ID: 1091801259

View in Genome Browser
Species Human (GRCh38)
Location 12:3326192-3326214
Sequence GACACGGATGGGCCTGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091801259_1091801274 22 Left 1091801259 12:3326192-3326214 CCCCCTGCAGGCCCATCCGTGTC No data
Right 1091801274 12:3326237-3326259 GAATTTTTTATGAAGTTCCTGGG No data
1091801259_1091801273 21 Left 1091801259 12:3326192-3326214 CCCCCTGCAGGCCCATCCGTGTC No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091801259 Original CRISPR GACACGGATGGGCCTGCAGG GGG (reversed) Intergenic
No off target data available for this crispr