ID: 1091796911

View in Genome Browser
Species Human (GRCh38)
Location 12:3302756-3302778
Sequence CTGTGGATATGGAGGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091796904_1091796911 8 Left 1091796904 12:3302725-3302747 CCATGGTTGGTTGAATCCAAGGA No data
Right 1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG No data
1091796900_1091796911 30 Left 1091796900 12:3302703-3302725 CCTTTTTGTTAGTACTTTTATTC No data
Right 1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG No data
1091796906_1091796911 -8 Left 1091796906 12:3302741-3302763 CCAAGGATACAGAACCTGTGGAT No data
Right 1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091796911 Original CRISPR CTGTGGATATGGAGGGCTGA TGG Intergenic
No off target data available for this crispr