ID: 1091803867

View in Genome Browser
Species Human (GRCh38)
Location 12:3342410-3342432
Sequence CAGCCTGAACAAAGGGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091803867_1091803877 29 Left 1091803867 12:3342410-3342432 CCTTTGGCCCTTTGTTCAGGCTG No data
Right 1091803877 12:3342462-3342484 GTCCCAATGCTCCAGGGCTCAGG No data
1091803867_1091803875 22 Left 1091803867 12:3342410-3342432 CCTTTGGCCCTTTGTTCAGGCTG No data
Right 1091803875 12:3342455-3342477 CTACTCTGTCCCAATGCTCCAGG No data
1091803867_1091803876 23 Left 1091803867 12:3342410-3342432 CCTTTGGCCCTTTGTTCAGGCTG No data
Right 1091803876 12:3342456-3342478 TACTCTGTCCCAATGCTCCAGGG No data
1091803867_1091803878 30 Left 1091803867 12:3342410-3342432 CCTTTGGCCCTTTGTTCAGGCTG No data
Right 1091803878 12:3342463-3342485 TCCCAATGCTCCAGGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091803867 Original CRISPR CAGCCTGAACAAAGGGCCAA AGG (reversed) Intergenic
No off target data available for this crispr