ID: 1091790742

View in Genome Browser
Species Human (GRCh38)
Location 12:3270573-3270595
Sequence GGCCAGGAAGCCCAAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 391}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091790740_1091790742 -8 Left 1091790740 12:3270558-3270580 CCCATACTGAGGCTAGGCCAGGA 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790737_1091790742 -6 Left 1091790737 12:3270556-3270578 CCCCCATACTGAGGCTAGGCCAG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790738_1091790742 -7 Left 1091790738 12:3270557-3270579 CCCCATACTGAGGCTAGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790733_1091790742 11 Left 1091790733 12:3270539-3270561 CCAGGCAGGGCAGGTGCCCCCCA 0: 1
1: 0
2: 4
3: 36
4: 412
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790741_1091790742 -9 Left 1091790741 12:3270559-3270581 CCATACTGAGGCTAGGCCAGGAA 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790725_1091790742 30 Left 1091790725 12:3270520-3270542 CCTTGATTGGAGCAAGCCCCCAG 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790732_1091790742 12 Left 1091790732 12:3270538-3270560 CCCAGGCAGGGCAGGTGCCCCCC 0: 1
1: 0
2: 5
3: 44
4: 384
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790730_1091790742 14 Left 1091790730 12:3270536-3270558 CCCCCAGGCAGGGCAGGTGCCCC 0: 1
1: 0
2: 7
3: 61
4: 447
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790731_1091790742 13 Left 1091790731 12:3270537-3270559 CCCCAGGCAGGGCAGGTGCCCCC 0: 1
1: 2
2: 5
3: 62
4: 535
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391
1091790736_1091790742 -5 Left 1091790736 12:3270555-3270577 CCCCCCATACTGAGGCTAGGCCA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG 0: 1
1: 0
2: 4
3: 41
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091790742 Original CRISPR GGCCAGGAAGCCCAAACAGA TGG Intronic
900939506 1:5789175-5789197 AGTCAGGGACCCCAAACAGAAGG + Intergenic
903328855 1:22586688-22586710 GGCCTGGAGGACCAAACACAGGG - Intronic
903421954 1:23224497-23224519 AGTCAGGGACCCCAAACAGAGGG - Intergenic
904324017 1:29715778-29715800 GGCCATGATGCCCACACTGAAGG + Intergenic
905293718 1:36940995-36941017 GGCCAGGAACCCAATACACATGG - Intronic
905664309 1:39753301-39753323 GGACGGGAAGCCAAAGCAGAAGG + Intronic
906449003 1:45927956-45927978 AGTCAGGGACCCCAAACAGAGGG - Intronic
908016375 1:59841845-59841867 GTGCAGAAATCCCAAACAGAGGG + Intronic
908519260 1:64925562-64925584 GGTCAGGAAGCCTAATCAGTTGG - Intronic
909254850 1:73407327-73407349 AGTCAGGGATCCCAAACAGAGGG + Intergenic
910605531 1:89079699-89079721 AGTCAGGGACCCCAAACAGAGGG + Intergenic
910785933 1:90998042-90998064 GGCCAGGAAGCTCGAACTGGGGG + Intronic
912297615 1:108485687-108485709 AGTCAGGGACCCCAAACAGAGGG + Intergenic
912786762 1:112611702-112611724 GGCCAAGAAGTCCCAAAAGAGGG + Intronic
913344291 1:117792766-117792788 TGGCAGGAAGCCCAAAAAGAAGG + Intergenic
915267253 1:154727894-154727916 GGGCTGAAAGCCCAAAAAGAGGG + Intronic
915282013 1:154829252-154829274 GGGCAGGAAGCCCAGGCTGAGGG + Intronic
915410550 1:155698422-155698444 AGTCAGGGACCCCAAACAGAGGG - Intronic
915999362 1:160599976-160599998 AGTCAGGGACCCCAAACAGAGGG + Intergenic
916278623 1:163023789-163023811 GGCCAGAATGCACAGACAGAGGG - Intergenic
916359945 1:163957346-163957368 AGTCAGGGACCCCAAACAGAGGG + Intergenic
918029857 1:180796210-180796232 CGCCAGAAAGCTCAAACACATGG - Intronic
918281597 1:183011441-183011463 AGTCAGGGACCCCAAACAGAGGG - Intergenic
920382204 1:205541697-205541719 AGGAAGGAAGTCCAAACAGAGGG - Intergenic
923028877 1:230230861-230230883 AGCCACGAAGACCAAACAGAGGG - Intronic
924690367 1:246343759-246343781 GGGCAGGAAGACCAAATAGGAGG - Intronic
1063128426 10:3155636-3155658 AGCCACGAAGCTCAAGCAGAAGG - Exonic
1063477981 10:6345333-6345355 GGCCAGCAGGCACAAACAGAAGG - Intergenic
1064787392 10:18913332-18913354 GGCCAGGAAGTCCAAGCACATGG - Intergenic
1065053316 10:21817671-21817693 AGTCAGGAACCCCAAACAGAGGG + Intronic
1065365892 10:24936674-24936696 GGCCAGGGAGCTCCAGCAGAAGG - Intronic
1066257015 10:33689858-33689880 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1066698551 10:38100965-38100987 AGTCAGGGACCCCAAACAGAGGG - Intronic
1069132712 10:64726812-64726834 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1069198369 10:65582522-65582544 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1069593793 10:69657470-69657492 GACCAGGGAACCCAGACAGAGGG - Intergenic
1069650168 10:70041392-70041414 AGTCAGGGACCCCAAACAGACGG + Intergenic
1069764257 10:70841406-70841428 GGCCAGGAAGCCCAAGAGCAAGG + Intronic
1071356742 10:84804545-84804567 GGCCAGGAAACCTAAACCAAAGG - Intergenic
1071945387 10:90638222-90638244 AGTCAGGTACCCCAAACAGAGGG + Intergenic
1072035225 10:91557029-91557051 GGCCAGGAAGGCCAGACAAGTGG - Intergenic
1072479939 10:95801145-95801167 AGTCAGGGACCCCAAACAGAGGG - Intronic
1072783660 10:98266642-98266664 GGGCAGGAAGGCCAATAAGAGGG - Intronic
1074445940 10:113520891-113520913 GGGCAGGAATCCCAGACAAAGGG - Intergenic
1075459111 10:122604268-122604290 AGTCAGGGACCCCAAACAGAGGG - Intronic
1075459743 10:122608327-122608349 AGTCAGGGACCCCAAACAGAGGG - Intronic
1075460375 10:122612386-122612408 AGTCAGGGACCCCAAACAGAGGG - Intronic
1075461007 10:122616445-122616467 AGTCAGGGACCCCAAACAGAGGG - Intronic
1076438311 10:130461641-130461663 GACCAGGAAGTCTAATCAGAAGG + Intergenic
1077364773 11:2157182-2157204 AGGCAGGACGCCCAGACAGAAGG + Intronic
1078714943 11:13830990-13831012 AGTCAGGGATCCCAAACAGAGGG - Intergenic
1079041406 11:17063593-17063615 CACCAGGAAGCCCCACCAGAGGG - Intergenic
1079336819 11:19577442-19577464 GGCCAGGTGGCTCACACAGATGG - Intronic
1080155380 11:29104864-29104886 AGTCAGGGAGCCCAAACAGAGGG + Intergenic
1080409668 11:32011691-32011713 GGCCAGCAAGCCCAGAGAGCAGG - Intronic
1080948095 11:36997481-36997503 GGCCAGAAAGCCAAAGCAAATGG - Intergenic
1081254013 11:40870462-40870484 CGTCAGGAACCCCAAACGGAGGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081653889 11:44844193-44844215 AGTCAGGGACCCCAAACAGAGGG - Intronic
1082309580 11:50630549-50630571 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1082310299 11:50637545-50637567 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1083164433 11:60874865-60874887 GGGCAGGAAGCACAAAGGGAAGG - Intronic
1083591222 11:63896143-63896165 GGCCAGGAAGCCCACTCAGGAGG - Intronic
1084024986 11:66442391-66442413 GGCCATGACGCCCACACTGAAGG - Intronic
1084345013 11:68541213-68541235 AGTCAGGGACCCCAAACAGAGGG - Intronic
1085321739 11:75578608-75578630 GACCAAGGAGACCAAACAGATGG + Intergenic
1089497145 11:118913604-118913626 GGGCAGGAAGCCCAGGCAGGCGG + Intronic
1090441510 11:126728784-126728806 GGCCATGGAGCCAACACAGAAGG - Intronic
1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG + Intronic
1093823626 12:23653594-23653616 GGCCGGGAAGCCCAAAATAAGGG + Intronic
1094385141 12:29885826-29885848 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1095951472 12:47784087-47784109 AGCCAGGATGCCCACAGAGAGGG + Exonic
1096035882 12:48469813-48469835 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1097138934 12:56883138-56883160 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1097548409 12:61034903-61034925 TGCCAAGAAGCCCAGACAGTAGG + Intergenic
1097811084 12:64020074-64020096 GGTAAGGAAGTCCAAACATAAGG - Intronic
1098446036 12:70566443-70566465 AGCAAGGAAGCCCAGACTGAAGG - Exonic
1098497128 12:71149565-71149587 AGTCAGGGACCCCAAACAGAGGG + Intronic
1099800818 12:87454418-87454440 TGCCAGGAAACCCAAACTGGTGG - Intergenic
1101686035 12:107022116-107022138 GTCCACGAATCACAAACAGACGG + Exonic
1102308077 12:111821771-111821793 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1103063542 12:117878081-117878103 GACCAAGAATCCCAAAAAGAAGG + Intronic
1104035176 12:125092765-125092787 GCCCAGGCAGCCCCCACAGAGGG - Intronic
1105244347 13:18635185-18635207 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1105856075 13:24373349-24373371 GGCCATGATGCCCACACTGAAGG + Intergenic
1106228946 13:27807180-27807202 GGGCCTGAAGCACAAACAGAAGG + Intergenic
1106746586 13:32715082-32715104 AGTCAGGGACCCCAAACAGAGGG - Intronic
1106753953 13:32802578-32802600 GCCCAGGATGCCCTAACAGGAGG + Intergenic
1108001996 13:45912185-45912207 AGCCAATCAGCCCAAACAGAGGG - Intergenic
1109294847 13:60517606-60517628 GGCTGGGAAGCCCATAGAGATGG - Intronic
1109755916 13:66760376-66760398 AGTCAGGGACCCCAAACAGAGGG + Intronic
1110311536 13:74055852-74055874 GCCCAGGAAGGACAAACAGCAGG + Intronic
1111324808 13:86680348-86680370 GGCCTAGAAGCCCAAAGAAATGG + Intergenic
1111509500 13:89242558-89242580 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1111813044 13:93115816-93115838 GGCCAGGAATTCAGAACAGATGG - Intergenic
1112960632 13:105121037-105121059 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1113260145 13:108552802-108552824 GGCCAGGAAGCCCAAGGTCAAGG + Intergenic
1113804566 13:113105871-113105893 AGCCCTGAAGCCCAAGCAGAAGG - Exonic
1114213004 14:20632098-20632120 AGCCTGGAGGCCCAAAGAGAAGG - Intergenic
1114215557 14:20655393-20655415 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1116562678 14:46401636-46401658 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1116727221 14:48575904-48575926 GGCCAGGAAGCTCGAACAGGGGG - Intergenic
1118376244 14:65179678-65179700 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1119288651 14:73476608-73476630 AGCCAGCAAGACCATACAGAGGG - Intergenic
1119728271 14:76935412-76935434 GGCCTGGAATGCAAAACAGAGGG - Intergenic
1119869214 14:78000914-78000936 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1120292652 14:82595417-82595439 TGCCAGGAACCCCATACATATGG - Intergenic
1121266361 14:92604866-92604888 TGACAGGAAGCCTCAACAGAAGG - Intronic
1124186191 15:27531519-27531541 TGCCAGGAAGCCCACTGAGAAGG + Intronic
1124618136 15:31257213-31257235 GGCTAGGAAGCCCAAAATCAAGG - Intergenic
1125583274 15:40802628-40802650 GGCCAGGGAGCCTTAGCAGAAGG + Intronic
1126059890 15:44770436-44770458 AGTCAGGGATCCCAAACAGAGGG + Intergenic
1127496102 15:59513492-59513514 GGGTAGGAAGCACAATCAGATGG + Intronic
1129267224 15:74400210-74400232 GGCCCTGCAGCCCAAGCAGAGGG + Intergenic
1131038306 15:89240191-89240213 GGCCATGACGCCCACACTGAAGG - Intergenic
1131165561 15:90139793-90139815 GGCCACGACGCCCACACTGAAGG - Intergenic
1132505499 16:306473-306495 GGGCAGGAAGGCCACACACACGG - Intronic
1133393483 16:5427880-5427902 GGCCACGATGCCCAGATAGATGG - Intergenic
1134029731 16:10982257-10982279 GGCCAGGATGCAAAATCAGAGGG - Intronic
1136540959 16:30927519-30927541 GGCCAGGAAGCCCAGAGCCAGGG - Intronic
1137396290 16:48117968-48117990 GGCCAAGAGGCCCAAAGAGCAGG - Intronic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1137632559 16:49957180-49957202 AGCAAGGAAGCCCAAATAGGAGG + Intergenic
1138767591 16:59622982-59623004 AGTGAGGAACCCCAAACAGAGGG - Intergenic
1139498047 16:67335688-67335710 AGTCAGGGACCCCAAACAGAGGG - Intronic
1141753795 16:85977855-85977877 GGGCAGGAATCCCAGACACAAGG - Intergenic
1141841507 16:86576944-86576966 ACCCAGGAACCCCAAACACACGG + Intronic
1142460328 17:86921-86943 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1143466304 17:7139099-7139121 GGCTAGGAAGCCCAAGGTGAAGG + Intergenic
1144269614 17:13603071-13603093 GGCAAGGAAGCCAAAAAATAAGG - Intergenic
1144509239 17:15861066-15861088 GTCCAGGAGGACAAAACAGAAGG - Intergenic
1145173357 17:20678711-20678733 GTCCAGGAGGACAAAACAGAAGG - Intergenic
1145959159 17:28876386-28876408 TGTAAGGAAGCCCAAACAGAGGG - Intergenic
1147509028 17:41049724-41049746 AGTCAGGAACCCCAAACGGAGGG + Intergenic
1147653618 17:42076049-42076071 AGCCAGCAAGCCCAAACATACGG - Intergenic
1148639029 17:49171041-49171063 GGCCATGATGCCCAAACTGAAGG - Intergenic
1148783425 17:50134042-50134064 GGACAAGAAGCCAAAACGGATGG + Exonic
1149857275 17:60093770-60093792 AGTCAGGAACCCCAAACGGAGGG - Intergenic
1150358920 17:64511898-64511920 AGTCAGGGACCCCAAACAGAGGG - Intronic
1150447288 17:65236769-65236791 AGCCAGGAACCCCAAATGGAGGG + Intergenic
1151192137 17:72406364-72406386 GGCCAGGAAACCCAGAGAGAAGG + Intergenic
1151544707 17:74785660-74785682 GCCCAGGAAGCCCGAACATGAGG + Intronic
1153948728 18:10039305-10039327 GGCCAGGAAGCCAAACAAAATGG - Intergenic
1153983872 18:10335822-10335844 GGCCAGGAAGTCCAAAAAGCCGG + Intergenic
1154444590 18:14424719-14424741 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1155909050 18:31487463-31487485 GGCCTGGAGGCCCCAACAGAAGG - Intergenic
1157301608 18:46483670-46483692 GGCAAGGTGGCCCACACAGAGGG + Exonic
1157537985 18:48474767-48474789 GGCCAGGAAGTCCAAGCTCAAGG - Intergenic
1157756342 18:50221198-50221220 AGCCAGGGACCCCAAACGGAGGG - Intergenic
1157843856 18:50984136-50984158 GCCCAGGAAGGCCAAAGAAATGG - Exonic
1159347660 18:67227687-67227709 AGTCAGGCACCCCAAACAGAGGG + Intergenic
1160973079 19:1778550-1778572 GGCCTTGAAGGCCAAGCAGAGGG - Exonic
1161288529 19:3480616-3480638 GGGCAGGATGCCCAATCAGGTGG - Intergenic
1162895664 19:13763524-13763546 GGCCAGGAACCACACACACAAGG + Intergenic
1163153510 19:15428212-15428234 GGCCAAGAAGGCCAAGCTGAAGG - Intronic
1164326492 19:24197275-24197297 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1164861307 19:31564356-31564378 GGCCATGAGGGCCAAACACATGG - Intergenic
1166168837 19:41012511-41012533 ATCCAGGATGCCCAAACAGGAGG - Intronic
1166244444 19:41515583-41515605 GGGCAGAAAGATCAAACAGAAGG - Intergenic
1166426929 19:42687336-42687358 AGTCAGGGACCCCAAACAGAGGG - Intronic
1167293535 19:48636862-48636884 GACCAGCAAGCCCAAAGAGCCGG - Exonic
1168638220 19:58012807-58012829 GGCCAGGAAGGCTACAAAGAAGG + Intergenic
925976924 2:9148204-9148226 GGTCAGGAAGCCCCCAGAGATGG - Intergenic
926382121 2:12301349-12301371 GGCCAGCAATGCCAAACAGTGGG + Intergenic
926556381 2:14362937-14362959 AGTCAGGGACCCCAAACAGAGGG - Intergenic
927133837 2:20082395-20082417 GGCCAGGAAGTCCAAAAGCATGG - Intergenic
927188514 2:20499830-20499852 GGCCTGGTAGACCAAACTGAGGG + Intergenic
927262850 2:21111446-21111468 GGACAGTAATCCCAAAGAGAAGG - Intergenic
928490991 2:31783091-31783113 AGTCAGGAACCCCGAACAGAGGG + Intergenic
929658911 2:43763283-43763305 GGCCAGGAAGCACACACAGGTGG + Intronic
929833192 2:45366837-45366859 GGGCAAGAATCCCAAATAGAAGG + Intergenic
930183090 2:48384608-48384630 GGCCATGACGCCCACACTGAAGG + Intergenic
930183742 2:48390235-48390257 GGCCATGACGCCCACACTGAAGG + Intergenic
931578427 2:63746064-63746086 AGTCAGGGACCCCAAACAGAGGG + Intronic
931984709 2:67730492-67730514 GGCCAGGCAGCCCTAACAGAGGG - Intergenic
932233689 2:70103710-70103732 GGCCAAGAAGCCCACCCAGATGG - Intergenic
932762485 2:74447920-74447942 GGCCAGGCAGCACAAACTTATGG - Intergenic
933354848 2:81197667-81197689 GCTCAGGAAGGCCAAACTGAAGG - Intergenic
933976286 2:87514731-87514753 GGACAGCAAGCCCAAACGGGCGG - Intergenic
934535650 2:95131061-95131083 AGTCAGGGACCCCAAACAGAGGG - Intronic
934619700 2:95796672-95796694 GGCCAGGAAGCAGGACCAGATGG - Intergenic
934641188 2:96027885-96027907 GGCCAGGAAGCAGGACCAGATGG + Intronic
934687993 2:96335643-96335665 CCCCAAGAAGCCCAATCAGACGG + Intergenic
935844006 2:107144911-107144933 GGCCAGGAAGCTCAAACTGGTGG - Intergenic
936241804 2:110794262-110794284 GGCCAGAGAGCACACACAGAGGG - Intronic
936317536 2:111436075-111436097 GGACAGCAAGCCCAAACGGGCGG + Intergenic
938670951 2:133586321-133586343 GGCCAGGAATCGGAAGCAGAAGG - Intergenic
938858499 2:135341280-135341302 AGTCAGGGACCCCAAACAGAGGG + Intronic
939133109 2:138261720-138261742 AGTCAGGGACCCCAAACAGAGGG + Intergenic
939246173 2:139626114-139626136 AGTCAGGGACCCCAAACAGAGGG - Intergenic
941249647 2:163146425-163146447 GGCCATGATGCCCACACTGAAGG - Intergenic
942866537 2:180682653-180682675 AGTCAGGGACCCCAAACAGAGGG - Intergenic
943606682 2:189984807-189984829 AGTCAGGGACCCCAAACAGAGGG - Intronic
944992416 2:205253393-205253415 GGCCAAGAAGACCAAACGTATGG - Intronic
945371029 2:209018208-209018230 AGTCAGGGACCCCAAACAGAGGG + Intergenic
945488376 2:210425512-210425534 AGTCAGGGACCCCAAACAGAGGG - Intergenic
946477807 2:220025439-220025461 AGCCAGGCAGCCCAAACAAATGG - Intergenic
946706346 2:222462173-222462195 GGCCAAGAAACTCAAGCAGATGG + Intronic
946734843 2:222743998-222744020 GACCAGGAAACGCAAACAGATGG + Intergenic
948055714 2:235008088-235008110 GGAGAGGAAGGCCACACAGAGGG - Intronic
948998555 2:241597688-241597710 AGCCAGGAAGCACACACAGAAGG - Intronic
1169280775 20:4265171-4265193 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1169388179 20:5168685-5168707 TGGCAGGAAACCCAAACAGCAGG + Intronic
1169483480 20:6006362-6006384 GGCCAGGCAGCCCAAGCAGCAGG - Exonic
1169760556 20:9087887-9087909 GTCCAGGCAGCCCACTCAGATGG + Intronic
1170618942 20:17978134-17978156 GGCCAGGAAGCCGAAAGAGTGGG + Intronic
1171232301 20:23497278-23497300 AGTCAGGAACCCCGAACAGAGGG - Intergenic
1172678660 20:36694979-36695001 AGTCAGGGACCCCAAACAGAGGG + Intronic
1173234159 20:41228486-41228508 GGCCAGGAAGTCCAAGATGAAGG + Intronic
1173522397 20:43709749-43709771 GGCCAGGAGCCCCAGACAGGTGG - Intronic
1174096382 20:48092765-48092787 CGCCAAGCAGCCCACACAGATGG - Intergenic
1174487931 20:50872863-50872885 GGCCTGGAAGACCAGACAGAAGG - Intronic
1175923475 20:62460952-62460974 GGTCAGGAAGCCCCAGCTGACGG + Intergenic
1176150650 20:63589086-63589108 GGCCAAGCAGCCCAAGCTGAAGG + Exonic
1176451392 21:6865142-6865164 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1176829561 21:13730193-13730215 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1179957440 21:44749455-44749477 GGCAAGGGAGCCCAAGGAGAAGG + Intergenic
1181345856 22:22220162-22220184 GCCCAGGCAGCACAAGCAGAGGG - Intergenic
1181601617 22:23955565-23955587 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1184671196 22:46013042-46013064 GGCCAGGAAGCCCCGAGAGGAGG - Intergenic
1184887770 22:47356848-47356870 GGCCAGGAATCCCCAAGAGAAGG - Intergenic
1185299516 22:50072230-50072252 GGCCAGGAAGCTCAGCCATAGGG + Intronic
949980080 3:9497029-9497051 GGTCAGGAAGGTCAAAGAGAAGG - Intergenic
950198672 3:11027766-11027788 GGTCAGGGACCCCAAACAGAGGG - Intronic
951081071 3:18450396-18450418 AGTCAGGGACCCCAAACAGAGGG - Intergenic
951978562 3:28541500-28541522 AGTCAGGGACCCCAAACAGAGGG - Intergenic
953125871 3:40091257-40091279 GGCCAGGAAACCCAAAATGTGGG - Intronic
953125899 3:40091423-40091445 GGCCAGGAAACCCAAAATGTTGG - Intronic
953383003 3:42488269-42488291 GGCCAGAAAGCCCAAGGATAGGG - Intergenic
953725878 3:45398506-45398528 GGCCAGGAAGAAAAAACAGAAGG + Intronic
953726926 3:45407852-45407874 GGGAAGGAAGCCCAAGCAGCTGG - Intronic
953751419 3:45611462-45611484 AGGCAGAAAGCCCAAAGAGATGG + Intronic
954385450 3:50241614-50241636 GGAGAGGAACCCCAGACAGAGGG + Intronic
954613370 3:51957725-51957747 GGCCAGGAAGCCCTAAGGGATGG + Exonic
959118889 3:102209419-102209441 AGTCAGGGACCCCAAACAGAGGG - Intronic
959224586 3:103563710-103563732 AGTCAGGGACCCCAAACAGAGGG + Intergenic
959887938 3:111524155-111524177 AGTCAGGGACCCCAAACAGAGGG + Intronic
960112902 3:113862850-113862872 AGTCAGGAACCCCGAACAGAGGG - Intronic
960374318 3:116879468-116879490 AGTCAGGGACCCCAAACAGAGGG - Intronic
960784389 3:121356343-121356365 GGCCGGGAAGCTCAAAATGAGGG - Intronic
961066369 3:123880610-123880632 GGCAAGGAAGTACCAACAGAGGG + Intronic
961922669 3:130444526-130444548 GGTCAGGGACCCCAAACGGAGGG - Intronic
961941464 3:130641806-130641828 GGCCAAGAAGCAGAGACAGAAGG - Intronic
962765394 3:138557593-138557615 AGTCAGGGACCCCAAACAGAGGG - Intronic
963176646 3:142304646-142304668 AGTCAGGGACCCCAAACAGAGGG - Intergenic
963519490 3:146346459-146346481 AGTCAGGGACCCCAAACAGAGGG + Intergenic
964135439 3:153340298-153340320 GGCCATGACGCCCACACTGAAGG + Intergenic
965068154 3:163879182-163879204 AGTCAGGGACCCCAAACAGAGGG - Intergenic
965081674 3:164040869-164040891 GGCCAAGCAGCCCACACAAAAGG + Intergenic
965402669 3:168231623-168231645 GGCCAGGAAGCCCCTAAACATGG - Intergenic
965418481 3:168426888-168426910 GGCCAGGAAGCCCAAGATCAGGG - Intergenic
965940031 3:174168727-174168749 GGGCAGGGAGCCAAAACAGGAGG + Intronic
967412851 3:189184107-189184129 AGTCAGGGACCCCAAACAGAGGG - Intronic
968189412 3:196656794-196656816 TGCCAGGAAGCCCAAAGAGTGGG + Intronic
968868483 4:3228448-3228470 GGCAAGGGAGCCCACAGAGAGGG - Intronic
968972024 4:3800950-3800972 GGGCAGGTAGCCCCAACAGAGGG + Intergenic
969673425 4:8601986-8602008 GGCCTGGAAGATCACACAGAGGG + Intronic
970719649 4:18971457-18971479 AGTCAGGGACCCCAAACAGAGGG - Intergenic
970772674 4:19634292-19634314 GGCCATGACGCCCACACTGAAGG + Intergenic
971365757 4:25975815-25975837 AGTCAGGGACCCCAAACAGAGGG + Intergenic
972301844 4:37792191-37792213 TGCCTGGATGCCCAAGCAGAAGG + Intergenic
972947295 4:44271560-44271582 GGCCATGATGCCCACACTGAAGG + Intronic
973615457 4:52673298-52673320 AGTCAGGGACCCCAAACAGAGGG - Intergenic
974164703 4:58186185-58186207 AGTCAGGGACCCCAAACAGAGGG - Intergenic
974983259 4:68988647-68988669 AGTCAGGAACCCCAAACAGAGGG + Intergenic
975021855 4:69500935-69500957 TGCCAGGAAGCCCAGAAAGCTGG - Intronic
975024836 4:69535099-69535121 AGTCAGGGACCCCAAACAGAGGG + Intergenic
975351972 4:73357235-73357257 GGCCATGATGCCCACACTGAAGG + Intergenic
975402532 4:73954182-73954204 AGTCAGGGACCCCAAACAGAGGG - Intergenic
975826930 4:78330066-78330088 AGTCAGGGACCCCAAACAGAGGG + Intronic
976876209 4:89856612-89856634 GGCCAGGAAGCCCAAACTGGGGG + Intergenic
977388856 4:96382266-96382288 AGTCAGGGACCCCAAACAGAGGG - Intergenic
977642502 4:99372713-99372735 GGCCATGATGCCCAAGCTGAAGG + Intergenic
978211903 4:106147429-106147451 AGTCAGGGACCCCAAACAGAGGG + Intronic
978467219 4:109021317-109021339 AGTCAGGGACCCCAAACAGAGGG + Intronic
979678203 4:123432599-123432621 AGTCAGGGACCCCAAACAGAGGG + Intergenic
979993771 4:127407146-127407168 AGTCAGGGACCCCAAACAGAGGG + Intergenic
980659842 4:135842875-135842897 GGCCAGGAAGCATAAACTCATGG - Intergenic
981197455 4:141938264-141938286 GGCCATGATGTCCACACAGAAGG - Intergenic
981197836 4:141941507-141941529 GGCCATGATGCCCACACTGAAGG - Intergenic
982035679 4:151343499-151343521 GGCCAGGAAGAGCAATGAGAAGG + Intergenic
982282157 4:153694315-153694337 GGCCATGACGCCCACACTGAAGG - Intergenic
982657864 4:158171220-158171242 CACCAGGAAGCCCAAGTAGATGG + Exonic
983303478 4:165956855-165956877 AGTCAGGGACCCCAAACAGAGGG - Intronic
983419041 4:167494978-167495000 AGTCAGGGACCCCAAACAGAGGG + Intergenic
984587223 4:181578316-181578338 GGCGAGGAGGCCTAATCAGAGGG - Intergenic
985501077 5:246127-246149 GGCCATAAAGCCCAAATAAATGG + Intronic
985694292 5:1331249-1331271 GGCCAGGCAGCCCAGGCAGGAGG - Intronic
985735767 5:1581061-1581083 GGCCATAAAGCCCAAATAAATGG - Intergenic
986524234 5:8655806-8655828 GGACAGGAAAGCAAAACAGAAGG + Intergenic
986534190 5:8769328-8769350 GGCCGAGAAGCCCAAACAGAAGG - Intergenic
986666354 5:10108211-10108233 GGACCGGAAGTCCAAACTGAAGG + Intergenic
988222689 5:28369368-28369390 AGTCAGGGACCCCAAACAGAGGG - Intergenic
988720271 5:33870478-33870500 AGTCAGGGACCCCAAACAGAGGG - Intronic
988830520 5:34982589-34982611 AGTCAGGGACCCCAAACAGAGGG - Intergenic
989387045 5:40864397-40864419 AGTCAGGGACCCCAAACAGAGGG + Intergenic
989420221 5:41229874-41229896 AGTCAGGGACCCCAAACAGAGGG + Intronic
989829135 5:45892372-45892394 AGTCAGGGAACCCAAACAGAGGG - Intergenic
990704505 5:58513420-58513442 AGCCAGGGACCCCGAACAGAGGG + Intergenic
991114446 5:62938223-62938245 GGCAGGGAAGCCCAAGTAGATGG - Intergenic
991712496 5:69421861-69421883 AGTCAGGGACCCCAAACAGAGGG + Intronic
992229732 5:74652349-74652371 GGCCAGGAGGCCCACACACTAGG - Intronic
992690758 5:79237661-79237683 GGCCAGGAAGCGCATCCAGGAGG + Exonic
992955107 5:81900532-81900554 AGTCAGGGACCCCAAACAGAGGG + Intergenic
994103117 5:95915774-95915796 GGCCAGGAAGAGCAAAAAGAAGG + Intronic
994734272 5:103533156-103533178 AGCCAGGAACCCCAAATGGAGGG + Intergenic
994986624 5:106941635-106941657 GGACTGGAAGCACAATCAGAAGG - Intergenic
995938441 5:117547896-117547918 GGCCTGGAAACCTGAACAGAAGG - Intergenic
996100014 5:119436220-119436242 AGTCAGGGACCCCAAACAGAGGG + Intergenic
996146911 5:119987740-119987762 AGTCAGGGAGCCCAAACAGAGGG - Intergenic
998402251 5:141853937-141853959 GGCCAGGAAGTCCACGCTGAAGG + Exonic
998969933 5:147580032-147580054 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1000471841 5:161652657-161652679 AGTCAGGGACCCCAAACAGAGGG - Intronic
1004164606 6:13245054-13245076 AGTCAGGGACCCCAAACAGAGGG - Intronic
1004371972 6:15060548-15060570 GGCCAGGAAGTCCAAAATCAAGG + Intergenic
1004738658 6:18434141-18434163 GTCCGGAAAGCCCAAACAGAAGG - Intronic
1006218432 6:32466511-32466533 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1007406913 6:41640548-41640570 GCCCAGGAAGCCCAAACCGCAGG + Intronic
1007789596 6:44301470-44301492 GGGCAGGAAGGACAAGCAGAGGG + Intronic
1008251304 6:49243176-49243198 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1008983979 6:57519920-57519942 AGTCAGGGACCCCAAACAGAGGG - Intronic
1009172039 6:60412828-60412850 AGTAAGGAACCCCAAACAGAGGG - Intergenic
1009544089 6:65002713-65002735 AGTCAGGGACCCCAAACAGAGGG + Intronic
1009630781 6:66197686-66197708 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1010103052 6:72132370-72132392 AGTCAGGGACCCCAAACAGAGGG - Intronic
1010831961 6:80541920-80541942 GGCCATGAGGCCCAAATAGTTGG + Intergenic
1011066026 6:83326915-83326937 AGTCAGGGACCCCAAACAGAGGG + Intronic
1011746227 6:90410339-90410361 GGCAAAGAAGCCCATCCAGAAGG - Intergenic
1013519161 6:110916844-110916866 GGCCATGATGCCCACACTGAGGG + Intergenic
1013973460 6:116047946-116047968 TGCAAGGAAGCACAAAAAGATGG + Intronic
1014044871 6:116874368-116874390 GGGCAAGAAGCCAACACAGATGG + Intergenic
1014251341 6:119118461-119118483 AGTCAGGGACCCCAAACAGAGGG + Intronic
1015341917 6:132110518-132110540 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1016193056 6:141294484-141294506 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1016337670 6:143025255-143025277 GGCCAGGAAGCTCAAGAACAAGG + Intergenic
1016382891 6:143503261-143503283 GCCCAGGAAGTGCAAGCAGAAGG + Intronic
1018149326 6:160923902-160923924 TGCTAGGAAGCCCAGACACATGG - Intergenic
1019002904 6:168770503-168770525 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1019452483 7:1106943-1106965 GGCCAGGAGCCCCCAACAGCAGG + Intronic
1019701263 7:2475970-2475992 GGCCAGGCCGCCCGCACAGAAGG + Exonic
1020387826 7:7627039-7627061 GGTCAGGGACCCCAAACGGAGGG - Intergenic
1020803576 7:12761099-12761121 TGTCAGGGACCCCAAACAGAGGG - Intergenic
1022155055 7:27652607-27652629 GGCCAGGAAGTCCAACATGAAGG + Intronic
1022509047 7:30923611-30923633 GGAGATGAAGCCCAAATAGAAGG + Exonic
1022686833 7:32604871-32604893 AGTCAGGAACCCCAAACTGAGGG - Intergenic
1022953973 7:35364454-35364476 CTCCAGGAAGCCCAAACTGAAGG + Intergenic
1023942828 7:44781037-44781059 GGCCAGGACTCCCAGACAGTTGG + Intergenic
1024118216 7:46212666-46212688 TGACAGGAAGCCCACACAGAGGG + Intergenic
1024929238 7:54652579-54652601 GGACAGGAAACACAAAGAGAAGG + Intergenic
1024946060 7:54808505-54808527 AGACAGGAATCCCGAACAGAGGG + Intergenic
1025759994 7:64380864-64380886 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1029635791 7:101782889-101782911 GGCCAGGAACCCCATAAAGCTGG - Intergenic
1030071042 7:105697838-105697860 AGTCAGGGACCCCAAACAGAGGG - Intronic
1030688914 7:112512983-112513005 TGCCAGGAAAGCCAAAAAGAGGG - Intergenic
1031125830 7:117772446-117772468 GGCCAAGAAGCCTAAACATTAGG + Intronic
1031229392 7:119085668-119085690 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1031425153 7:121596170-121596192 GGCTAGGAAGCACTTACAGATGG - Intergenic
1031560017 7:123227324-123227346 AGTCAGGAACCCCAAACGGAGGG + Intergenic
1031640369 7:124156004-124156026 GGACAGGTAGACAAAACAGATGG - Intergenic
1032496634 7:132367892-132367914 GACCAGGAAGGCCAAATAGCTGG + Intronic
1033720699 7:144056418-144056440 GGATAGGAAGCCCAAAGAGCTGG + Intergenic
1033721163 7:144060683-144060705 AGTCAGGAACACCAAACAGATGG + Intergenic
1034251716 7:149697429-149697451 AGTCAGGGATCCCAAACAGAGGG + Intergenic
1034354487 7:150442122-150442144 GGCCAGGAAGCCCTGAGAGAAGG - Intergenic
1034583917 7:152071809-152071831 AGTCAGGGACCCCAAACAGAGGG - Intronic
1035336023 7:158127428-158127450 GACCAGGAAACCCAAGCACAGGG + Intronic
1037287934 8:17320855-17320877 GGACAGAAAGCCCAAACAGCAGG - Intronic
1037808867 8:22074228-22074250 GGCCTGGGAGGCCAAACTGAGGG + Intronic
1040880298 8:52197717-52197739 GGGCAGGGAGGCCAAAAAGAAGG + Intronic
1041036806 8:53799892-53799914 GGCCAGGAAGTCCAAGATGAAGG - Intronic
1041608437 8:59814137-59814159 GGAAATGAAACCCAAACAGAAGG + Intergenic
1041799751 8:61786284-61786306 GGCCAGGAAGAGCAAACAAATGG + Intergenic
1042072882 8:64956046-64956068 GGCCAGGAAGCTCGAACTGGGGG + Intergenic
1042084411 8:65092093-65092115 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1043024553 8:75049689-75049711 GGCCATGATGCCCACACTGAAGG + Intergenic
1043327388 8:79069685-79069707 AGCCAGGGACCCCAAACGGAGGG + Intergenic
1044066842 8:87708685-87708707 AGTCAGGAACCCCGAACAGAGGG - Intergenic
1045058805 8:98393578-98393600 GGGCAGGAATCCCAAGCAAAGGG - Intergenic
1045813910 8:106257521-106257543 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1046043966 8:108941952-108941974 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1046469521 8:114652693-114652715 GGCCAAGAATCCCAACAAGATGG - Intergenic
1047624700 8:126644535-126644557 TGCCAGGAAGCCCAAAACCAAGG - Intergenic
1047963140 8:130025387-130025409 CAACAGGAAGCCCAAGCAGATGG - Intergenic
1048002848 8:130393762-130393784 AGTCAGGGACCCCAAACAGAGGG + Intronic
1048104372 8:131391582-131391604 GGACTAGAAGCCCAAGCAGATGG - Intergenic
1048602225 8:135930697-135930719 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1048809750 8:138275208-138275230 AGTCAGGGACCCCAAACAGAGGG - Intronic
1049247084 8:141568673-141568695 ATCCAGGAAGCCCAAGCAGCTGG + Intergenic
1049513468 8:143041790-143041812 TGTCAGGGACCCCAAACAGAGGG - Intronic
1049815731 8:144598462-144598484 GGCCAGCAGGACCAGACAGACGG + Intronic
1050766656 9:9142869-9142891 GACCAGGAAGCCCAACAATATGG - Intronic
1050817528 9:9834205-9834227 AGTCAGGGACCCCAAACAGAGGG - Intronic
1051833731 9:21310871-21310893 AGTCAGGAACCCCGAACAGAGGG + Intergenic
1052061031 9:23961684-23961706 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1053130066 9:35609585-35609607 GGACAGGAAGCCAAAGCTGAAGG - Exonic
1053343865 9:37363600-37363622 GGCCAGAAAGCCAAGACACAAGG - Intergenic
1053510140 9:38680715-38680737 GGGCAGGAAGCACAGAGAGAAGG + Intergenic
1055731318 9:79281877-79281899 AGAAAGGAACCCCAAACAGAGGG + Intergenic
1056470406 9:86900176-86900198 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1057200753 9:93138618-93138640 GGGAAGGAACCCTAAACAGAAGG + Intergenic
1057915943 9:99055327-99055349 GGCCTGGAGGCCCAGACATAAGG - Exonic
1057925836 9:99147750-99147772 GGCCAAATATCCCAAACAGATGG + Exonic
1058137978 9:101328312-101328334 AGCCAGGGACCCCACACAGAGGG - Intergenic
1058265124 9:102889690-102889712 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1060530836 9:124346343-124346365 GACCAGGAAACCCAAGCTGACGG + Intronic
1061768670 9:132900087-132900109 GCCCAAGAAACCCAAAAAGAAGG + Intronic
1062552722 9:137097447-137097469 TGCCAGGATGGCCACACAGACGG - Intronic
1203517789 Un_GL000213v1:19375-19397 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1187122533 X:16423241-16423263 AGTCAGGAATCCCAAACGGAGGG - Intergenic
1188038158 X:25341385-25341407 GGCCATGATGCCCACACTGAAGG + Intergenic
1189200021 X:39186006-39186028 GGCCAGGAAGCTCAAACAGGTGG - Intergenic
1190001932 X:46697385-46697407 AGTCAGGGACCCCAAACAGAGGG + Intronic
1191155019 X:57265231-57265253 TGCCAGGAAGCCCAGAAAGCTGG - Intergenic
1191160993 X:57329747-57329769 AGTCAGGGACCCCAAACAGAGGG + Intronic
1191696100 X:63992432-63992454 GGCTAGGAAGCCCAAGAACATGG - Intergenic
1191803169 X:65103720-65103742 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1192151061 X:68712690-68712712 GGCCAGGATGCCCAGACAGTAGG + Intronic
1192509315 X:71712592-71712614 GGGCAGGATGCCCACAGAGAGGG - Intergenic
1192517382 X:71768961-71768983 GGGCAGGATGCCCACAGAGAGGG + Intergenic
1193289043 X:79750181-79750203 GGCCATGACGCCCACACTGAAGG - Intergenic
1194226913 X:91272415-91272437 GGCCAGGAGCCCACAACAGAGGG - Intergenic
1195656680 X:107337918-107337940 CTCCAGGAAGCCCAGTCAGAGGG - Intergenic
1196160764 X:112479879-112479901 AGCCAGTAAGCCAAAACAAAGGG + Intergenic
1196179216 X:112671796-112671818 GGCCAGGAAGTCCATTCAGCTGG - Intronic
1197358397 X:125466678-125466700 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1197364793 X:125550114-125550136 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1197414030 X:126152055-126152077 GGCTAGGAAGCCCAAAGTCAAGG + Intergenic
1198023288 X:132680283-132680305 AGTCAGGGACCCCAAACAGAGGG - Intronic
1198378527 X:136062670-136062692 GGCAAGGAGGTCCAGACAGATGG + Intergenic
1199328226 X:146527287-146527309 GGCTAAGAAGTCCAAACTGAAGG + Intergenic
1199587847 X:149435237-149435259 GGCCAGGAAGATCAAAGAGTAGG - Intergenic
1199884133 X:152002313-152002335 AGTCAGGGACCCCAAACAGAGGG + Intergenic
1200070473 X:153526641-153526663 GGCGAGGATGCCCAGAGAGAGGG - Intronic
1200117433 X:153775498-153775520 GGCCAGGAAGCCCCAGCAGGTGG + Intronic
1201343075 Y:12954714-12954736 AGTCAGGGACCCCAAACAGAGGG - Intergenic
1202346360 Y:23932219-23932241 AGTCAGGAACCCCGAACAGAGGG - Intergenic
1202524411 Y:25737871-25737893 AGTCAGGAACCCCGAACAGAGGG + Intergenic