ID: 1091806445

View in Genome Browser
Species Human (GRCh38)
Location 12:3360005-3360027
Sequence TCCAGGGATCCACAGTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091806438_1091806445 30 Left 1091806438 12:3359952-3359974 CCTTCCTGCTCTCTATTTGCATA No data
Right 1091806445 12:3360005-3360027 TCCAGGGATCCACAGTGCATGGG No data
1091806442_1091806445 -7 Left 1091806442 12:3359989-3360011 CCTGTGAGCACAGAATTCCAGGG No data
Right 1091806445 12:3360005-3360027 TCCAGGGATCCACAGTGCATGGG No data
1091806440_1091806445 26 Left 1091806440 12:3359956-3359978 CCTGCTCTCTATTTGCATATGGT No data
Right 1091806445 12:3360005-3360027 TCCAGGGATCCACAGTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091806445 Original CRISPR TCCAGGGATCCACAGTGCAT GGG Intergenic
No off target data available for this crispr