ID: 1091791197

View in Genome Browser
Species Human (GRCh38)
Location 12:3273212-3273234
Sequence CCAAATCCTGGCCCTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091791191_1091791197 19 Left 1091791191 12:3273170-3273192 CCTGCTCTAGGCTCTGCGGATTT 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1091791197 12:3273212-3273234 CCAAATCCTGGCCCTCAAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 216
1091791190_1091791197 20 Left 1091791190 12:3273169-3273191 CCCTGCTCTAGGCTCTGCGGATT 0: 1
1: 0
2: 3
3: 14
4: 178
Right 1091791197 12:3273212-3273234 CCAAATCCTGGCCCTCAAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 216
1091791192_1091791197 -6 Left 1091791192 12:3273195-3273217 CCACAAAAACAACAGACCCAAAT 0: 1
1: 0
2: 4
3: 61
4: 435
Right 1091791197 12:3273212-3273234 CCAAATCCTGGCCCTCAAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 216
1091791188_1091791197 24 Left 1091791188 12:3273165-3273187 CCAGCCCTGCTCTAGGCTCTGCG 0: 1
1: 0
2: 0
3: 46
4: 347
Right 1091791197 12:3273212-3273234 CCAAATCCTGGCCCTCAAGGAGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091791197 Original CRISPR CCAAATCCTGGCCCTCAAGG AGG Intronic