ID: 1091792106

View in Genome Browser
Species Human (GRCh38)
Location 12:3277852-3277874
Sequence AATTTCCCACAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 327}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091792106_1091792108 -4 Left 1091792106 12:3277852-3277874 CCTTTCTCCATCTGTGGGAAATT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 1091792108 12:3277871-3277893 AATTGTTCTTCAGACTCCAGTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1091792106_1091792109 4 Left 1091792106 12:3277852-3277874 CCTTTCTCCATCTGTGGGAAATT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 1091792109 12:3277879-3277901 TTCAGACTCCAGTGGACAAATGG 0: 1
1: 0
2: 2
3: 21
4: 210
1091792106_1091792111 12 Left 1091792106 12:3277852-3277874 CCTTTCTCCATCTGTGGGAAATT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 1091792111 12:3277887-3277909 CCAGTGGACAAATGGCCCTTCGG 0: 1
1: 0
2: 2
3: 6
4: 114
1091792106_1091792112 13 Left 1091792106 12:3277852-3277874 CCTTTCTCCATCTGTGGGAAATT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 1091792112 12:3277888-3277910 CAGTGGACAAATGGCCCTTCGGG 0: 1
1: 0
2: 0
3: 18
4: 113
1091792106_1091792113 26 Left 1091792106 12:3277852-3277874 CCTTTCTCCATCTGTGGGAAATT 0: 1
1: 0
2: 4
3: 32
4: 327
Right 1091792113 12:3277901-3277923 GCCCTTCGGGTCAGAGTAACAGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091792106 Original CRISPR AATTTCCCACAGATGGAGAA AGG (reversed) Intronic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
903375074 1:22860624-22860646 AATGCCCCGCAGATGGAGGAGGG + Intronic
904864674 1:33569056-33569078 AATTTGCCAAAAATGGAGACTGG + Intronic
904908365 1:33915056-33915078 AAGTTCCCACTGATTCAGAAGGG - Intronic
906709217 1:47916654-47916676 AAATCCACACAGGTGGAGAAGGG + Intronic
907654475 1:56328257-56328279 AAGTTCCCATAGCTGGTGAATGG - Intergenic
907995014 1:59621832-59621854 AATTTCCCAAACTTGGTGAAAGG - Intronic
908736333 1:67280713-67280735 AATGTCACTCAGATGGATAATGG - Intergenic
911241207 1:95469578-95469600 AATTTCCCAAACCTAGAGAAAGG - Intergenic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
911875836 1:103161820-103161842 AATTTCCCACCAAATGAGAATGG + Intergenic
912122413 1:106488623-106488645 AACTTCCCACATTTGAAGAAAGG - Intergenic
912945370 1:114080002-114080024 TTTTGCCCACAGAAGGAGAAAGG - Intergenic
914922652 1:151858055-151858077 AAATTCATACAGAAGGAGAAGGG - Intergenic
914976758 1:152372031-152372053 AATTTTCAACAGATGTACAAAGG + Intergenic
914997460 1:152557544-152557566 AATTACCCCAAGATGTAGAAAGG - Intronic
915033638 1:152904947-152904969 AATTTCCTTTAGTTGGAGAAGGG + Intergenic
915293399 1:154901727-154901749 AAACTCCCACAAATGCAGAAAGG + Intergenic
917431666 1:174975630-174975652 AACTTCCAACTGGTGGAGAATGG - Intronic
917814485 1:178693612-178693634 AAATTCCCCTGGATGGAGAAAGG - Intergenic
918413772 1:184286875-184286897 AATTCCCCACAGATGGGGCTGGG - Intergenic
918525749 1:185463076-185463098 GACTTCCCACAGATTAAGAAAGG + Intergenic
918587622 1:186205961-186205983 TATTTCCAACATATGGACAATGG + Intergenic
918641427 1:186845461-186845483 AGGATCCCACAGATAGAGAAAGG + Intronic
918664101 1:187127113-187127135 AATATCCCACATATTCAGAAGGG + Intergenic
920545925 1:206818291-206818313 AATGTCCATCAGAAGGAGAATGG + Intronic
920925204 1:210334589-210334611 TATTACCCACAGAAGGAGCAGGG - Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921188042 1:212686446-212686468 AAATTCCCAGAACTGGAGAAGGG + Exonic
923581340 1:235217683-235217705 AATCTCCCACATCTGGACAATGG + Intronic
924170694 1:241337051-241337073 AAGATCACACAGATGGAAAATGG - Intronic
1062876404 10:946306-946328 AGTTTCCCACAGAAGGAAAGGGG - Intergenic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1064792708 10:18976185-18976207 AATTCCCCACAGATAAGGAAGGG + Intergenic
1065958277 10:30711862-30711884 AGTTTCCCCCAAATGGTGAATGG + Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068342465 10:55724365-55724387 AATGTCCCTCAACTGGAGAAGGG + Intergenic
1069311482 10:67043237-67043259 AACATCCCACAGATGATGAATGG + Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1070710983 10:78683060-78683082 TATTTCCCACATGTGGAGAAAGG - Intergenic
1071133254 10:82420767-82420789 AATTTCCTTCAGTGGGAGAATGG + Intronic
1071227331 10:83545966-83545988 AACATCCCACAGCTGGATAAAGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1071798494 10:89031360-89031382 AATTTCACATTGATAGAGAAAGG + Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072150807 10:92681348-92681370 AATGTCCCTCAGATGATGAAGGG - Intergenic
1073511589 10:104045971-104045993 CATTTCCCAAAGAGGGACAAGGG - Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074458657 10:113616919-113616941 CCTTTCCCACAGAGGGAAAAGGG + Intronic
1075245765 10:120821108-120821130 GATTTGCCACCCATGGAGAAGGG + Intergenic
1078337846 11:10477808-10477830 ACTTTCCCAGAGATGGGAAAGGG - Intronic
1078770786 11:14349564-14349586 AGTTTCTCACTGTTGGAGAAGGG - Intronic
1079834397 11:25314963-25314985 AATTTCCCCAATATGGAGAAAGG - Intergenic
1079869940 11:25784639-25784661 ACTTTCCCAAACATTGAGAAGGG + Intergenic
1080101237 11:28462218-28462240 AATTTTCCAGAAATGAAGAAAGG + Intergenic
1080335507 11:31191297-31191319 AATTTTCCACACATAGACAAAGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080813318 11:35727817-35727839 ATTTTCCCACAGATACAGATGGG - Intronic
1080913093 11:36625541-36625563 AATGTCCCACAAAAAGAGAATGG - Intronic
1081654932 11:44850878-44850900 AAGTGCCCACAGATGGGTAAAGG - Intronic
1082706712 11:56501271-56501293 AATTTCCTTCAGTGGGAGAAAGG + Intergenic
1085096399 11:73763903-73763925 TATTTCTCACAGCTGGAGACTGG + Intergenic
1085875478 11:80402243-80402265 GATTACCCACATATGGAGAACGG - Intergenic
1086874969 11:92084662-92084684 AATGTCCCACAGCAGGTGAATGG - Intergenic
1088358011 11:108963179-108963201 CATTTCCAACAGTTGGAGAGTGG + Intergenic
1088464895 11:110124701-110124723 AATTTCCCACTTAAGGTGAAGGG - Intronic
1088811012 11:113392347-113392369 AATATCACAGAGGTGGAGAAGGG + Intronic
1088937139 11:114413939-114413961 AACTACCTAAAGATGGAGAAAGG - Intronic
1089023274 11:115240746-115240768 AATCTCTCACAAATGGAGTAGGG + Intronic
1090590548 11:128262416-128262438 CATTTCCCACAAATGGGAAAGGG - Intergenic
1091006099 11:131955315-131955337 AATTTTCCCCAGATGTTGAAGGG + Intronic
1091101859 11:132881862-132881884 CATTTCCCAGATCTGGAGAAGGG - Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1092206815 12:6619891-6619913 CACTTCCCACCGCTGGAGAAGGG + Exonic
1092732864 12:11550739-11550761 AATTTCTCACTGTTGAAGAAAGG + Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094268872 12:28589222-28589244 CCTTTCTAACAGATGGAGAAGGG + Intergenic
1095453945 12:42362741-42362763 GATTTCCCACAGATGGAAAAAGG - Intronic
1095466483 12:42492572-42492594 AAATTCCTACAGTTGCAGAAAGG - Intronic
1098219285 12:68251786-68251808 GATTTCCCAAAGATGAAGAGAGG - Intronic
1098784142 12:74728266-74728288 AATGTCCCTCACAGGGAGAAAGG - Intergenic
1099517400 12:83614587-83614609 ATTTTGCCTAAGATGGAGAAGGG + Intergenic
1101922917 12:108947511-108947533 AATTTCCCATTATTGGAGAAGGG - Intronic
1102048359 12:109844353-109844375 AAATTCCCACTGATGGACAGTGG - Intergenic
1103030376 12:117607540-117607562 ATTCTCCCACTGCTGGAGAAAGG - Intronic
1103672229 12:122627360-122627382 AATTTCCCACAGAGAGAAACAGG + Intergenic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1106916079 13:34515681-34515703 GATTTCCCACAGAGGCTGAATGG - Intergenic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1108329294 13:49369311-49369333 AATATCCCACAAGTGGGGAATGG + Intronic
1110493118 13:76132947-76132969 AATTTAGCACAGTTGAAGAATGG - Intergenic
1110674962 13:78231086-78231108 AATTTCCTACATCTGGAGTAGGG + Intergenic
1110981429 13:81904505-81904527 AATTTCCCCAAGATGAAGACAGG - Intergenic
1111913663 13:94338911-94338933 CATTGCCCATAGCTGGAGAAGGG + Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115510999 14:34137771-34137793 AATTTCCCAGAAAGGGAGAAAGG + Intronic
1115572340 14:34678460-34678482 AATTTCTCAGAGATGAAGAACGG + Intergenic
1116394488 14:44431078-44431100 CACTTCCCAGAGAGGGAGAATGG + Intergenic
1116581414 14:46646986-46647008 AATATGCCACAGCTGGAGAGTGG + Intergenic
1117294397 14:54365936-54365958 AATTTGCCAGGAATGGAGAATGG - Intergenic
1117718075 14:58601083-58601105 AACGTACCACAGATAGAGAATGG - Intergenic
1119329155 14:73781122-73781144 AAGTTCCCACAGCTGTTGAATGG - Intronic
1119334776 14:73823752-73823774 AATGGGCCACAGATGCAGAAAGG - Intergenic
1119596232 14:75936833-75936855 AATTTCCCAAAGGAAGAGAAAGG + Intronic
1119953816 14:78773479-78773501 AATCTCCTACAGAAGGATAAAGG + Intronic
1119960477 14:78849978-78850000 GATGTACCACATATGGAGAAGGG + Intronic
1120454012 14:84708452-84708474 GATTTCCCACATGTGGGGAAGGG - Intergenic
1120769307 14:88361114-88361136 AATTTCCCACAGGAAGACAAGGG + Intergenic
1121083766 14:91129308-91129330 AATTTCCCTCAGGTAGAGACAGG - Intronic
1121679745 14:95783643-95783665 AATGTTCCCAAGATGGAGAAAGG + Intergenic
1122290867 14:100679776-100679798 GATTACCGACAGAAGGAGAAAGG + Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1124377560 15:29137943-29137965 CATTTCCCACAGATTGACCACGG - Intronic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1124580956 15:30954519-30954541 AATTTCCTTCAGATGATGAAAGG - Intronic
1126497549 15:49308914-49308936 GATTTCCCTGAGATGGAAAAGGG - Intronic
1126594183 15:50369242-50369264 AGTTTCCCACAGATTCATAAAGG + Intergenic
1128702701 15:69815801-69815823 AATTTTCCAGAAATGGAAAATGG - Intergenic
1129044003 15:72717183-72717205 AATGTCACACAGATGGGGACGGG - Intronic
1129743327 15:78000863-78000885 GTGGTCCCACAGATGGAGAAGGG - Intronic
1130329733 15:82912479-82912501 AATGTCCATCAGATGAAGAATGG - Intronic
1130355285 15:83124079-83124101 AATATCCAACAGTGGGAGAATGG + Intronic
1130682538 15:86009282-86009304 AATTCTCTAGAGATGGAGAATGG - Intergenic
1131349587 15:91686172-91686194 AAAGTCCCACAGATTGGGAAAGG + Intergenic
1132614671 16:834586-834608 AATTTCCCACTGAGGGATAGTGG + Intergenic
1133380470 16:5325816-5325838 AATATCCCTCAGAGGGTGAATGG - Intergenic
1134421052 16:14090185-14090207 AATTTCCAACAGAGAGAGAATGG - Intronic
1135039573 16:19107684-19107706 CATTTCCCACAGTGGGAGCAGGG - Intergenic
1136470391 16:30475666-30475688 AAGTTCCCACAGATGGTCAAAGG + Intronic
1138035143 16:53596740-53596762 AGGTGCCCACAGAAGGAGAAGGG - Intergenic
1138957511 16:61989335-61989357 GTTTTCCCACACATGGAGACTGG + Intronic
1139046814 16:63070761-63070783 AATTTCACGAAGATGGAGAGTGG - Intergenic
1140883239 16:79218331-79218353 AATGTCCCACAGTAGGGGAATGG - Intergenic
1141762631 16:86038762-86038784 AATTACCCACGTGTGGAGAAGGG - Intergenic
1141793821 16:86255672-86255694 AATTTCCCAAATATGGTGAAAGG - Intergenic
1141970122 16:87475854-87475876 AATTTCCCACAGCTGGCAGAAGG + Intronic
1203133060 16_KI270728v1_random:1704288-1704310 AGTTTCCAAGAGATGGAGACGGG + Intergenic
1203143112 16_KI270728v1_random:1781874-1781896 TGTATCCCCCAGATGGAGAATGG + Intergenic
1143049894 17:4116362-4116384 AACTTCCAACAGATGGAGTTAGG - Intronic
1143718799 17:8796023-8796045 AACGTCTCACAGCTGGAGAAGGG - Intergenic
1144889808 17:18488103-18488125 AAGATCCCACAGATGACGAATGG - Intronic
1145142406 17:20456214-20456236 AAGATCCCACAGATGACGAATGG + Intronic
1145793502 17:27642694-27642716 AAGATCCCACAGATGATGAATGG - Intronic
1146619536 17:34386698-34386720 GATTTCCCAGAGATGGAGAAGGG - Intergenic
1147024627 17:37569982-37570004 AATATCCAACAGGAGGAGAAAGG - Intronic
1147915885 17:43885586-43885608 AAGTTCTCACTGAAGGAGAAGGG - Intronic
1148294063 17:46484487-46484509 AATTTCCTATAGCTGAAGAAAGG - Intergenic
1148316246 17:46702190-46702212 AATTTCCTATAGCTGAAGAAAGG - Intronic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1150335018 17:64324524-64324546 ACTTACCCACAGAAGAAGAAAGG + Intronic
1150517750 17:65831807-65831829 AATTACTCACAGAAGGAAAAAGG + Intronic
1152314113 17:79570253-79570275 AATTACGGACAGATGGTGAATGG + Intergenic
1153356361 18:4141071-4141093 AACTTCCCAAACATAGAGAAAGG - Intronic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1155133068 18:22958309-22958331 AATTTCCCTCAGTGGCAGAAAGG - Intronic
1157209980 18:45733990-45734012 AATTTTCCATGGATGGGGAATGG - Intronic
1157989070 18:52473565-52473587 CTTTTCACACAGCTGGAGAAAGG + Intronic
1158243234 18:55401630-55401652 TATTCCCCACAAACGGAGAAAGG + Intronic
1159162315 18:64658895-64658917 AATTACACACTGATGCAGAATGG + Intergenic
1161744541 19:6047678-6047700 ACTGTCCCACAGAAGGAGAGAGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163938688 19:20473743-20473765 AATTTGCAACAAAAGGAGAAGGG - Intergenic
1164971209 19:32534230-32534252 ATTTGACCAAAGATGGAGAATGG + Intergenic
1165057153 19:33184902-33184924 AATTTCCCACAAATGAAGTGCGG - Intronic
1165971735 19:39637496-39637518 AATTCCCCACAGGGTGAGAAAGG - Intergenic
1167136647 19:47620306-47620328 CATGTCCCAGGGATGGAGAAAGG + Intronic
1168028993 19:53664906-53664928 ACCACCCCACAGATGGAGAATGG - Intergenic
925812262 2:7712172-7712194 AATTGGCCAGAGATGAAGAAAGG - Intergenic
927480179 2:23447468-23447490 AATTTCCCAGGCAAGGAGAAAGG - Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
932794743 2:74684599-74684621 AAGTTCAAGCAGATGGAGAAGGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933564436 2:83932448-83932470 AATTTACCAAAGATGGGGGAAGG + Intergenic
933631099 2:84659557-84659579 AATTTCTCACTGTTAGAGAAGGG + Intronic
933807652 2:86011900-86011922 AATTTCCCAAGGATGAAGGAAGG - Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
936963237 2:118099019-118099041 AAGTTGCCAGAGATGGAAAATGG + Intronic
938988429 2:136602892-136602914 AATTTCCTAGAGATGTTGAATGG - Intergenic
939629353 2:144515428-144515450 AATTACTCAGAGATGGGGAAGGG + Intronic
940811234 2:158245051-158245073 AAATTCCCACACTGGGAGAATGG + Intronic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941426198 2:165348424-165348446 AAGTCCCCAAAGATAGAGAAAGG + Intronic
942069408 2:172302542-172302564 AATGTCCATCAGCTGGAGAATGG - Intergenic
942199736 2:173559138-173559160 AATTTACCACAGGGGGAGGATGG - Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943326575 2:186505955-186505977 AATTTCCCATGGTTGGAGTAAGG - Intronic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
945300359 2:208210510-208210532 AATCTGCCACAGATGGAAAGTGG - Intergenic
945373737 2:209054107-209054129 CATTTCCAAAAGATTGAGAAAGG + Intergenic
945702399 2:213188448-213188470 AAGTTCCCTCAGATGAAGGAAGG + Intergenic
945913154 2:215672528-215672550 AACTTCCCAAATATGGTGAAAGG + Intergenic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946025969 2:216671892-216671914 GCTTTCCAACAGATGGGGAAGGG + Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
948615072 2:239193256-239193278 AATTTCTCACAGATGGAGGGAGG + Intronic
948997077 2:241586738-241586760 AATTAGACACAGATGAAGAAAGG + Intronic
1169615845 20:7444681-7444703 AATTTCCAGTAGATGGAGGATGG + Intergenic
1170020587 20:11833031-11833053 AATTCCCAACAGAAGTAGAATGG + Intergenic
1170180392 20:13523496-13523518 AATCTCCCACAGAGGGACAGAGG + Intronic
1170274604 20:14570747-14570769 AATCTCCCACAGAAGGACCAGGG - Intronic
1170467244 20:16633455-16633477 AATTTCTCCCAGTTGGTGAATGG - Intergenic
1172478442 20:35256280-35256302 AAGGTCCCACAGTTGGTGAATGG + Intronic
1174126453 20:48310487-48310509 AAGGTCGCACAGCTGGAGAACGG - Intergenic
1174408005 20:50314844-50314866 AATATCCCTCAGCTGGTGAATGG - Intergenic
1175080807 20:56418879-56418901 TATTTACTACATATGGAGAAAGG - Intronic
1176185814 20:63778385-63778407 ATTTTCCCACAGCAAGAGAATGG + Intronic
1177225120 21:18244485-18244507 AATTTAGCACAGAAAGAGAAAGG + Intronic
1177679186 21:24341810-24341832 AATTTTTCACAGATGGGGGAAGG + Intergenic
1177891456 21:26808863-26808885 AATTTACCTCAGGTGGAAAAGGG - Intergenic
1181333364 22:22111613-22111635 AATTTCCCAGAGATGCAGAGAGG - Intergenic
1182157984 22:28093855-28093877 ATTTTCCATCAGATGGGGAAGGG - Intronic
1182166434 22:28178953-28178975 CAATCCCCACAGATGGGGAATGG + Intronic
949106502 3:206077-206099 ACTTTTCCACAAATGGATAATGG - Intronic
949236994 3:1821362-1821384 AATTTTCCAGTGATAGAGAAAGG + Intergenic
950408586 3:12819951-12819973 ACTTTCCCAGAGATGGGGAGGGG + Intronic
950671850 3:14532100-14532122 AAGTTCCCACAGCTGGCGAATGG - Intronic
950764624 3:15264355-15264377 AATTACCAACAGATGCAAAATGG - Intronic
951115038 3:18851127-18851149 GATTTCTCACTGATAGAGAAGGG + Intergenic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953111797 3:39948756-39948778 AATTTCCAACAGTTGATGAAAGG + Intronic
953143421 3:40250338-40250360 ACATTCCAACAGAGGGAGAAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953627407 3:44582093-44582115 AATTTGCCACAGCTGGATACAGG + Intronic
957755423 3:84478665-84478687 AATTTTCCAAATATGGAGAAAGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960039386 3:113134183-113134205 AATTTGCCAAAGTTGTAGAAAGG + Intergenic
960653708 3:119979519-119979541 CACTTCCCAGAGAGGGAGAATGG - Intronic
960690261 3:120339765-120339787 AATTTCCCACAGTTAAAGAAAGG - Intronic
961191732 3:124968052-124968074 AATATCCCACAGATGGGGGAAGG - Exonic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
966077797 3:175959566-175959588 AATTTCTCACAGTGGGAGAAAGG - Intergenic
966475648 3:180342407-180342429 CTTACCCCACAGATGGAGAAGGG - Intergenic
967521661 3:190439377-190439399 AATTTACAATAGATGGAGCAGGG - Intronic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
971521913 4:27564221-27564243 AATTTCCCTCAGTAAGAGAAGGG + Intergenic
975301630 4:72797480-72797502 AATTTCTCCCATTTGGAGAATGG - Intergenic
975896089 4:79092903-79092925 GATTTCTCACTGTTGGAGAAGGG - Intergenic
976719707 4:88158106-88158128 AATTTCATACATTTGGAGAAAGG + Intronic
977129676 4:93219823-93219845 AATTTTTCTTAGATGGAGAAAGG - Intronic
977432337 4:96945950-96945972 AATGTCCCAAATCTGGAGAAAGG + Intergenic
977664651 4:99631997-99632019 AATGTCTCACAGCTGGCGAAAGG + Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980317577 4:131222475-131222497 AGTTTCTCACTGATGGAGAAAGG + Intergenic
980340200 4:131534719-131534741 AAATTCCCATAGAGGGAGACTGG + Intergenic
981584814 4:146289558-146289580 AGTTTCCCAAAGTTGCAGAATGG + Intronic
981731411 4:147903043-147903065 CAATTCCCAAAGTTGGAGAAGGG - Intronic
982266924 4:153546233-153546255 ATTATCTTACAGATGGAGAAGGG + Intronic
982966126 4:161910595-161910617 AATTTGCCACAGATTGAGTATGG - Intronic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985284252 4:188318895-188318917 AATTTCCAACACATGGAGGCTGG - Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
986679024 5:10216556-10216578 GCTTTCCCGAAGATGGAGAAGGG - Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
987907921 5:24103099-24103121 CATTTTCCACTGTTGGAGAATGG - Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
993599775 5:89907413-89907435 AATTTTCCAAAGGTGGAGAGAGG - Intergenic
993860242 5:93127081-93127103 AATTTCCTACAAATGTTGAATGG + Intergenic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995619172 5:114004410-114004432 AATGTCCCACACATTGAGTAGGG + Intergenic
995642376 5:114271815-114271837 AATTTCACACAGAATGAAAATGG - Intergenic
995815535 5:116163859-116163881 AATTTCACACAAATGGAAACTGG - Intronic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
999089142 5:148920394-148920416 AATGCCCCACAGATGTGGAATGG + Intergenic
1000184319 5:158844060-158844082 AGTTTCCCACAGTTGGGGTAAGG - Intronic
1000494998 5:161971372-161971394 AATTTCCCTGAGATGTTGAAAGG + Intergenic
1000649131 5:163794200-163794222 AACTTCCCACAGTGGGAGATTGG - Intergenic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1002068205 5:176663017-176663039 AGGTTCCCACAGATTGAGAGTGG - Intergenic
1002325376 5:178401550-178401572 AATATCCCTCAAATGGAGAATGG - Intronic
1002865529 6:1118855-1118877 AATTTCCCACAGATGAACTTTGG - Intergenic
1003294088 6:4808397-4808419 GATTTCTCACTGCTGGAGAAAGG - Intronic
1003825850 6:9950826-9950848 AATGTCCCCCAGCTGGTGAATGG + Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004635118 6:17459961-17459983 AATTTCCCAGAAATGAAGAAAGG + Intronic
1004820003 6:19357288-19357310 CATTTCTCACAGCTGCAGAAGGG + Intergenic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1006570123 6:34995794-34995816 AATATCCCTCAGCTAGAGAAGGG - Intronic
1006687998 6:35853784-35853806 ACTTTCCCACAGTGGGAGGAAGG + Intronic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008901369 6:56621002-56621024 AATTTACAACAGATGAGGAAAGG + Intronic
1009192081 6:60641457-60641479 ATTTTACCTCAGATAGAGAAAGG - Intergenic
1009371360 6:62907049-62907071 AATTTCCCAAACTTTGAGAAAGG + Intergenic
1010351696 6:74882479-74882501 AATTTCCCACCAATAGAGCATGG + Intergenic
1014433108 6:121392196-121392218 AAAGTCCCAAAGATAGAGAAGGG - Intergenic
1015085190 6:129282395-129282417 CAGTTCCCACATATAGAGAAAGG - Intronic
1015574678 6:134658926-134658948 TATATCCTAAAGATGGAGAAGGG - Intergenic
1015656517 6:135524926-135524948 AATTGACCACAGTTGAAGAAAGG - Intergenic
1015812422 6:137174123-137174145 AGTTTTCCAGAGAGGGAGAAGGG - Intergenic
1015839740 6:137464169-137464191 AAGTGCCCAGAGATGGAGGAAGG - Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1019880467 7:3855679-3855701 AATTTTCCATAGCTGCAGAAAGG + Intronic
1020677796 7:11201424-11201446 AATCTCCCAAAGCTGGAGATGGG - Intergenic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1021192739 7:17641178-17641200 AATATCCCACTGACAGAGAAAGG + Intergenic
1024147818 7:46535198-46535220 ATTTTCCAACAGATTAAGAAAGG + Intergenic
1027932863 7:84561951-84561973 GATTTCCCACATATTGAGGAAGG - Intergenic
1028278195 7:88885654-88885676 AATTTCTGAAAGATGCAGAAAGG - Intronic
1028278251 7:88886768-88886790 AATTTCTGAAAGATGCAGAAAGG + Intronic
1028512709 7:91642773-91642795 AAATTCCCACATAAGCAGAAAGG + Intergenic
1028964170 7:96783164-96783186 AATTTCCAACAGATTGTGACTGG + Intergenic
1029493215 7:100883547-100883569 ATCTTCCCACGGGTGGAGAAAGG + Intronic
1031346184 7:120670418-120670440 AACCTCCCAAAGATGGAGAAGGG + Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032409668 7:131685636-131685658 AATTTCCCAAAGATTTTGAAAGG - Intergenic
1033325242 7:140372241-140372263 AATTTCTCAAAGATACAGAAAGG + Intronic
1034136002 7:148770668-148770690 GCTTTCCCAGAGATGGCGAATGG - Intronic
1036118610 8:5989067-5989089 TATTTCCCAGAGGTGAAGAAAGG + Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1036660779 8:10707057-10707079 AATGTCCCCCTGAGGGAGAAAGG - Intronic
1036949662 8:13129036-13129058 AAGGTCCCACAGAAGGAAAAGGG + Intronic
1039391155 8:37181652-37181674 GTTTTCCCACTAATGGAGAAGGG - Intergenic
1040618220 8:49061491-49061513 AAATGCCCACAGATGGAAATTGG + Intronic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041980378 8:63851353-63851375 AATATCGCACAGATGGAGGATGG - Intergenic
1043085097 8:75819883-75819905 AATTTACCATAGGTGGACAAGGG - Intergenic
1043173798 8:76999316-76999338 AATTTCCCACATTTAGTGAAAGG - Intronic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044630206 8:94271209-94271231 AAGTTCCCACAGCTAGAAAATGG + Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045720430 8:105103400-105103422 CATCTTCCAAAGATGGAGAATGG - Intronic
1045979319 8:108166216-108166238 AATGTCCCTCACCTGGAGAATGG - Intergenic
1046795998 8:118372692-118372714 AATGTCCCACAGCTGGGGGATGG + Intronic
1047844369 8:128789958-128789980 AATTCCCCAGAGATGAAGAAGGG + Intergenic
1048285532 8:133138309-133138331 CATCTACCACAAATGGAGAAGGG - Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048945529 8:139443600-139443622 ACTATCCTACATATGGAGAAGGG + Intergenic
1050157460 9:2682638-2682660 AATTTTCCATAGCAGGAGAAAGG + Intergenic
1050536243 9:6633319-6633341 AATTTCCCAGGGATGGAGTGTGG - Intronic
1051663983 9:19451036-19451058 CCTTTCCCAAAGATGGAAAATGG + Exonic
1052606110 9:30703705-30703727 AAGTTCCCACATATAGACAAGGG + Intergenic
1055783538 9:79846067-79846089 AATTTCCCACAAATATAGAGTGG + Intergenic
1055830174 9:80368938-80368960 AATTTCCCACAGATATAGAAAGG + Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058338958 9:103870125-103870147 AAATTACCACACATCGAGAAAGG - Intergenic
1058775147 9:108275928-108275950 AATGGCCAACAGTTGGAGAATGG - Intergenic
1059096546 9:111422236-111422258 AATTTCCAAGAGATGAAAAAGGG + Intronic
1059502823 9:114769934-114769956 ACTTTTGCACAAATGGAGAAGGG + Intergenic
1059794301 9:117674798-117674820 AATTCTCCAGGGATGGAGAAGGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1062212388 9:135372082-135372104 AATTTGGCAGAGCTGGAGAAGGG - Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1188607838 X:32054750-32054772 AATTTCCTTCACATAGAGAAAGG - Intronic
1189622224 X:42854013-42854035 ATTAACCCACAGATGGGGAAGGG + Intergenic
1189816617 X:44830528-44830550 AATTTCTAACAGATTAAGAAGGG - Intergenic
1189911545 X:45815230-45815252 AATTTCCCAAAGATTAAAAAGGG + Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1193437297 X:81491292-81491314 TATTTCCCAAAGATGAGGAATGG - Intergenic
1196337484 X:114554514-114554536 AGTTTCCAGCAGATAGAGAAGGG - Intergenic
1197251488 X:124220546-124220568 AATGTCCATCAGCTGGAGAATGG - Intronic
1198135286 X:133743565-133743587 AATTTCCCCCACTTGGAGCAAGG - Intronic
1198806464 X:140500118-140500140 AATGTCCAACAAATGGAGAAAGG - Intergenic
1198931962 X:141871786-141871808 CACTTCCCAGAGAGGGAGAATGG + Intronic
1201630201 Y:16063442-16063464 CATTTCCCTGAGAGGGAGAATGG + Intergenic
1201974215 Y:19830890-19830912 AATTTCCCAAAGAGTGATAAGGG - Intergenic
1202189890 Y:22230996-22231018 CACTTCCCAGAGAGGGAGAATGG + Intergenic