ID: 1091789076

View in Genome Browser
Species Human (GRCh38)
Location 12:3260956-3260978
Sequence AGCCATATCCCTTGGGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091789072_1091789076 -2 Left 1091789072 12:3260935-3260957 CCTTGAAGGAACGCCATGATCAG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1091789076 12:3260956-3260978 AGCCATATCCCTTGGGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 128
1091789071_1091789076 8 Left 1091789071 12:3260925-3260947 CCTCTAGAGGCCTTGAAGGAACG 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1091789076 12:3260956-3260978 AGCCATATCCCTTGGGTTGTAGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091789076 Original CRISPR AGCCATATCCCTTGGGTTGT AGG Intronic
902251924 1:15159453-15159475 AGCAATATAAATTGGGTTGTTGG - Intronic
902675847 1:18008088-18008110 CCCCACATCCCTGGGGTTGTGGG - Intergenic
904255647 1:29252912-29252934 AGTCAGATCCCATGGGTTGAGGG + Intronic
904934984 1:34123628-34123650 AGTCACATCCCATGGGTTGGGGG - Intronic
911722427 1:101205890-101205912 CTCCATATCCCTTAGGTTCTAGG + Intergenic
914420591 1:147525134-147525156 AGCCCTGTCACTGGGGTTGTGGG + Intergenic
918074795 1:181161806-181161828 AGCCAGATGCCTGGGGTTGCAGG + Intergenic
920258591 1:204673806-204673828 TGCCAGATCACTTGGGTAGTGGG - Intronic
924351921 1:243123112-243123134 AGCCAGATGCCTGTGGTTGTTGG + Intergenic
1063540384 10:6927820-6927842 AGCCTTAGCCCTTGGGTGGTGGG - Intergenic
1070682412 10:78457669-78457691 AGCTATACCCCTTGGATGGTAGG + Intergenic
1074351310 10:112739701-112739723 AGCCATACACCCTGGCTTGTTGG + Intronic
1080203265 11:29699087-29699109 AGCCATATCCCTAGGGGAATGGG - Intergenic
1081297081 11:41404451-41404473 ACACATAGCCCTGGGGTTGTCGG - Intronic
1081549991 11:44102060-44102082 ACCCATATCCCATGGATTGAAGG + Intronic
1081997385 11:47374392-47374414 AGCCATATCCCAGGGGTAGGCGG - Intronic
1082070354 11:47934651-47934673 AACCATATCACATGGGTTTTGGG + Intergenic
1086033080 11:82383848-82383870 ACCCATATGCCATGGGCTGTGGG + Intergenic
1087991195 11:104746698-104746720 AGCCAGATCCCATGGCTTGAAGG + Intergenic
1088451358 11:109984495-109984517 AGCCTTATCCCTTACATTGTAGG - Intergenic
1090533351 11:127614139-127614161 AGACATGTCCCTTAGGTTGGAGG - Intergenic
1090990012 11:131808661-131808683 AGTCACATCACATGGGTTGTAGG + Intronic
1091789076 12:3260956-3260978 AGCCATATCCCTTGGGTTGTAGG + Intronic
1091850620 12:3694020-3694042 AGCCATTCCCCTGGAGTTGTTGG + Intronic
1094382617 12:29859528-29859550 AGCCATTTCCCTTCAGTTGTGGG - Intergenic
1097264041 12:57735947-57735969 AGCTCTTTCCCTTGGGCTGTGGG - Intronic
1099151023 12:79114105-79114127 AGGAAAATACCTTGGGTTGTGGG + Intronic
1100197694 12:92266039-92266061 TGTCATATCCCTTGGCATGTTGG + Intergenic
1102534616 12:113571377-113571399 AGCAATTTCCCTTGGGAAGTTGG + Intergenic
1110090080 13:71434049-71434071 AGCCATATGCGGTGTGTTGTGGG + Intergenic
1111468366 13:88645899-88645921 AGGCATCTCCCATGTGTTGTGGG - Intergenic
1112268930 13:97950675-97950697 AACCATATCACTTGGTTTTTTGG - Intergenic
1113131672 13:107043528-107043550 AACCATATTCCTTTTGTTGTTGG + Intergenic
1113310022 13:109122068-109122090 AGCCAGATCCCTGGCGATGTTGG - Intronic
1114260545 14:21033344-21033366 AGCCATATCCCCTGAGTAGGTGG + Exonic
1120214720 14:81669106-81669128 AGCCAGCTCCCTTGGCTTGTGGG - Intergenic
1125552753 15:40559425-40559447 AACGAGATCCCTTGGCTTGTTGG - Intronic
1134373922 16:13652147-13652169 AACCATATCACTTGGATTATGGG + Intergenic
1136515905 16:30768224-30768246 AGCCATCTCCTTTCTGTTGTCGG - Exonic
1137035583 16:35566904-35566926 AGTCATATCACTTGGGTGCTAGG + Intergenic
1137840790 16:51639080-51639102 AGGCATGTCCATTGGCTTGTAGG - Intergenic
1139335471 16:66227966-66227988 AGCCATATCACCTGGGTAATCGG + Intergenic
1143205153 17:5136093-5136115 AGGCATCTGACTTGGGTTGTGGG - Intronic
1151632273 17:75319005-75319027 AGCCAGATCCAGTGGGATGTGGG + Exonic
1156363445 18:36404270-36404292 TGACATATCCCCTGGGATGTTGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1163223205 19:15936658-15936680 AGCCAGAGCCCTGGGATTGTTGG + Intergenic
1164041311 19:21494912-21494934 AGTCACATCACTTGGGTAGTGGG - Intergenic
1164234720 19:23322296-23322318 AGCCATATCACCTAGGTTCTAGG - Intronic
1167117326 19:47495883-47495905 TGCCCTGTCCCTGGGGTTGTGGG - Intronic
925435403 2:3833062-3833084 ATCCACATCCTTTGGCTTGTGGG + Intronic
926334552 2:11853485-11853507 AGGCAGGTGCCTTGGGTTGTGGG + Intergenic
927135578 2:20094044-20094066 AGCCCTGTCCCTTGGCTTCTAGG - Intergenic
927382916 2:22499656-22499678 AGCAATGTCCCTTGGAGTGTGGG + Intergenic
929138064 2:38643455-38643477 AGCCATCTCCCTCTGCTTGTGGG - Intergenic
929726990 2:44440018-44440040 AGCCATATCCCATGAGATGGAGG - Intronic
933506280 2:83181009-83181031 AGCCAGCTCCCTCGGCTTGTGGG + Intergenic
934159078 2:89230952-89230974 AGCCATATCCATTTTGGTGTTGG - Intergenic
934208195 2:89951473-89951495 AGCCATATCCATTTTGGTGTGGG + Intergenic
935040951 2:99426610-99426632 AGCCAAATACCTTGAGTTGATGG + Intronic
937241941 2:120467561-120467583 AGCCCTTTCCCTTGGGCTGCAGG + Intergenic
938591631 2:132742977-132742999 ATCCATATCCCCTGGTCTGTTGG - Intronic
944106819 2:196087961-196087983 AGCCAGATTCCTGGGGTTGGAGG + Intergenic
945603785 2:211901170-211901192 AGACATATCCTCTGGGTTTTTGG - Intronic
946388169 2:219398792-219398814 AGACATTACCCTTGGGTGGTAGG - Intronic
947503583 2:230689976-230689998 AGCCTTGTGCTTTGGGTTGTGGG + Intergenic
1170287266 20:14723750-14723772 GGTCATATCCCTTGGTCTGTGGG + Intronic
1171015403 20:21536740-21536762 ATCCATTTCCCTGTGGTTGTAGG - Intergenic
1172571190 20:35972161-35972183 ACCCACATTCCTTGGCTTGTGGG + Intronic
1175518351 20:59583592-59583614 AGCCAGCACCCTGGGGTTGTTGG - Intronic
1175625187 20:60483874-60483896 AGCCACATCCCTTGGGAGCTGGG + Intergenic
1184043935 22:41960445-41960467 AGGCAGATCCCTTGGGATGTAGG + Intergenic
950544085 3:13628733-13628755 AGGTGTATCCCTTGGGTAGTGGG + Intronic
953375546 3:42425488-42425510 AGCCCTTTCCCTAGGGTTATAGG - Intergenic
954577118 3:51682671-51682693 AGACAAGTCCCTTGGGTTCTGGG - Intronic
958985606 3:100776673-100776695 AGCCATTTCCCTTGAGTTAGAGG + Intronic
962383816 3:134916754-134916776 AGCCGGATCCCTTGGCTTGCCGG - Intronic
964376215 3:156051744-156051766 AGCCAGCTCCCTTGGCTTGCGGG + Intronic
965675905 3:171196046-171196068 AGTCATATTCTTTGGGTGGTGGG - Intronic
967124700 3:186413293-186413315 AGGCATTTCCCTTGGGGTCTGGG - Intergenic
967731073 3:192907418-192907440 AGCCATCTTTCTTGGGTTGAGGG - Intronic
969303205 4:6309418-6309440 AGCCGGATCCCTCGGCTTGTGGG - Intergenic
977762999 4:100761848-100761870 AATCATTTCCCTTGGGTTGGAGG + Intronic
977885114 4:102245009-102245031 AGCCAGTTCCCTTTGCTTGTGGG + Intergenic
983887083 4:172992203-172992225 AGCCATGTCCCTTAGCTAGTTGG - Intronic
986311178 5:6552107-6552129 AGTCATATCCCTTCAGCTGTCGG - Intergenic
990506793 5:56453371-56453393 ATCCATCTCCTTGGGGTTGTAGG + Intergenic
993223232 5:85130954-85130976 AGCCATATCCATTTGGCTGTCGG - Intergenic
994335277 5:98557469-98557491 ACCCATTTCCCTGGGCTTGTTGG - Intergenic
998409920 5:141901914-141901936 AGCCATATGGCTTGGTTTGAAGG - Intergenic
999421319 5:151447362-151447384 AGCACTGTCCCTTGAGTTGTGGG - Intronic
999632364 5:153584082-153584104 AACCATATCCTTTGGGATGGAGG - Intronic
1000353778 5:160373632-160373654 GGCCACATCCCTTGGGGTGGTGG + Intergenic
1002165250 5:177340138-177340160 AGTCATCTCCTTTGGTTTGTAGG - Intronic
1009288725 6:61856815-61856837 AGGCATATCCCTCGGATTGCTGG + Intronic
1010900321 6:81420277-81420299 AGCTATATTTCTTGTGTTGTGGG + Intergenic
1013601172 6:111706237-111706259 AGCATTCTCCCTTGGGTTTTGGG - Intronic
1017168000 6:151427824-151427846 AGTGATTTTCCTTGGGTTGTGGG - Intronic
1019462087 7:1165430-1165452 AGCCATCTCCCTAGGGACGTTGG + Intergenic
1024748249 7:52431632-52431654 AGCCAGATCCCTCTGCTTGTGGG - Intergenic
1024912587 7:54463118-54463140 AGCCTTATCCTTTGCTTTGTGGG - Intergenic
1025722053 7:64025935-64025957 AGTCATATCACTTGGGTGCTGGG - Intergenic
1025750534 7:64290219-64290241 AGTCATATCACTTGGGTGATGGG + Intergenic
1026173254 7:67973108-67973130 AGCCATGTACCTTGAGTAGTGGG - Intergenic
1031257959 7:119481160-119481182 CGACATATCCCTGGGGTTTTAGG - Intergenic
1032787131 7:135209993-135210015 AGCCAGATCTCTTAGGTTCTGGG - Intronic
1033862621 7:145645863-145645885 AGGCATATACCTTGAGTTTTTGG + Intergenic
1034542950 7:151770756-151770778 AGCCCTGTCTCTTGGGTTTTAGG + Intronic
1036614385 8:10377475-10377497 AGCCATATCCTTTGGGTGGATGG + Intronic
1037119647 8:15267306-15267328 AGCCTTGTGCCTTGGTTTGTGGG - Intergenic
1040378665 8:46851085-46851107 AGCCACATCACTTGGGTGCTGGG - Intergenic
1040609536 8:48969047-48969069 AGCAATTGCCCTTTGGTTGTAGG - Intergenic
1041934109 8:63317887-63317909 AGCCATGTCCCTTTGGCTGCAGG + Intergenic
1051682691 9:19623910-19623932 CGCCTTAACCCTTGGGTTGGGGG + Intronic
1054843898 9:69772098-69772120 GGCAATACCCCTTGGGTTTTGGG - Intergenic
1058729258 9:107834329-107834351 AACCATGTCCCTTGGCTTGAGGG - Intergenic
1185768912 X:2749723-2749745 GCCAATATCCCTTGGCTTGTAGG + Intergenic
1187807276 X:23134653-23134675 AACGATATCCCTTTGGATGTAGG - Intergenic
1187958260 X:24542028-24542050 AGACATTTTCCTTGGGTGGTAGG + Intergenic
1190867507 X:54397190-54397212 AGAGATGTCCCTTGGGTTGCAGG + Intergenic
1200420850 Y:2965502-2965524 AGCCTTCTCCTTTGGGTTGTTGG + Intronic
1200849653 Y:7869892-7869914 AGCCATATCTCTTGGGAACTTGG + Intergenic
1200896589 Y:8382552-8382574 AGTCATATCCCTTAGGTCATGGG + Intergenic
1200896608 Y:8382697-8382719 AGCCAGATCACTTGGGTGCTGGG + Intergenic
1202248406 Y:22843075-22843097 AGCCACATCACTTGGGTGCTGGG - Intergenic
1202252753 Y:22890048-22890070 AGCCACATCACTTGGGTGGTGGG + Intergenic
1202255548 Y:22916662-22916684 AGCCACATCACTTGGGTGCTGGG - Intergenic
1202264159 Y:23000550-23000572 AGCCACATCACTTGGGTGCTGGG - Intronic
1202265432 Y:23012993-23013015 AGCCACGTCCCTTGGGTGCTGGG - Intergenic
1202401394 Y:24476823-24476845 AGCCACATCACTTGGGTGCTGGG - Intergenic
1202405742 Y:24523797-24523819 AGCCACATCACTTGGGTGGTGGG + Intergenic
1202408539 Y:24550411-24550433 AGCCACATCACTTGGGTGCTGGG - Intergenic
1202417151 Y:24634292-24634314 AGCCACATCACTTGGGTGCTGGG - Intronic
1202418425 Y:24646735-24646757 AGCCACGTCCCTTGGGTGCTGGG - Intergenic
1202452361 Y:25023351-25023373 AGCCACGTCCCTTGGGTGCTGGG + Intergenic
1202453636 Y:25035794-25035816 AGCCACATCACTTGGGTGCTGGG + Intronic
1202462243 Y:25119669-25119691 AGCCACATCACTTGGGTGCTGGG + Intergenic
1202465038 Y:25146285-25146307 AGCCACATCACTTGGGTGGTGGG - Intergenic
1202469387 Y:25193263-25193285 AGCCACATCACTTGGGTGCTGGG + Intergenic