ID: 1091802507

View in Genome Browser
Species Human (GRCh38)
Location 12:3333640-3333662
Sequence CTAGAGAGGACCTCGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091802495_1091802507 30 Left 1091802495 12:3333587-3333609 CCCAGGTTTCCCCTCTCTGTGCT No data
Right 1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG No data
1091802501_1091802507 19 Left 1091802501 12:3333598-3333620 CCTCTCTGTGCTGGGTTTCGATA No data
Right 1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG No data
1091802499_1091802507 21 Left 1091802499 12:3333596-3333618 CCCCTCTCTGTGCTGGGTTTCGA No data
Right 1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG No data
1091802496_1091802507 29 Left 1091802496 12:3333588-3333610 CCAGGTTTCCCCTCTCTGTGCTG No data
Right 1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG No data
1091802500_1091802507 20 Left 1091802500 12:3333597-3333619 CCCTCTCTGTGCTGGGTTTCGAT No data
Right 1091802507 12:3333640-3333662 CTAGAGAGGACCTCGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091802507 Original CRISPR CTAGAGAGGACCTCGTTCTG GGG Intergenic
No off target data available for this crispr