ID: 1091805348

View in Genome Browser
Species Human (GRCh38)
Location 12:3352160-3352182
Sequence GTGGAGAGAGGGTCTTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091805348_1091805352 -9 Left 1091805348 12:3352160-3352182 CCTTTTGAAGACCCTCTCTCCAC No data
Right 1091805352 12:3352174-3352196 TCTCTCCACTGCTGGTTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091805348 Original CRISPR GTGGAGAGAGGGTCTTCAAA AGG (reversed) Intergenic