ID: 1091795289

View in Genome Browser
Species Human (GRCh38)
Location 12:3294493-3294515
Sequence TGCCAGAGCCAGCCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091795289_1091795300 25 Left 1091795289 12:3294493-3294515 CCCTGCCCAGGCTGGCTCTGGCA No data
Right 1091795300 12:3294541-3294563 AACCCCCAGTGATCTCCACACGG No data
1091795289_1091795297 -6 Left 1091795289 12:3294493-3294515 CCCTGCCCAGGCTGGCTCTGGCA No data
Right 1091795297 12:3294510-3294532 CTGGCAGGGGGCGTGACCTGAGG No data
1091795289_1091795301 26 Left 1091795289 12:3294493-3294515 CCCTGCCCAGGCTGGCTCTGGCA No data
Right 1091795301 12:3294542-3294564 ACCCCCAGTGATCTCCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091795289 Original CRISPR TGCCAGAGCCAGCCTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr