATGCAGG + Intergenic
1038451370 8:27641384-27641406 GGAGGGGGTGAGCTCATCTTTGG + Intronic
1039888651 8:41669954-41669976 GGTGAGGGTGAGGACATCTCAGG - Intronic
1041464067 8:58141743-58141765 GGAGAGTTTGTGCAGAGCTCTGG + Intronic
1042378670 8:68086353-68086375 GGAGAGTTTGAGCAAAACTAAGG - Intronic
1042780774 8:72488954-72488976 GGAGAGGTTGTGCATATGTAGGG + Intergenic
1046696314 8:117343799-117343821 GGGAAGTTTGAGCACATCACTGG + Intergenic
1049713899 8:144080525-144080547 TAAGAGGGTGTGCACATCTCGGG - Exonic
1050188910 9:3004490-3004512 GGAGAGTCTCAGCACAGCTCTGG - Intergenic
1051196411 9:14566696-14566718 GGGGAGGTTGAGCACATCCAGGG - Intergenic
1053659394 9:40256212-40256234 GGAAAGGGTGAGCACATGCCAGG - Intronic
1053909766 9:42885575-42885597 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1054360427 9:64108974-64108996 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1054371521 9:64402513-64402535 GGAAAGGGTGAGCACATGCCAGG - Intronic
1054525204 9:66120005-66120027 GGAAAGGGTGAGCACATGCCAGG + Intronic
1054679142 9:67892228-67892250 GGAAAGGATGAGCACATGCCAGG - Intronic
1062353512 9:136151132-136151154 GGAGAGTGTGATCACAGCTCAGG - Intergenic
1203694174 Un_GL000214v1:80381-80403 GGAAAGGGTGAGCACATGCCAGG + Intergenic
1203705379 Un_KI270742v1:37044-37066 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1203558629 Un_KI270744v1:28761-28783 GGAAAGGGTGAGCACATGCCAGG + Intergenic
1203642099 Un_KI270751v1:23682-23704 GGAAAGGGTGAGCACATGCCAGG - Intergenic
1193216714 X:78873262-78873284 GAAGAGGTTGAGCATACTTCAGG + Intergenic
1194708808 X:97208010-97208032 GGCATGGTGGAGCACATCTCAGG + Intronic
1195476693 X:105294758-105294780 GTAGTTGTTGAGCACATTTCAGG + Intronic
1200077269 X:153557364-153557386 GCAGAGGAAGAGCACATCTGGGG - Intronic