ID: 1091788656

View in Genome Browser
Species Human (GRCh38)
Location 12:3258370-3258392
Sequence TCTGGGGCCCAGAATCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091788653_1091788656 -7 Left 1091788653 12:3258354-3258376 CCATCCAGGGATATATTCTGGGG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG 0: 1
1: 0
2: 3
3: 30
4: 220
1091788650_1091788656 -2 Left 1091788650 12:3258349-3258371 CCTTTCCATCCAGGGATATATTC 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG 0: 1
1: 0
2: 3
3: 30
4: 220
1091788647_1091788656 18 Left 1091788647 12:3258329-3258351 CCTGTGGGTCTAAGACATGTCCT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG 0: 1
1: 0
2: 3
3: 30
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091788656 Original CRISPR TCTGGGGCCCAGAATCACCT TGG Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
902736642 1:18405607-18405629 TCTGGGGACCAGACTGACCCAGG - Intergenic
902779762 1:18697474-18697496 TTTGAGGTCCAGAACCACCTAGG + Intronic
905493324 1:38362399-38362421 ACTGGAGACCACAATCACCTGGG + Intergenic
905668786 1:39778093-39778115 TCTGGGGCCCCGAAACACAGGGG - Intronic
905790810 1:40788257-40788279 TCTGGAGACCAAAGTCACCTGGG + Intronic
909665915 1:78133335-78133357 CCTGAGGACCAGCATCACCTGGG + Intronic
915909029 1:159900699-159900721 TCTGCAGCTAAGAATCACCTGGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916163643 1:161944344-161944366 TCTCAGGCCCAGAAACACCTGGG - Intronic
916553638 1:165874194-165874216 TCTGGGCTCCACAATCACCTGGG + Intronic
919615554 1:199804343-199804365 TATTGTGCCCAGAATCACCCAGG + Intergenic
920382162 1:205541466-205541488 TCTGCAGCCCAGGAACACCTAGG - Intergenic
920536342 1:206739105-206739127 TCTGGAACCCAGAATTACCTTGG + Intergenic
923001658 1:230011276-230011298 TCTGGTCACCAGAATCACCTAGG - Intergenic
924413741 1:243835268-243835290 TCTGGGGACCAAAATCACCCTGG + Intronic
924416297 1:243859991-243860013 CCTGGGGCCCAGTGTAACCTGGG + Intergenic
924676138 1:246179889-246179911 TCTGGGGCCCATGTTCACCCTGG + Intronic
1062927763 10:1329741-1329763 TCTGGAGCCGCGAACCACCTGGG + Intronic
1064388811 10:14923314-14923336 ACTGTGGATCAGAATCACCTGGG - Intronic
1065725830 10:28667273-28667295 CCTGGGGCCCAGCATTAGCTTGG - Intergenic
1070143934 10:73760115-73760137 TCTGGATCCCAGGATGACCTTGG - Exonic
1073321850 10:102620428-102620450 GCTGGGGCCCTGACTCTCCTGGG - Intronic
1073509339 10:104033683-104033705 TCTGGGACCCAGAACGAGCTAGG + Intronic
1073549026 10:104380379-104380401 AATGTGGCCCAGAATCAGCTCGG - Intronic
1074442036 10:113486503-113486525 GCTGGGCCACGGAATCACCTGGG - Intergenic
1075262106 10:120971977-120971999 CCTTGGGCCAAAAATCACCTGGG - Intergenic
1076203056 10:128573199-128573221 TCTGGGGCCTTGGATCCCCTGGG + Intergenic
1076590140 10:131577149-131577171 TCTGGGGCCCAGCCTCTCCAAGG - Intergenic
1076980254 11:200351-200373 TCTAGGGCCCAGGGTCAGCTTGG + Intronic
1078374889 11:10785537-10785559 GCTGAGGCCCAGAGTCACCGTGG + Intergenic
1080656537 11:34262987-34263009 TCTGGGGCCCATTATCTCCCTGG - Intronic
1080740983 11:35064134-35064156 TCTGGGGAGCAGAATACCCTGGG - Intergenic
1081575744 11:44317688-44317710 TCTGGGGGCCAGGAACTCCTTGG - Intergenic
1082954683 11:58857399-58857421 TCCAGGTCCCAGAATCACCCAGG - Intronic
1084212838 11:67631747-67631769 TCTGGAGCCCCGAGCCACCTAGG - Exonic
1084561371 11:69907349-69907371 TCTTGGGCTCAGAATCCCCCAGG - Intergenic
1084697048 11:70761970-70761992 GCTGGGGCTGAGAACCACCTGGG - Intronic
1086210762 11:84316106-84316128 TCTGGGGGCTAGAATAACCTAGG + Intronic
1087401090 11:97667499-97667521 CCTGGGGCCCAGAACCTCGTGGG + Intergenic
1088326637 11:108607821-108607843 TCTGAGGATCAGAATCACCTGGG + Intergenic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1089009277 11:115119497-115119519 TCAGGACCCCAGAATGACCTAGG - Intergenic
1091267559 11:134282659-134282681 GCTGGGGGCCAGAATCACAGAGG - Intronic
1091666313 12:2420887-2420909 TCTGGAGCCCCGAATGTCCTTGG + Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1094838462 12:34333168-34333190 TGAGAGGCCCAGAGTCACCTGGG - Intergenic
1095975673 12:47939434-47939456 TCTTGGGCCAAGGATCACCCTGG + Intronic
1097078861 12:56414667-56414689 TCTGGGGCTCTGTATCAACTTGG + Intergenic
1097130273 12:56806359-56806381 CTTGATGCCCAGAATCACCTGGG + Intergenic
1097797877 12:63883351-63883373 TCTGGGGCAAAGACTTACCTAGG - Intronic
1102203431 12:111074342-111074364 TCTTTGGCTCTGAATCACCTGGG - Intronic
1102349741 12:112183787-112183809 TCTGAAACTCAGAATCACCTGGG + Intronic
1102479099 12:113208634-113208656 CCTGGGGCCCAGGGTCACCCAGG + Intronic
1108934301 13:55866922-55866944 TCTGACCTCCAGAATCACCTGGG + Intergenic
1109030433 13:57182312-57182334 TTTGAGTTCCAGAATCACCTGGG + Intergenic
1110260127 13:73475320-73475342 CCTGGGGCCCAAGATCCCCTGGG - Intergenic
1112033557 13:95477697-95477719 TCTGTGGACCAGCAGCACCTGGG + Intronic
1112182168 13:97094324-97094346 CCTGGGGAACAAAATCACCTTGG + Intergenic
1112200529 13:97269597-97269619 TCTGGGGCCAACAGTCACCCTGG - Intronic
1113427081 13:110217136-110217158 TCTGGTTCCCATAATAACCTTGG - Intronic
1113804254 13:113104186-113104208 TCTGGGCAGCAGAATGACCTGGG - Intergenic
1113853462 13:113431079-113431101 TCTGAGGCCCACAGCCACCTAGG + Intronic
1116859017 14:49978975-49978997 TCTGGGGCACAGCACCCCCTTGG + Intergenic
1119327830 14:73772047-73772069 TCTGGGGCCCTGAGCCAGCTGGG + Intronic
1121177987 14:91905478-91905500 TCTGGAGCCCAAAACCTCCTAGG + Intronic
1122375989 14:101257701-101257723 CCTGGGGTCCTGAACCACCTAGG + Intergenic
1122899736 14:104777485-104777507 TCTGGGGCACACGAACACCTGGG + Intronic
1123721394 15:23064658-23064680 TCAGTGGACCAGAAACACCTTGG + Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1124717930 15:32084070-32084092 ACTGGTGTCCAGAAACACCTTGG - Intronic
1126012348 15:44315147-44315169 GCTGATGCTCAGAATCACCTGGG - Intronic
1126210416 15:46094983-46095005 TCTGGGGAAGAGAATGACCTTGG + Intergenic
1128344483 15:66844852-66844874 GCTGGGGCCCAGATCCACATTGG + Intergenic
1130710461 15:86275735-86275757 TCTGGGGTCAAAAATGACCTGGG - Intronic
1132366161 15:101258589-101258611 TCTGGGTATCAGAATCATCTTGG - Intergenic
1133557392 16:6918385-6918407 AGTGGGCCCCAGAATCACCCGGG - Intronic
1134027590 16:10966098-10966120 TCTGGGTATCAGAATCACCTGGG + Intronic
1134172227 16:11977307-11977329 TCTGGGGACCAGAAGCTCCTGGG - Intronic
1137365410 16:47855594-47855616 TCTGGGACCCAGAATCAGCTGGG + Intergenic
1137409528 16:48216072-48216094 TCTGGGGCCCAGCATCAAATGGG + Intronic
1137850575 16:51738008-51738030 ACTGTGCACCAGAATCACCTAGG + Intergenic
1138029215 16:53546498-53546520 TCTGATGCCAAGAAGCACCTGGG - Intergenic
1138429957 16:56962350-56962372 TCTGAGACCCAGAATCACTGGGG + Intronic
1140030819 16:71337853-71337875 ACTGCTGCTCAGAATCACCTGGG - Intergenic
1141962810 16:87420860-87420882 TCTGGGGCCCACATCCACTTAGG + Intronic
1143185713 17:5008785-5008807 TCTGGGACCCAGCCACACCTAGG + Intronic
1143197014 17:5083589-5083611 GCTGGGCATCAGAATCACCTAGG + Intronic
1143201954 17:5119505-5119527 GCTGGGGCCCAGAAACCCCCTGG + Intronic
1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG + Intergenic
1144627464 17:16851652-16851674 GCTGGGGCCCAGAACCTCCCTGG - Intergenic
1144678935 17:17180084-17180106 GCTGGACCCCAGACTCACCTTGG - Exonic
1144853759 17:18257237-18257259 CCTGGGGCCCAGAATCCAGTAGG - Intronic
1144878977 17:18421067-18421089 GCTGGGGCCCAGAACCTCCCTGG + Intergenic
1145153259 17:20523327-20523349 GCTGGGGCCCAGAACCTCCCTGG - Intergenic
1145902857 17:28499301-28499323 TCTGGGGCCAAGCCTCCCCTAGG + Intronic
1146529889 17:33599495-33599517 TCTGGGGCTCAGAACTACCGGGG + Intronic
1147573310 17:41584765-41584787 GCTGTGGACCAGAATCACCCAGG + Intronic
1147581592 17:41630346-41630368 GCTGGGGCCCAGAACCTCCCTGG - Intergenic
1148478254 17:47943028-47943050 TCTGTGCATCAGAATCACCTGGG - Intronic
1148736907 17:49870061-49870083 TCTGGGGCCTGGAATCCCATGGG - Intergenic
1150576778 17:66437680-66437702 TGTGGGTCCCAGAAGCAACTGGG + Intronic
1151398143 17:73838664-73838686 TCCAGGGCCCAGATTCACCTGGG - Intergenic
1151444443 17:74153962-74153984 GCTGAGGCCCAGCATCACCCGGG + Intergenic
1156458080 18:37305939-37305961 CCTGAGGCCGAGAATCACGTTGG + Intronic
1157676752 18:49574186-49574208 TCTGGTTCCCATAATCACTTGGG + Intronic
1158694944 18:59696076-59696098 TGTGGGCCACAGATTCACCTGGG - Intronic
1159394618 18:67839410-67839432 TCTGGGGCCCTAAATAAACTTGG - Intergenic
1159623876 18:70669695-70669717 TCTGAGGCCCATAAACACCCTGG + Intergenic
1160048212 18:75407248-75407270 TCTGGGGGCCTGATTCAGCTTGG + Intronic
1160604382 18:80038324-80038346 TCTGGGGCCCTACTTCACCTGGG + Intronic
1161221096 19:3118631-3118653 GCTGGCGCCCAGAATCCTCTGGG + Intronic
1161854157 19:6754018-6754040 TCTGGGGCTTAGCATCCCCTGGG - Intronic
1161894503 19:7069955-7069977 CCTGGGGCGCAGAATCGCCCCGG - Intronic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162376653 19:10309185-10309207 TCTGGTGCCCAGAGACACTTGGG - Exonic
1163115401 19:15185854-15185876 TTTGGGGACCAGAATGATCTGGG - Intronic
1163175766 19:15563358-15563380 TTGGGGTCCCAGAGTCACCTTGG + Intergenic
1163356604 19:16816210-16816232 ACTGTAGCCCAGAATCACCATGG + Exonic
1164883684 19:31759304-31759326 GCTGAGGGTCAGAATCACCTGGG - Intergenic
1164931483 19:32179256-32179278 TCTGGGGCTCTTACTCACCTTGG + Intergenic
1165247289 19:34504935-34504957 TGTGGGGCCCAGGAGAACCTTGG + Exonic
1165712875 19:38024545-38024567 TCTGGGGCCCAGGGCCAGCTGGG - Intronic
1165733634 19:38162367-38162389 GGTGGGGCCCAGACTCACTTTGG - Exonic
1165793986 19:38507878-38507900 TCTGCAGACCAGACTCACCTAGG + Intronic
925151452 2:1618109-1618131 CCCGGGCCTCAGAATCACCTGGG + Intergenic
926775371 2:16416958-16416980 TCTGGATCCCAGAATTACCAAGG + Intergenic
927677160 2:25114584-25114606 TCTGGGGCCCAGGACTGCCTAGG - Intronic
927812445 2:26187573-26187595 TTCTGGGCCCAGAACCACCTCGG + Exonic
928458786 2:31450367-31450389 TCTGGGGCCCTAAATTAACTTGG + Intergenic
933777842 2:85781963-85781985 TCTTGGCCCCAGAGTCAGCTGGG - Intronic
933919100 2:87026753-87026775 TCTGAGGTCCAGACTCACCATGG + Intergenic
934003894 2:87743154-87743176 TCTGAGGTCCAGACTCACCATGG - Intergenic
934572816 2:95383191-95383213 GCTGGGGCACAGACTCACTTTGG + Intronic
936156072 2:110048206-110048228 TCTGGTGCCCAGAGCCACCAGGG - Intergenic
936188616 2:110323222-110323244 TCTGGTGCCCAGAGCCACCAGGG + Intergenic
936514746 2:113174483-113174505 TCTAGGGTCGAGAATCACTTGGG - Intronic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
937001814 2:118474526-118474548 TCTGTGGTCCTGAATCACATAGG - Intergenic
946673431 2:222131134-222131156 TCTGGGGCACAAAATCAGCCCGG - Intergenic
947523467 2:230865228-230865250 TCTGGGGCCCTGACGCGCCTCGG - Intronic
1169572966 20:6926645-6926667 TCTGGTGCTCAGGATCACCCAGG - Intergenic
1170215377 20:13885613-13885635 TCTGGGGTACAGAAACACCCAGG + Intronic
1170914806 20:20612574-20612596 TCTGGGGACCAAAATCAAATGGG - Intronic
1171048108 20:21830007-21830029 GCTGGGGGACAGAATCACCAGGG + Intergenic
1171395283 20:24829183-24829205 TCTGGGGCCCTGCATCACCTGGG - Intergenic
1174163384 20:48567516-48567538 TCTGGGGCCCTGAAGCAGGTGGG - Intergenic
1174261626 20:49300190-49300212 TCTGTGGCCCAGGATGATCTCGG + Intergenic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175496531 20:59418346-59418368 TCTAGAACCCAGAGTCACCTTGG - Intergenic
1177151295 21:17457843-17457865 TCTGGGGGGCAAAATCACCCAGG + Intergenic
1178132416 21:29588876-29588898 TATGGGGCCCAGAATGACAAAGG - Exonic
1180007138 21:45028022-45028044 CCTGGGCCCCAGAAGCCCCTGGG + Intergenic
1180957051 22:19745872-19745894 CCTGGGGCTCAGCATCCCCTCGG - Intergenic
1183584691 22:38746138-38746160 TCTGGTCGTCAGAATCACCTGGG + Intronic
1184879470 22:47295784-47295806 ACTCGGGCCCAGAGTCACATGGG + Intergenic
1185139277 22:49091388-49091410 TCTGAAGCCCACATTCACCTGGG + Intergenic
950640569 3:14345765-14345787 CCTGGGGCCCAGACTGACCTTGG - Intergenic
951165332 3:19478896-19478918 CCTAGGTCCCTGAATCACCTAGG + Intronic
953461668 3:43086130-43086152 TTTGTACCCCAGAATCACCTGGG - Intronic
955479459 3:59374700-59374722 TCTGTTGCCCAGCATCACCAAGG + Intergenic
959498043 3:107073924-107073946 TCAAGAGCCCAGAAGCACCTGGG + Intergenic
961398572 3:126616585-126616607 TCTGGGGCCCAGCAGCACAGTGG - Intronic
961779487 3:129313414-129313436 TCTGAACCCCAGAACCACCTGGG + Intergenic
962547857 3:136455529-136455551 CCTGGAGGCCAGAAACACCTGGG + Intronic
962910542 3:139845326-139845348 TCTGTGGCCTAGAGTCACCTGGG + Intergenic
963735335 3:149012265-149012287 TCTTGGGTTCAGAATAACCTTGG + Intronic
965063764 3:163816726-163816748 TCAGGAGCTCAGAATCAGCTTGG + Intergenic
965353615 3:167646345-167646367 TCTGGGGCCAAGGATCAGTTTGG + Intronic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
966649900 3:182288501-182288523 TCTGAGGTCTAAAATCACCTCGG - Intergenic
968890820 4:3367553-3367575 GCTGGGGCCCAGAATCTTCTGGG + Intronic
969322093 4:6418514-6418536 GCTGGGGCCGAGGTTCACCTGGG - Intronic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
972680792 4:41305113-41305135 TCTGAGGGCCAGACTCAGCTGGG + Intergenic
975733029 4:77356179-77356201 TGTGGGGCCCAGAAGTGCCTTGG + Intronic
980719057 4:136669253-136669275 TTTGGGGGCCAAAATCACCCAGG - Intergenic
981006414 4:139879752-139879774 TATGGGCCTAAGAATCACCTGGG - Intronic
982073209 4:151713816-151713838 TCTTGGACCCAGACACACCTGGG + Intronic
983289936 4:165789440-165789462 TCTGGAGCTCAGAAGGACCTTGG + Intergenic
985614483 5:911213-911235 TCTGGTGCCCACCACCACCTGGG - Intronic
987158531 5:15115492-15115514 TCTGGGAACCAGCATCCCCTCGG - Intergenic
989610076 5:43282406-43282428 ACTGGGGCCCAGTAGCACATCGG + Intergenic
990834456 5:60001003-60001025 TCTGGGGACAAGATTGACCTTGG - Intronic
996741131 5:126800005-126800027 TTTGGGTCTCAGAATAACCTGGG + Intronic
998087590 5:139339446-139339468 TCAGGGGCCCAGTATTTCCTTGG - Intergenic
998428362 5:142049045-142049067 TCTGTGCCCCTGAATCCCCTTGG - Intergenic
999681556 5:154064974-154064996 TCTGGAGGCCAGAATCTTCTGGG + Intronic
1000944932 5:167410334-167410356 TATGGTGCTCAGAATCATCTTGG + Intronic
1002427446 5:179184694-179184716 CCTGGGACCCAGAATGGCCTGGG + Intronic
1003193468 6:3894137-3894159 TCTGGGGCCCAGCATTCCCCAGG + Intergenic
1004806027 6:19204954-19204976 CCAGTGGCCCAGAAGCACCTTGG - Intergenic
1007207897 6:40167429-40167451 TCTAGGGCTCACCATCACCTGGG + Intergenic
1007370950 6:41426917-41426939 TCTGGGGGCCAGCAGCCCCTTGG + Intergenic
1007506339 6:42338035-42338057 TCACGTGCCCACAATCACCTGGG - Intronic
1010296830 6:74208114-74208136 ACTGGGGCACAGACTCACCTTGG - Intergenic
1012160465 6:95878786-95878808 TCTGGTGACCAGCATCTCCTGGG + Intergenic
1012887543 6:104862264-104862286 TCTGGGCCACAGAAGAACCTGGG - Intergenic
1014972530 6:127835256-127835278 TCTACTGCCCAAAATCACCTAGG - Intronic
1015513708 6:134064202-134064224 TCTAGGGCCCAAACACACCTGGG - Intergenic
1018127681 6:160697315-160697337 TCTGAGGTCCAGACTCACCATGG - Intergenic
1018630088 6:165814929-165814951 TCTGGGGCCAGGGATCATCTGGG - Intronic
1018926571 6:168211019-168211041 TCTGGGGCACAGAGTCACTCGGG - Intergenic
1019406071 7:884721-884743 ACTGAGGACCAGAATGACCTTGG - Intronic
1024095207 7:45977365-45977387 TCTGGTGCCCAGAAAGACATGGG + Intergenic
1026365031 7:69639695-69639717 TCAGAGGCACAGAATGACCTGGG - Intronic
1026504167 7:70968130-70968152 TCTGTGCATCAGAATCACCTGGG - Intergenic
1030623132 7:111814330-111814352 CCCGGGCCCTAGAATCACCTGGG + Intronic
1032056939 7:128691231-128691253 TCTGTGCCCCAGAATTCCCTTGG + Intergenic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1034232940 7:149546903-149546925 TCTGAGAACCAGAATGACCTGGG + Intergenic
1034938832 7:155217028-155217050 CCTGGTGCTCAGAATCCCCTGGG - Intergenic
1035457867 7:159021110-159021132 TCTGAGGCCCATAAACACCCTGG - Intergenic
1037892983 8:22633692-22633714 TGTGGGCCTCAGCATCACCTGGG + Intronic
1038199158 8:25395724-25395746 GCTTGGTCCCAGAATCCCCTAGG + Intronic
1045712020 8:104995955-104995977 TCTTCGGCCCAGCCTCACCTGGG + Intronic
1047246572 8:123150586-123150608 GCTGGGGCCCAGAATTCCATCGG - Intronic
1047697658 8:127418850-127418872 TCTGGGATCCAGAATCACTTGGG - Exonic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1050139829 9:2505877-2505899 TCTGGGGGGCAAAATCACCCTGG + Intergenic
1053573291 9:39331937-39331959 TCTGGAGACCAGAATGACCTAGG + Intergenic
1053624648 9:39856169-39856191 TCTGGAGACCAGAATGACCTAGG + Intergenic
1053880222 9:42587059-42587081 TCTGGAGACCAGAATGACCTAGG - Intergenic
1053892442 9:42707267-42707289 TCTGGAGACCAGAATGACCTAGG + Intergenic
1054094861 9:60890643-60890665 TCTGGAGACCAGAATGACCTAGG + Intergenic
1054116328 9:61166547-61166569 TCTGGAGACCAGAATGACCTAGG + Intergenic
1054123853 9:61287074-61287096 TCTGGAGACCAGAATGACCTAGG - Intergenic
1054219248 9:62394529-62394551 TCTGGAGACCAGAATGACCTAGG - Intergenic
1054231466 9:62514644-62514666 TCTGGAGACCAGAATGACCTAGG + Intergenic
1054591432 9:67015997-67016019 TCTGGAGACCAGAATGACCTAGG - Intergenic
1055465193 9:76558637-76558659 TCTGGAGCCCAGAACAAACTTGG - Intergenic
1056103755 9:83326560-83326582 CCTGAGGCCCAGACTCACCAAGG + Intronic
1056167301 9:83951823-83951845 GCTGTGCCCCAGAATCACTTAGG - Intronic
1057813984 9:98280307-98280329 CCTGAGGCCCAGAATCTCCCAGG + Intergenic
1060211969 9:121716109-121716131 AGTGGGTCTCAGAATCACCTGGG - Intronic
1186485638 X:9932497-9932519 TCTGTGGCCCTGTATCTCCTGGG - Exonic
1186640020 X:11445657-11445679 TCTGGGAGGCAGAATCACCCTGG - Intronic
1186898469 X:14029410-14029432 TCGGCACCCCAGAATCACCTGGG + Intronic
1190839865 X:54133922-54133944 TGTGGGGCTCACCATCACCTAGG + Exonic
1192249910 X:69403397-69403419 TCTGTGGCCCAAAATAACCAAGG - Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1192801137 X:74465828-74465850 TATGGGGACCAGAAGCCCCTGGG + Intronic
1193701062 X:84761746-84761768 TCTAGGGTCCAGAATCCCATTGG + Intergenic
1195526560 X:105897599-105897621 TTAGGGGCCAAGAATTACCTAGG - Intronic
1196818673 X:119685788-119685810 TCTGTGGGCCAGAACCACCTTGG - Intronic
1199053927 X:143270120-143270142 TATGGTCCACAGAATCACCTAGG + Intergenic
1199570495 X:149262521-149262543 TCTGGGATCCACAATCACCTTGG + Intergenic
1199847332 X:151700801-151700823 ACTGGGCCCCAGCACCACCTGGG - Exonic
1200077238 X:153557232-153557254 TCTGGGGCCCACTGTCACCTTGG - Intronic
1200767238 Y:7090448-7090470 TCAGAGGTGCAGAATCACCTTGG - Intronic
1202161190 Y:21938564-21938586 TCTGGGGCCATAAATAACCTCGG - Intergenic
1202230166 Y:22647809-22647831 TCTGGGGCCATAAATAACCTCGG + Intergenic
1202312990 Y:23548356-23548378 TCTGGGGCCATAAATAACCTCGG - Intergenic
1202557812 Y:26122238-26122260 TCTGGGGCCATAAATAACCTCGG + Intergenic