ID: 1091801273

View in Genome Browser
Species Human (GRCh38)
Location 12:3326236-3326258
Sequence TGAATTTTTTATGAAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091801260_1091801273 20 Left 1091801260 12:3326193-3326215 CCCCTGCAGGCCCATCCGTGTCT No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801258_1091801273 22 Left 1091801258 12:3326191-3326213 CCCCCCTGCAGGCCCATCCGTGT No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801261_1091801273 19 Left 1091801261 12:3326194-3326216 CCCTGCAGGCCCATCCGTGTCTG No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801262_1091801273 18 Left 1091801262 12:3326195-3326217 CCTGCAGGCCCATCCGTGTCTGT No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801259_1091801273 21 Left 1091801259 12:3326192-3326214 CCCCCTGCAGGCCCATCCGTGTC No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801269_1091801273 5 Left 1091801269 12:3326208-3326230 CCGTGTCTGTGGGAGTGGGACCC No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801257_1091801273 27 Left 1091801257 12:3326186-3326208 CCAGGCCCCCCTGCAGGCCCATC No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801256_1091801273 28 Left 1091801256 12:3326185-3326207 CCCAGGCCCCCCTGCAGGCCCAT No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801265_1091801273 10 Left 1091801265 12:3326203-3326225 CCCATCCGTGTCTGTGGGAGTGG No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data
1091801267_1091801273 9 Left 1091801267 12:3326204-3326226 CCATCCGTGTCTGTGGGAGTGGG No data
Right 1091801273 12:3326236-3326258 TGAATTTTTTATGAAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091801273 Original CRISPR TGAATTTTTTATGAAGTTCC TGG Intergenic
No off target data available for this crispr