ID: 1091804950

View in Genome Browser
Species Human (GRCh38)
Location 12:3349203-3349225
Sequence TGGGCTTCATTCGTGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091804950_1091804962 28 Left 1091804950 12:3349203-3349225 CCAACCCCCACGAATGAAGCCCA No data
Right 1091804962 12:3349254-3349276 CAACATCTGAGCTAAGTTCTGGG No data
1091804950_1091804961 27 Left 1091804950 12:3349203-3349225 CCAACCCCCACGAATGAAGCCCA No data
Right 1091804961 12:3349253-3349275 ACAACATCTGAGCTAAGTTCTGG No data
1091804950_1091804963 29 Left 1091804950 12:3349203-3349225 CCAACCCCCACGAATGAAGCCCA No data
Right 1091804963 12:3349255-3349277 AACATCTGAGCTAAGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091804950 Original CRISPR TGGGCTTCATTCGTGGGGGT TGG (reversed) Intergenic
No off target data available for this crispr