ID: 1091789051

View in Genome Browser
Species Human (GRCh38)
Location 12:3260823-3260845
Sequence GGGGCTGATGCCTCTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 461}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091789051_1091789062 10 Left 1091789051 12:3260823-3260845 CCCAGAGTAGAGGCATCAGCCCC 0: 1
1: 0
2: 2
3: 28
4: 461
Right 1091789062 12:3260856-3260878 GGTGTGTTCCCAGAGGGATGAGG 0: 1
1: 0
2: 0
3: 19
4: 224
1091789051_1091789065 25 Left 1091789051 12:3260823-3260845 CCCAGAGTAGAGGCATCAGCCCC 0: 1
1: 0
2: 2
3: 28
4: 461
Right 1091789065 12:3260871-3260893 GGATGAGGACCCTAGATTGCAGG 0: 1
1: 0
2: 1
3: 3
4: 80
1091789051_1091789061 4 Left 1091789051 12:3260823-3260845 CCCAGAGTAGAGGCATCAGCCCC 0: 1
1: 0
2: 2
3: 28
4: 461
Right 1091789061 12:3260850-3260872 ACAGGGGGTGTGTTCCCAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1091789051_1091789060 3 Left 1091789051 12:3260823-3260845 CCCAGAGTAGAGGCATCAGCCCC 0: 1
1: 0
2: 2
3: 28
4: 461
Right 1091789060 12:3260849-3260871 GACAGGGGGTGTGTTCCCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091789051 Original CRISPR GGGGCTGATGCCTCTACTCT GGG (reversed) Intronic
900243756 1:1628563-1628585 GGGGCTGGTGCCGCTACTGGTGG + Exonic
902017220 1:13318354-13318376 GAGAGTGATGCCTCTTCTCTGGG + Intronic
902193774 1:14782810-14782832 TGGGGGGATGCCTCTACCCTGGG - Intronic
902603341 1:17554857-17554879 GTGGCTCATGCCTCTAATCCAGG - Intronic
902860011 1:19238485-19238507 GGGGCTCATGCCTCTGCTACAGG + Intronic
903062421 1:20679041-20679063 GTGGCTGATGCCTGTAATCCCGG + Intronic
903302490 1:22389434-22389456 GGGGCTGGAGCCGCTTCTCTGGG + Intergenic
903313899 1:22485270-22485292 GGGGCTGTTGCTTCCACTTTGGG + Intronic
903633057 1:24791605-24791627 GTGGCTCATGCCTGTAATCTGGG + Intronic
903648115 1:24906819-24906841 GGGGCGGATGCCTCCACCCAGGG - Intronic
904773955 1:32895519-32895541 GGGCCTGGTGCCCCTACTCCAGG + Intronic
905198691 1:36301578-36301600 GGGGCAGAGGCAACTACTCTGGG + Exonic
907224580 1:52933316-52933338 GTGGCTCATGCCTGTAATCTTGG + Intronic
907686494 1:56616812-56616834 GTGGCTCATGCCTATAATCTCGG - Intronic
914778451 1:150760617-150760639 GTGGCTCATGCCTGTACTTTGGG + Intronic
915078962 1:153338184-153338206 TGGGCTGATGCCTGTATTCCTGG - Intronic
915083326 1:153366960-153366982 GGTCCTCATGCTTCTACTCTGGG - Intergenic
915209326 1:154295895-154295917 GTGGCTCATGCCTGTAATCTCGG + Intergenic
915773223 1:158453275-158453297 GTGGCTCATGCCTATAATCTGGG + Intergenic
917020144 1:170577753-170577775 GTGGCTCATGCCTGTAATCTCGG - Intergenic
919195738 1:194283443-194283465 GTGGCTCATGCCTGTAATCTTGG + Intergenic
919655792 1:200196112-200196134 GTGGCTCATGCCTATAATCTCGG + Intergenic
920154862 1:203940248-203940270 GTGGCTCATGCCTGTAATCTCGG + Intergenic
920316387 1:205078397-205078419 GAGGCTGCTGCCTCTACTCTTGG + Exonic
920695331 1:208177738-208177760 GGGGCAGATGCTGCTGCTCTGGG - Intronic
921376448 1:214479075-214479097 GTGGCTCATGCCTGTAATCTTGG + Intronic
921442031 1:215199046-215199068 GTGGCTCATGCCTGTACTTTGGG + Intronic
922316199 1:224444614-224444636 GTGGCTCATGCCTGTAATCTCGG - Intronic
922529340 1:226331539-226331561 GTGGCTCATGCCTGTAATCTTGG + Intergenic
923131858 1:231082053-231082075 GTGGCTCATGCCTGTAATCTCGG - Intergenic
924104918 1:240640194-240640216 GGGGGTGATGCCCCTAGTTTTGG + Intergenic
1065224071 10:23524904-23524926 GTGGCTCATGCCTATAATCTCGG - Intergenic
1065452940 10:25877868-25877890 GAGGCTCATGCCTATAGTCTTGG + Intergenic
1065541502 10:26773466-26773488 GTGGCTCATGCCTGTAATCTTGG - Intronic
1065828870 10:29596581-29596603 GGGGATGATGCCACAACTCAGGG + Intronic
1066574660 10:36812360-36812382 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1068589053 10:58834805-58834827 GTGGCTCATGCCTCTAATCTTGG + Intergenic
1069548330 10:69344671-69344693 GGGGCTGATACCACTCCTCTGGG - Intronic
1069729698 10:70602703-70602725 GGGGCTGATGCCACCATTCCAGG - Exonic
1069756995 10:70779538-70779560 GGGGCTCATGCCTCTCCCCAAGG - Intronic
1070867009 10:79712763-79712785 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1070880799 10:79850884-79850906 GGGGCTGCTGCCTCTGTCCTCGG + Intergenic
1071162448 10:82764642-82764664 GTGGCTCATGCCTGTACTTTGGG - Intronic
1071633921 10:87234986-87235008 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1071647371 10:87367203-87367225 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1072079335 10:92012500-92012522 GTGGCTCATGCCTGTAATCTCGG + Intronic
1072639007 10:97196735-97196757 GGGGCAGCTGCTTCTCCTCTAGG - Intronic
1073486479 10:103822157-103822179 GTGGCTCATGCCTGTAATCTCGG - Intronic
1075326065 10:121533118-121533140 GTGGCTCATGCCTGTAATCTTGG + Intronic
1077196705 11:1284615-1284637 GGGGCTCATGCCTCTAATCCCGG - Intronic
1077889557 11:6409213-6409235 GTGGCTGATGCCTCCACTCCCGG + Intronic
1078320934 11:10333975-10333997 GAAGCTGATGCCTCTTCTGTTGG + Intronic
1080536864 11:33230438-33230460 GTGGCTCATGCCTCTAATCCTGG + Intergenic
1080864406 11:36180574-36180596 GGGACTTTTGCCTCTACTCTGGG + Intronic
1081057017 11:38422417-38422439 GTGGCTTATGCCTGTAATCTTGG + Intergenic
1081829373 11:46094621-46094643 GTGGCTCATGCCTGCACTCTGGG + Intronic
1082044321 11:47712769-47712791 GTGGCTCATGCCTGTAATCTTGG + Intronic
1083157540 11:60833925-60833947 GTGGCTCATGCCTATAATCTTGG + Intergenic
1083250316 11:61462667-61462689 GTGGCTCATGCCTGTAATCTTGG - Intronic
1083488082 11:62996003-62996025 GGGGCTGAGGACTATAGTCTGGG - Intronic
1083765470 11:64839380-64839402 GGGCCTGATGCCTCTGCACTAGG + Intronic
1083909594 11:65698458-65698480 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1084000538 11:66293253-66293275 GGGGGTGGTTCCTCTCCTCTTGG + Intronic
1084308187 11:68300158-68300180 GTGGCTCATGCCTGTACTTTGGG - Intergenic
1084407502 11:68984042-68984064 GTGGCTCATGCCTGTAATCTGGG - Intergenic
1084456998 11:69273682-69273704 AGGGCTGAAGCCACTGCTCTGGG + Intergenic
1084577805 11:70001272-70001294 GAGGCAGAGGCCTCTACTCATGG + Intergenic
1084974558 11:72789711-72789733 GGGGCTGAAGGCTCTGCCCTGGG + Intronic
1085696912 11:78712825-78712847 GGGGATGATGCCCCTATTTTGGG + Intronic
1087855230 11:103084719-103084741 GTGGCTCATGCCTGTAATCTTGG + Intronic
1088339662 11:108748930-108748952 GTGGCTCATGCCTGTAATCTTGG - Intronic
1088753112 11:112862501-112862523 GGAGCTGATGCTACTGCTCTAGG - Intergenic
1089459141 11:118642483-118642505 TGGGCTGACGCCTCCACTCAAGG - Intronic
1090237426 11:125159862-125159884 GGGGATGAAGCCTGTCCTCTGGG - Intergenic
1091789051 12:3260823-3260845 GGGGCTGATGCCTCTACTCTGGG - Intronic
1092953335 12:13527683-13527705 GGGGCTGCTGCCTCTGGTGTGGG - Intergenic
1093923658 12:24888238-24888260 GTGGCTCATGCCTGTAATCTCGG + Intronic
1093947079 12:25121199-25121221 GATGCTGATGCCTCTGCTCGAGG + Intronic
1094094172 12:26685325-26685347 GTGGCTCATGCCTGTAATCTCGG + Intronic
1094223922 12:28025019-28025041 GTGGCTCATGCCTCTAATCCTGG - Intergenic
1094787489 12:33865438-33865460 GTGGCAAATGCCTGTACTCTTGG + Intergenic
1094853354 12:34392174-34392196 GCGGCTGATGTCTCTCCCCTTGG + Intergenic
1096638145 12:52974243-52974265 GTGGCTCATGCCTGTACTTTGGG + Intergenic
1096737691 12:53668748-53668770 GGGGCTCATGCCTGTAATCCTGG + Intronic
1097419092 12:59351888-59351910 GTGGCTTATGCCTCTAATCCTGG + Intergenic
1098261398 12:68675602-68675624 GGGGCTGTCTCCTCTTCTCTAGG + Intergenic
1098903014 12:76132265-76132287 GTGGCTCATGCCTATAATCTTGG + Intergenic
1100308205 12:93370771-93370793 GGGGCTGAGCCCTCAACTGTGGG - Intergenic
1100651113 12:96590013-96590035 GTGGCTTATGCCTGTAATCTCGG - Intronic
1100694612 12:97078391-97078413 GTGGCTTATGCCTTTAATCTTGG - Intergenic
1101095037 12:101329742-101329764 GAGGCTGATGCCACCACTTTGGG + Intronic
1101135813 12:101741966-101741988 GTGGCTCATGCCTGTAATCTCGG + Intronic
1101579887 12:106033081-106033103 GCGGCTGATGCCTCTTAGCTGGG - Intergenic
1102448007 12:113018497-113018519 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1102468571 12:113145468-113145490 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1102845807 12:116181186-116181208 GTGGCTCATGCCTGTACTTTGGG - Intronic
1103267892 12:119646325-119646347 GTGGCTCATGCCTTTAATCTTGG - Intergenic
1103274563 12:119700862-119700884 GTCGCTGATGCCCCTGCTCTTGG - Exonic
1103395285 12:120602293-120602315 GTGGCTCATGCCTGTAATCTGGG + Intergenic
1103593551 12:122009324-122009346 GGGGCTGATGCCTCACGCCTGGG - Intergenic
1104024525 12:125016072-125016094 GCTGCCGATGCCTCTATTCTGGG - Intronic
1104919286 12:132282197-132282219 GGAGCTGATTCCTCTTCTGTGGG - Intronic
1105385807 13:19928526-19928548 GGGGCTCATGCCTGTAATCCTGG + Intergenic
1105661412 13:22499399-22499421 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1107486059 13:40828582-40828604 GTGGCTCATGCCTATAATCTTGG + Intergenic
1108393493 13:49971176-49971198 GTGGCTCACGCCTTTACTCTGGG - Intergenic
1108394554 13:49979853-49979875 GGGGCTCATGCCTGTAATCCTGG + Intergenic
1109277860 13:60322264-60322286 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1109308206 13:60663270-60663292 GTGGATGCAGCCTCTACTCTGGG - Intergenic
1109952476 13:69516536-69516558 GGTGCTGATGCCTCTACAAAGGG + Intergenic
1110218436 13:73048427-73048449 GTGGCTCATGCCTGTAATCTAGG - Intergenic
1113515838 13:110897390-110897412 GTGGCTCATGCCTCTAATCTCGG - Intronic
1114381157 14:22205633-22205655 GGGGCTCATGCCTGTAATCTTGG + Intergenic
1114510396 14:23254660-23254682 GTGGCTCATGCCTGTAATCTTGG - Intronic
1115176107 14:30563132-30563154 GGGGCTGGTCCCTACACTCTTGG + Intronic
1115586320 14:34817317-34817339 GTGGCTCATGCCTGTAATCTCGG + Intronic
1117145559 14:52833817-52833839 GGGGCTCATGCCTGTAATCCCGG - Intergenic
1117361593 14:54980541-54980563 GTGGCTCATGCCTGTACTTTGGG + Intronic
1118073777 14:62276274-62276296 GGGGCTTTTGCCGCTTCTCTGGG - Intergenic
1118246601 14:64116682-64116704 GTGGCTCATGCCTGTAATCTCGG - Intronic
1118353695 14:64993086-64993108 GTGGCTCATGCCTGTACTTTGGG - Intronic
1119351246 14:73967536-73967558 GTGGCTCATGCCTGTACTCCTGG + Intronic
1121041404 14:90751945-90751967 GGGGCCAATGCATCTGCTCTGGG + Intronic
1121138527 14:91520548-91520570 GGGGCTCATACCTGTAATCTTGG - Intergenic
1121172328 14:91865037-91865059 GGGGCTCATGCCTGTAATCTGGG - Intronic
1122402353 14:101474954-101474976 GGGGCTGATGCCTCTGCAGTGGG + Intergenic
1122451887 14:101815590-101815612 CTAACTGATGCCTCTACTCTAGG - Intronic
1122755416 14:103974871-103974893 GTGGCTCATGCCTGTAATCTTGG - Intronic
1123009487 14:105340874-105340896 GGGCCTGCTGCCTCTGCTCAGGG + Intronic
1123760383 15:23427447-23427469 GTGGCTCATGCCTGTAGTCTCGG - Intergenic
1123846894 15:24312211-24312233 GTGGCTCATGCCTATACTTTGGG + Intergenic
1124502376 15:30240305-30240327 GTGGCTGATGCCTGTAATCCCGG - Intergenic
1124741187 15:32298344-32298366 GTGGCTGATGCCTGTAATCCCGG + Intergenic
1124889161 15:33715993-33716015 GGGGCAGATGCCTCTTGGCTTGG + Intronic
1124949388 15:34302680-34302702 GTGGCTCATGCCTATAATCTTGG + Intronic
1125214493 15:37254791-37254813 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1127119173 15:55756584-55756606 GTGGCTCATGCCTGTACTTTGGG - Intergenic
1127504766 15:59587742-59587764 GTGGCTCATGCCTGTAATCTTGG + Intergenic
1127955947 15:63853709-63853731 GTGGTTCATGCCTGTACTCTAGG + Intergenic
1127991222 15:64119388-64119410 GTGGCTCATGCCTGTAATCTCGG - Intronic
1128073317 15:64810756-64810778 TGGGCTGAGCCCCCTACTCTGGG + Intergenic
1128157021 15:65397559-65397581 GTGGCTCATGCCTGTGCTCTTGG + Intronic
1130678924 15:85979467-85979489 GGGTCAGATGCCTCTTTTCTGGG + Intergenic
1132097453 15:98998204-98998226 GGGACTGGGGCCTCTACTCCTGG + Intronic
1132545178 16:529668-529690 CGGTGTGATGCCTCTACTCATGG + Intronic
1132652789 16:1029095-1029117 GGGGCTGGGGGCTCCACTCTGGG - Intergenic
1132932562 16:2466413-2466435 GGGGCTTATGCCTGTAATCCCGG + Intergenic
1133213363 16:4275197-4275219 GTGGCTGATGCCTGTAATCCTGG - Intergenic
1133266552 16:4588068-4588090 GGGTCTGATGCTTCTAGTTTGGG - Intronic
1133928653 16:10214246-10214268 GTGGCTCATGCCTGTAATCTGGG + Intergenic
1133952175 16:10405092-10405114 GTGGCTCATGCCTGTAATCTCGG + Intronic
1134062720 16:11208733-11208755 GTGGCTGATGCCTGTAATCCTGG + Intergenic
1134377027 16:13686453-13686475 GTGGCTCATGCCTATAATCTCGG - Intergenic
1134591542 16:15458169-15458191 TGAACTGATGCCTCTTCTCTTGG + Intronic
1135069725 16:19341337-19341359 GTGGCTGATGCCTGTACTCCCGG + Intergenic
1135357096 16:21778420-21778442 GGGGCTCATGCCTGTAATCTTGG + Intergenic
1135455600 16:22594536-22594558 GGGGCTCATGCCTGTAATCTTGG + Intergenic
1135606625 16:23831478-23831500 GAGGCTTATGCCTCCACTTTGGG - Intergenic
1136053428 16:27669954-27669976 GTGGCTCATGCCTGTAATCTCGG - Intronic
1136317483 16:29462908-29462930 GTGGCTCATGCCTCTAATCCCGG - Intronic
1136432058 16:30202253-30202275 GTGGCTCATGCCTCTAATCCCGG - Intronic
1136578275 16:31137065-31137087 GTGGCTCACGCCTCTAATCTCGG + Intergenic
1136933759 16:34439996-34440018 GTGGCTCATGCCTGTACTTTGGG - Intergenic
1136970813 16:34971818-34971840 GTGGCTCATGCCTGTACTTTGGG + Intergenic
1137265462 16:46865527-46865549 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1138397276 16:56714838-56714860 GTGGCTCATGCCTGTAATCTTGG - Intronic
1138553485 16:57759456-57759478 GGGGGTGCTGACTCTACCCTGGG - Intronic
1138581320 16:57942594-57942616 GTGGCTCATGCCTGTAATCTCGG + Intronic
1139104417 16:63809868-63809890 GTGGCTGATGCCTGTAATCTCGG - Intergenic
1139454803 16:67065165-67065187 GTGGCTGATGCCTGTAATCCCGG - Intronic
1140575941 16:76168920-76168942 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1141548324 16:84787086-84787108 GGGGCTGGGGCCTCGATTCTGGG + Intergenic
1141573053 16:84946140-84946162 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1142130012 16:88428102-88428124 GGGGCTGGTGCCCCTGCTCTGGG - Exonic
1203063704 16_KI270728v1_random:998635-998657 GTGGCACATGCCTCTACTCCCGG - Intergenic
1143003235 17:3809013-3809035 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1144183955 17:12778493-12778515 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1144659966 17:17061613-17061635 GGGGCTGATGCCCCAACTCTGGG - Intronic
1147299523 17:39514162-39514184 GTGGCTGATGCCTGTAATCCTGG - Intronic
1147363107 17:39943812-39943834 TGGGCTGGGGCCTCTTCTCTGGG - Intronic
1147654150 17:42079073-42079095 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1147695755 17:42351493-42351515 GTGGCTCAAGCCTATACTCTTGG - Intronic
1147871822 17:43592830-43592852 GTGGCTCATGCCTGTAGTCTTGG + Intergenic
1148818090 17:50345356-50345378 GATGCTGATGCCTTTGCTCTGGG - Intergenic
1149747967 17:59117691-59117713 GTGGCTCATGCCTATAATCTTGG - Intronic
1149823767 17:59807562-59807584 GTGGCTCATGCCTGTAATCTTGG + Intronic
1150809420 17:68344892-68344914 AGGGCTGGTGCCTCTGCTATTGG + Intronic
1151391937 17:73793266-73793288 GGGGGGGATTCCTCTCCTCTTGG - Intergenic
1151710945 17:75806185-75806207 GGGGCTCATGCCTGTAATCCCGG + Intronic
1151819979 17:76492089-76492111 GGGGCTGAAGGCCCTTCTCTGGG - Intronic
1151820610 17:76494840-76494862 GGAGCTGCTGCCTCTTCCCTGGG - Intronic
1152247882 17:79195125-79195147 GTGGCTGATGCCTGTAATCCCGG + Intronic
1152308759 17:79536526-79536548 GGGGCTGATGCCACCACAGTGGG - Intergenic
1152833221 17:82511862-82511884 GTGGCTCATGCCTATAATCTTGG - Intergenic
1153444386 18:5155292-5155314 GGGGCTGAAAACTCCACTCTGGG + Intronic
1153475707 18:5496398-5496420 GCAGCTGATGCCCCTACTCAAGG + Intronic
1153631802 18:7077858-7077880 GGTGCTCATGCCTCTAATCCCGG + Intronic
1153802578 18:8684246-8684268 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1154348091 18:13560482-13560504 GGGGCTGATGTCTCTTCCCATGG + Intronic
1155993304 18:32303647-32303669 GTGGCTCATGCCTGTAATCTTGG + Intronic
1156427720 18:37032907-37032929 GTGGCTCATGCCTGTAATCTCGG - Intronic
1157043105 18:44062702-44062724 GTGGCTGATGCCTGTAATCCAGG + Intergenic
1157283446 18:46360896-46360918 GGGGCTGACGCCTGGCCTCTGGG - Intronic
1158456323 18:57611232-57611254 GTGGCTCATGCCTGTAATCTCGG - Intronic
1158717262 18:59891849-59891871 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1159033940 18:63259247-63259269 GGGGCTGGTGCCTTTGCACTAGG - Intronic
1159754452 18:72347518-72347540 TGGACTGATTCCTCTGCTCTGGG + Intergenic
1159805022 18:72945963-72945985 GGGGCTCATGCCTGTAATCCCGG + Intergenic
1160497421 18:79383569-79383591 GGGGCTGCAGCCTCTCCTCTGGG + Intergenic
1160712565 19:559232-559254 GGGGCTGAGGGCTTCACTCTGGG - Intergenic
1160956701 19:1696699-1696721 GTGGCTCATGCCTGTACTTTGGG - Intergenic
1161368678 19:3896533-3896555 GGGGCTCATGCCTGTAATCCCGG - Intronic
1161546403 19:4883275-4883297 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1161548955 19:4900084-4900106 GTGGCTCATGCCTGTAATCTCGG - Intronic
1161622464 19:5305593-5305615 GTGGCTCATGCCTCTAATCCCGG + Intronic
1161624323 19:5317201-5317223 GTGGCTCATGCCTATAATCTCGG + Intronic
1162339415 19:10083142-10083164 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1162545356 19:11325803-11325825 GGGGCTTATGCCTGTAATCCTGG + Intronic
1162872360 19:13595895-13595917 GTGGCTCATGCCTGTAATCTTGG + Intronic
1163343253 19:16723578-16723600 GTGGCTCATGCCTGTAATCTCGG - Intronic
1163420246 19:17210158-17210180 GGGGCTGATTCTTCTGCTATGGG - Intronic
1163679690 19:18673670-18673692 GTGGCTCATGCCTCTAATCCCGG - Intergenic
1163854489 19:19690592-19690614 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1164849383 19:31468912-31468934 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1165081387 19:33308799-33308821 GGGGCTCTTCCCTCTTCTCTCGG + Intergenic
1165723252 19:38094517-38094539 GTGGCTCATGCCTGTAATCTCGG - Intronic
1165906255 19:39196599-39196621 GGGGCTGGTGCCTGGACTCCTGG + Intergenic
1165906278 19:39196672-39196694 GGGGCTGGTGCCTGGACTCCTGG + Intergenic
1165918465 19:39276487-39276509 GTGGCTGACGCCTCTAATCCTGG - Intergenic
1166099595 19:40563768-40563790 GTGGCTCATGCCTGTAATCTCGG + Intronic
1166348805 19:42184258-42184280 GTGGCTCATGCCTGTAATCTTGG - Intronic
1166569557 19:43784983-43785005 GGGGCTGAGGCCTGGACTCCTGG + Intergenic
1166648280 19:44549159-44549181 GGGGCTGGTGCAGCTTCTCTGGG + Intergenic
1166712967 19:44948955-44948977 GGGGCTGAGGCCTGGACTCCTGG - Intronic
1166849305 19:45751002-45751024 GTGGCTGATGCCTGTACTCCCGG + Intronic
1167266028 19:48483302-48483324 GGGGCTGAAGCCTGGACTCCCGG - Intergenic
1167690135 19:50980127-50980149 GGGGCTGAGGCCTGGACTCCTGG + Intronic
1167705582 19:51079288-51079310 GGGGCTGAGGCCTGGACTCCTGG - Intronic
1167743400 19:51337772-51337794 GGGGCTGAGGCCTGGACTCCAGG + Intronic
1168254501 19:55158150-55158172 GGGGCTGGGGCCTGGACTCTTGG - Intronic
1168254514 19:55158186-55158208 GGGGCTGGGGCCTGGACTCTTGG - Intronic
927283055 2:21327578-21327600 GGGGCTGATACCTTTATTTTTGG + Intergenic
928574691 2:32642935-32642957 GTGGCTTATGCCTATAATCTCGG - Intronic
928835642 2:35541358-35541380 GTGGCTCATGCCTCTAATCCCGG - Intergenic
929222704 2:39481043-39481065 GTGGCTGAAGCCTGTAATCTCGG - Intergenic
930031357 2:47059886-47059908 GTGGCTCATGCCTATAATCTCGG + Intronic
930274631 2:49297116-49297138 GGGCCTGATAACTCTACTGTGGG + Intergenic
931906553 2:66849381-66849403 GGGGCTGCTGCTCCTTCTCTTGG - Intergenic
932413665 2:71561350-71561372 AGCGCTGGAGCCTCTACTCTAGG + Intronic
933327125 2:80852347-80852369 GGGGCTGGTGTCTCTGATCTTGG + Intergenic
933465077 2:82641488-82641510 TAGGCTGATGGCTCTACTCAGGG + Intergenic
933609469 2:84418899-84418921 GTGGCTCATGCCTGTACTTTCGG + Intergenic
933721958 2:85402732-85402754 GTGGCTCATGCCTATACTCTCGG - Intronic
934489739 2:94753971-94753993 GTGGCTCATGCCTATAATCTCGG + Intergenic
934527427 2:95060234-95060256 GGGGCTGGGGCCTCCAATCTAGG + Intergenic
934994297 2:98942949-98942971 GTGGCTCATGCCTGTAATCTTGG + Intergenic
935181014 2:100691340-100691362 GGGGCTGCTGCTGCTACTCAAGG + Intergenic
936259887 2:110949617-110949639 AGAGCTGATTCCTCTAATCTTGG - Intronic
937777167 2:125791816-125791838 GGGGCTGCTGCTGTTACTCTGGG + Intergenic
938765484 2:134458356-134458378 GGGGGTGACGGCTCTATTCTGGG - Intronic
940309052 2:152257697-152257719 GTGGCTTATGCCTGTAATCTCGG - Intergenic
940918927 2:159286685-159286707 GGGCCTGTTCCCTCTGCTCTGGG - Intronic
941851178 2:170182986-170183008 GTGGCTCATGCCTGTAATCTAGG + Intronic
941998686 2:171625697-171625719 GGAGCAGTTGCCTCTTCTCTTGG + Intergenic
942145908 2:173026012-173026034 ATGTCTGATCCCTCTACTCTTGG - Intronic
942739128 2:179153973-179153995 GTGGCTCATGCCTATAATCTCGG + Intronic
942959160 2:181809169-181809191 GAGGCTGATGCTTCTGGTCTAGG + Intergenic
945261620 2:207849063-207849085 GTGGCTCATGCCTGTAATCTTGG + Intronic
946970573 2:225086593-225086615 GGAGCTGAGGACGCTACTCTGGG + Intergenic
947036012 2:225856729-225856751 GTGGCTCATGCCTGTAATCTCGG + Intergenic
947308323 2:228772866-228772888 GTGGCTCATGCCTCTAATCCCGG + Intergenic
947506103 2:230709600-230709622 GGGGCTCATGCCTATAATCCTGG - Intergenic
947705568 2:232272848-232272870 GTGGCTAATGCTTCTGCTCTTGG + Intronic
948217981 2:236245741-236245763 GGGGCTGCTGCTTCCTCTCTGGG + Intronic
948426338 2:237889031-237889053 GTGGCTCATGCCTGTAATCTTGG - Intronic
948712220 2:239832334-239832356 GTGGCTCATGCCTGTAATCTCGG + Intergenic
948961803 2:241344795-241344817 GTGGCTCATGCCTGTACTCCTGG + Intronic
949035466 2:241814019-241814041 GGTGCTGTGGCCTCTATTCTGGG + Intronic
1169023120 20:2345089-2345111 GTGGCTCATGCCTGTAGTCTTGG + Intergenic
1169040079 20:2486505-2486527 GTGGCTCATGCCAGTACTCTGGG + Intronic
1169065922 20:2693970-2693992 GGGGCTTCTGCCTCCACTCCGGG + Intronic
1169417370 20:5429038-5429060 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1169659933 20:7967406-7967428 GTGGCTCATGCCTGTAATCTTGG + Intergenic
1170339981 20:15314320-15314342 GTGGCTCATGCCTGTAATCTCGG + Intronic
1170701408 20:18707027-18707049 GGGGTGGATGCCACTGCTCTTGG + Intronic
1170877755 20:20266987-20267009 AGGGCTGAGACTTCTACTCTAGG - Intronic
1171001583 20:21421485-21421507 GTGGCTAATGCCTCTAATCCAGG - Intergenic
1172081355 20:32343497-32343519 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1172111826 20:32551105-32551127 GTGGCTCATGCCTGTAATCTCGG + Intronic
1172246902 20:33451717-33451739 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1172724917 20:37031870-37031892 GTGGCAGATGCCTATAGTCTTGG - Intronic
1172996633 20:39075330-39075352 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1174393640 20:50233251-50233273 GGGGCTGAGGCCTCCTCTCCTGG + Intergenic
1174481860 20:50836974-50836996 GTGGCTCATGCCTGTAATCTTGG - Intronic
1174488369 20:50875133-50875155 GGGTCAGATGTCTCTACTCGGGG - Intronic
1174572529 20:51512300-51512322 TGGGCTGATGCCTGGACTCACGG - Intronic
1175111929 20:56654529-56654551 ATGGCTGATGCCTCCAATCTGGG - Intergenic
1176293524 21:5058831-5058853 GGGGGTGATGCCTGCAGTCTTGG - Intergenic
1179041993 21:37811443-37811465 GGGGCTGATGCCTTAACTTGTGG + Intronic
1179718232 21:43301113-43301135 GCGGCTGACGCCTCCGCTCTTGG - Intergenic
1179809620 21:43862274-43862296 GTGGCTCATGCCTCTAATCCTGG + Intergenic
1179814457 21:43896034-43896056 GTGGCTCATGCCTGTAATCTCGG - Intronic
1179863736 21:44204817-44204839 GGGGGTGATGCCTGCAGTCTTGG + Intergenic
1179983275 21:44907381-44907403 GACGCTGAGGCCTCTCCTCTTGG - Intronic
1181276612 22:21691210-21691232 GTGGCTCATGCCTGTAATCTCGG - Intronic
1181426798 22:22849017-22849039 GGAGCTGAGCCCTCTACACTTGG + Intronic
1181873258 22:25920198-25920220 GGTGCAGATGCCTCAACACTGGG - Intronic
1182257924 22:29051267-29051289 GTGGCTCATGCCTCTAATCTTGG + Intronic
1182978915 22:34649555-34649577 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1183671620 22:39276254-39276276 GTGGGTGAGGCCTCTGCTCTGGG - Intergenic
1183865983 22:40704591-40704613 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1184210780 22:43034415-43034437 GTGGCTGATGCCTGTAATCCCGG + Intergenic
1184403297 22:44286233-44286255 GAACCTGATGCCTCTGCTCTTGG - Intronic
1184581278 22:45419463-45419485 GTGGCTCATGCCTGTAATCTCGG + Intronic
950409292 3:12824638-12824660 GTGGCTCATGCCTGTAATCTCGG + Intronic
950769120 3:15296963-15296985 GTGGCTCATGCCTCTAATCCTGG - Intronic
950786133 3:15437419-15437441 GTGGCTCATGCCTATAATCTCGG - Intronic
951466413 3:23004733-23004755 GGGGCTTTTGCATCTACTCTGGG - Intergenic
951889593 3:27555970-27555992 GTGGCTGATGCCTGTAATCCTGG - Intergenic
952233493 3:31455561-31455583 GGGGCAGAGGCAACTACTCTGGG + Intergenic
952439905 3:33316325-33316347 GTGGCTCATGCCTGTAATCTCGG - Intronic
954688846 3:52385180-52385202 GGGACTGATGCCCTTCCTCTGGG + Intronic
954739704 3:52738708-52738730 GTGGCTCATGCCTATACTTTGGG - Intronic
954790867 3:53132466-53132488 GTGGCTCATGCCTGTAATCTCGG - Intergenic
955469225 3:59268928-59268950 GGGGCTCATTCCTCTAATCCTGG + Intergenic
956844088 3:73166365-73166387 GTGGCTCATGCCTGTAATCTAGG - Intergenic
956995612 3:74824096-74824118 GGGACTGTTGTCTCTCCTCTGGG + Intergenic
958058088 3:88439473-88439495 GTGGCTCATGCCTGTAATCTTGG + Intergenic
959062393 3:101627661-101627683 GTAGCTCATGCCTGTACTCTCGG - Intergenic
959702598 3:109312072-109312094 GTGGCTAATGCCTGTACTTTGGG + Intronic
959964989 3:112343570-112343592 GTGGCTGATGCCTGTAATCCTGG - Intronic
960638445 3:119806552-119806574 GTGGCTGATGCCTGTAATCCCGG - Intronic
961255351 3:125546023-125546045 GCGGCTCATGCCTGTAATCTTGG + Intronic
962826843 3:139106598-139106620 GGGGCTAATGCCTAAACTCCTGG + Intronic
963957315 3:151269139-151269161 GTGGCTTATGCCTATACTCTGGG + Intronic
966774690 3:183533537-183533559 GAGGCTCATGCCTGTAATCTTGG - Intronic
966903977 3:184508532-184508554 GCTGCTGATACCTCTACCCTTGG + Intronic
967834348 3:193948249-193948271 GTGGCTCATGCCTGTAATCTCGG - Intergenic
970384294 4:15541050-15541072 GTGGCTCATGCCTGTACTTTGGG + Intronic
971091662 4:23352630-23352652 GAGGCAGGTGCCTATACTCTTGG - Intergenic
971319830 4:25596603-25596625 GTGGCTCATGCCTGTAATCTCGG + Intergenic
974930310 4:68353720-68353742 GTGGCTTATGCCTGTAATCTCGG + Intergenic
975128407 4:70807766-70807788 GTGGCTCATGCCTGTAATCTCGG - Intergenic
976089048 4:81436048-81436070 GTGGCTCATGCCTGTAATCTGGG - Intronic
976296520 4:83478193-83478215 GGGGCTCTTGCCTCTAATCCAGG + Intronic
976425115 4:84894388-84894410 GGGGCTCATGCCTGTAATCTCGG + Intronic
976713884 4:88102327-88102349 GTGGCTCATGCCTGTAATCTCGG + Intronic
977087965 4:92628729-92628751 GGGACTCATGCCTCCAATCTGGG + Intronic
980824924 4:138061756-138061778 GAGGCTGATGACTCTCTTCTCGG + Intergenic
980931235 4:139185074-139185096 GTGGCTCATGCCTGTACTTTGGG - Intergenic
981327772 4:143470706-143470728 GGGGGTCATGCCTCAACTGTGGG - Exonic
981849618 4:149214114-149214136 GTGGCTCATGCCTGTAATCTAGG - Intergenic
982216063 4:153083438-153083460 GGGGCTGAGGACTTTACACTGGG + Intergenic
983668027 4:170204400-170204422 GTGGCTTATGCCTGTACTCCTGG + Intergenic
984453190 4:179930275-179930297 GTGGCTCATGCCTGTAATCTCGG + Intergenic
984809052 4:183777747-183777769 GTGGCTCATGCCTGTAATCTCGG - Intergenic
985565945 5:617405-617427 GTGGCTCATGCCTGTAGTCTTGG + Intronic
985821685 5:2164803-2164825 GGGGCTTCTGCCTCTATCCTGGG - Intergenic
986183756 5:5417785-5417807 GGTGCTGAGGCCTCTGCTCTTGG + Intergenic
986754135 5:10818805-10818827 AGGGCTGTTGCCTTTAGTCTGGG + Intergenic
987382570 5:17299512-17299534 GTGGCTCATGCCTGTAATCTTGG + Intergenic
987980214 5:25074152-25074174 GTGGCTCATGCCTTTAATCTCGG - Intergenic
988490883 5:31704279-31704301 GTGGCTCATGCCTGTAATCTTGG - Intronic
990368413 5:55093072-55093094 TGGGCTAATGCCTCAAGTCTGGG + Intergenic
990968666 5:61478900-61478922 GTGGCTCATGCCTGTAATCTTGG + Intronic
991337515 5:65565533-65565555 GTGGCTGATGCCTGTAATCCTGG + Intronic
991375747 5:65965057-65965079 GGGGCTCATGCCTGTAATCCCGG - Intronic
992532467 5:77665549-77665571 AGGGCTGACGCCTCCACTCAAGG - Intergenic
996375731 5:122805021-122805043 GTGGCTCATGCCTGTAATCTCGG + Intronic
996562968 5:124850626-124850648 GTGGCTCATGCCTGTAATCTCGG + Intergenic
996715948 5:126588208-126588230 GTGGCTCATGCCTGTACTTTGGG + Intronic
997533500 5:134597577-134597599 TGGGCTGATCCCTTTACTCCAGG + Intergenic
999273965 5:150316233-150316255 GTGGCTCATGCCTGTAATCTTGG - Intronic
999393009 5:151207980-151208002 GTGGCTCATGCCTATAATCTTGG + Intronic
1000157273 5:158564069-158564091 GGGGCAGATGCAGCTCCTCTAGG - Intergenic
1000661130 5:163939692-163939714 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1000725224 5:164761652-164761674 GGGGTTGAAGCCTCTAGACTGGG + Intergenic
1002143307 5:177158604-177158626 GTGGCTCATGCCTGTAATCTCGG - Intronic
1002398674 5:178977851-178977873 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1002442706 5:179272704-179272726 GGGGCTGGGGCCTCTGTTCTGGG - Intronic
1003736664 6:8885019-8885041 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1006647094 6:35522351-35522373 GGGGCTCTTCCCTCTGCTCTGGG - Intergenic
1006943404 6:37767872-37767894 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1009034313 6:58098025-58098047 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1009321256 6:62292269-62292291 GTGGCTCATGCCTCTAATCTCGG + Intergenic
1010524545 6:76884777-76884799 GAGGCTGATCAGTCTACTCTGGG - Intergenic
1011072055 6:83396090-83396112 GTGGCTCATGCCTGTACTTTGGG + Intronic
1011746044 6:90408806-90408828 GGGGCTCATGCCTGTAATCTCGG - Intergenic
1013238598 6:108222023-108222045 GTGGCTCATGCCTATAATCTCGG - Intronic
1013494408 6:110683975-110683997 GTGGCTCATGCCTGTATTCTCGG - Intronic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1014170102 6:118268876-118268898 GTGGCTTATGCCTGTAATCTTGG - Intronic
1014487009 6:122011716-122011738 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1014605310 6:123466579-123466601 AGGAGTGAAGCCTCTACTCTAGG + Intronic
1014772269 6:125470382-125470404 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1015121555 6:129706616-129706638 GTGGCTCATGCCTGTAATCTCGG + Intronic
1016912154 6:149209716-149209738 GGGGCTGATGCCTCATGACTTGG - Intergenic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017817176 6:158024289-158024311 GGGGCTCATGCCTGTAATCCCGG + Intronic
1018805330 6:167254823-167254845 GGAGCCGGTGCCTCTCCTCTAGG - Intergenic
1018872780 6:167796104-167796126 GGGGCTGCTGCCTTTGCTCTGGG - Intronic
1019698014 7:2458487-2458509 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1019732555 7:2635932-2635954 GGGGCTGAGGCCTCTCCCCGAGG - Intronic
1020017363 7:4838712-4838734 GGAGGTGAGGCCTCTCCTCTGGG + Intronic
1020650546 7:10869898-10869920 GTGACTCATGCCTGTACTCTGGG + Intergenic
1021098853 7:16565173-16565195 GTGGCTGATGCCTGTATTTTGGG + Intronic
1022403500 7:30064290-30064312 GTGGCTCATGCCTGTACTTTCGG + Intronic
1023186420 7:37538001-37538023 GTGGCTTATGCCTGTAATCTCGG + Intergenic
1023984701 7:45088008-45088030 CAGGCTGCTGCCTCTGCTCTAGG - Intronic
1024468177 7:49736712-49736734 ATTGCTGATGCATCTACTCTGGG + Intergenic
1025054943 7:55757568-55757590 GTGGCTTATGCCTGTAATCTCGG + Intergenic
1025125385 7:56340080-56340102 GTGGCTGATGCCTGTAATCCCGG - Intergenic
1026371522 7:69704535-69704557 GTGGCTCATGCCTGTACTTTGGG - Intronic
1027268679 7:76508306-76508328 GTGGCTCATGCCTGTAATCTGGG + Intergenic
1029716523 7:102330598-102330620 GTGGCTCATGCCTGTAATCTTGG + Intergenic
1030060263 7:105615941-105615963 GGTGCTGCTGCTGCTACTCTGGG + Intronic
1030693980 7:112564338-112564360 AGGGCTGACTCTTCTACTCTAGG - Intergenic
1032227674 7:130046336-130046358 GTGGCTCATGCCTGTAATCTTGG + Intronic
1032783853 7:135185488-135185510 GGGGCTGAGGCCTCTGCTACTGG - Exonic
1033229632 7:139586498-139586520 GTGGCTCATGCCTGTAATCTCGG + Intronic
1033672458 7:143505911-143505933 GGGGCTCTTTCCTCTTCTCTTGG + Intergenic
1034197524 7:149259805-149259827 GTGGCTGATGCCTGTAATCCCGG + Intergenic
1034267000 7:149785887-149785909 GGGGTTGGTGCCTCTCCTCTTGG + Intergenic
1035234607 7:157488095-157488117 GGGGCTGCAGCCCCTCCTCTAGG - Intergenic
1035841045 8:2812095-2812117 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1036963576 8:13272177-13272199 GTGGCTCATGCCTGTAATCTCGG + Intronic
1037100736 8:15042292-15042314 TGTGCTGATGCCTCTCTTCTGGG + Intronic
1038197050 8:25378017-25378039 GTGGCTCATGCCTGTAGTCTTGG - Intronic
1039620423 8:38992195-38992217 GTGGCTGATGCCTATAATCCCGG + Intronic
1039941063 8:42091343-42091365 GTGGCTCATGCCTCTAGTCCCGG - Intergenic
1039967700 8:42295385-42295407 GTGGCTCATGCCTGTAATCTCGG - Intronic
1040913854 8:52548078-52548100 GTGGCTTATGCCTGTAATCTCGG + Intronic
1042277931 8:67025211-67025233 GTGGCTCATGCCTATAATCTTGG - Intronic
1042916121 8:73878095-73878117 GGGGCTGAGGACTCGGCTCTCGG + Intronic
1043320754 8:78982876-78982898 AAGGCTGCTGCCTCTACACTTGG + Intergenic
1043618066 8:82152439-82152461 GTGGCTGATGCCTGTAATCCCGG - Intergenic
1043662599 8:82763213-82763235 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1044083359 8:87912495-87912517 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1044271537 8:90250108-90250130 GGGGCTCACGCCTGTAATCTTGG + Intergenic
1044424281 8:92033514-92033536 GTGGCTCATGCCTGTAATCTCGG + Intronic
1044483938 8:92727504-92727526 GGGGATGATGCTTCTATTCCAGG - Intergenic
1045102038 8:98854405-98854427 GTGGCTCATGCCTGTAATCTCGG - Intronic
1045190754 8:99880605-99880627 GTGGCTCATGCCTGTAATCTGGG + Intronic
1046668506 8:117032619-117032641 GTGGCTGATGCCTGTAATCCTGG + Intronic
1046963753 8:120139755-120139777 GTGGCTCATGCCTATAATCTTGG + Intronic
1047081367 8:121464938-121464960 GTGGCTCATGCCTCTAATCCCGG - Intergenic
1047322658 8:123802491-123802513 GGTGGTGATACCACTACTCTGGG + Intronic
1047458036 8:125034229-125034251 GTGGCTTATGCCTGTAATCTTGG + Intronic
1047559136 8:125967359-125967381 GTGGCTCATGCCTCTAATCCAGG + Intergenic
1047608052 8:126494078-126494100 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1048187444 8:132254611-132254633 GTGGCTCATGCCTGTAATCTCGG + Intronic
1048877076 8:138845245-138845267 GTGGCTCATGCCTGTACTTTGGG + Intronic
1050356521 9:4788771-4788793 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1050698304 9:8304557-8304579 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1053359710 9:37476127-37476149 GTGGCTCATGCCTGTAATCTTGG - Intergenic
1053668049 9:40330568-40330590 GTGGCTCATGCCTATAATCTCGG - Intergenic
1054379194 9:64470606-64470628 GTGGCTCATGCCTATAATCTTGG - Intergenic
1054516562 9:66045717-66045739 GTGGCTCATGCCTATAATCTCGG + Intergenic
1055040649 9:71867936-71867958 GTGGCTCATGCCTGTAATCTCGG + Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056237336 9:84607938-84607960 GTGGCTCATGACTCTACTGTGGG + Intergenic
1056308588 9:85317028-85317050 GTGGCTTATGCCTATACTTTGGG - Intergenic
1057353433 9:94318168-94318190 AGGGCTGCTGCCTCTGCCCTTGG - Intergenic
1057654318 9:96939424-96939446 AGGGCTGCTGCCTCTGCCCTTGG + Intronic
1057922286 9:99106571-99106593 GGGGCAAATGCCACTACTCCTGG - Intronic
1058845785 9:108957847-108957869 GTGGCTCATGCCTGTAATCTTGG + Intronic
1060080292 9:120637523-120637545 GTGGCTCATGCCTGTAATCTCGG + Intronic
1060507881 9:124211936-124211958 GTGGCTCATGCCTGTAATCTTGG + Intergenic
1060722388 9:125987631-125987653 GGGGCTGACACCTCTACCCAGGG + Intergenic
1061621037 9:131811563-131811585 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1062648409 9:137562705-137562727 GTGGCTCATGCCTGTACTTTGGG + Intronic
1185843625 X:3416661-3416683 GGAGCTGAGGCCTCTCCACTTGG - Intergenic
1186043325 X:5505426-5505448 GTGGCTGATGCCTGTAATCCCGG - Intergenic
1186400419 X:9253607-9253629 GTGGCTCATGCCTGTAATCTCGG + Intergenic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1187431231 X:19226995-19227017 GTGGCTCATGCCTGTAGTCTCGG - Intergenic
1187643717 X:21323072-21323094 GTGGCTTATGCCTGTAATCTTGG - Intergenic
1188329821 X:28855285-28855307 GTGGCTCATGCCTGTAATCTTGG - Intronic
1189512125 X:41673386-41673408 GTGGCTCATGCCTGTAATCTGGG - Intronic
1189684177 X:43546501-43546523 GTGGCTCATGCCTGCACTCTGGG - Intergenic
1190703204 X:53003607-53003629 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1191072675 X:56418933-56418955 GTGGCTCATGCCTCTAATCCCGG + Intergenic
1192111688 X:68371485-68371507 GTGGCTCATGCCTCTAATCCTGG - Intronic
1192569411 X:72190682-72190704 GTGGCTCATGCCTGTACTCCTGG + Intronic
1193842870 X:86429829-86429851 GTGGCTCATGCCTGTACTCCTGG - Intronic
1196648706 X:118146957-118146979 GTGGCTCATGCCTCTAATCCCGG + Intergenic
1196658913 X:118249086-118249108 GTGGCTCATGCCTGTAATCTCGG - Intergenic
1197699653 X:129589247-129589269 GGGGTGGATCCCTCTACTCTGGG + Intronic
1197800703 X:130344880-130344902 TGGACTGAAGCCTCTTCTCTGGG + Intronic
1198465040 X:136897422-136897444 GTGGCTCATGCCTCTAATCCTGG + Intergenic
1198627241 X:138590654-138590676 GTGGCTGATGCCTGCACTTTGGG - Intergenic
1199763397 X:150923151-150923173 GGGGCTTATGCCTGTAATCCCGG + Intergenic