ID: 1091806913

View in Genome Browser
Species Human (GRCh38)
Location 12:3363485-3363507
Sequence GCTGCTGGTGTGAGGGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091806906_1091806913 4 Left 1091806906 12:3363458-3363480 CCGGCATGTAACTTAGATGAACC No data
Right 1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG No data
1091806905_1091806913 12 Left 1091806905 12:3363450-3363472 CCTGGAAGCCGGCATGTAACTTA No data
Right 1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG No data
1091806904_1091806913 16 Left 1091806904 12:3363446-3363468 CCTACCTGGAAGCCGGCATGTAA No data
Right 1091806913 12:3363485-3363507 GCTGCTGGTGTGAGGGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091806913 Original CRISPR GCTGCTGGTGTGAGGGATCC AGG Intergenic
No off target data available for this crispr