ID: 1091796273

View in Genome Browser
Species Human (GRCh38)
Location 12:3299076-3299098
Sequence GAGAGGAAGAAGAAGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091796273_1091796282 3 Left 1091796273 12:3299076-3299098 CCCGCCACCTTCTTCTTCCTCTC No data
Right 1091796282 12:3299102-3299124 CCTCCCACTCAAGGATGCACTGG No data
1091796273_1091796278 -6 Left 1091796273 12:3299076-3299098 CCCGCCACCTTCTTCTTCCTCTC No data
Right 1091796278 12:3299093-3299115 CCTCTCCTCCCTCCCACTCAAGG No data
1091796273_1091796283 4 Left 1091796273 12:3299076-3299098 CCCGCCACCTTCTTCTTCCTCTC No data
Right 1091796283 12:3299103-3299125 CTCCCACTCAAGGATGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091796273 Original CRISPR GAGAGGAAGAAGAAGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr